Engineering strain for producing pentamethylene diamine and application thereof

Abstract

The invention provides an engineering strain for producing pentamethylene diamine and application thereof, and the engineering strain is prepared by a method comprising the following steps: transferring a lysine decarboxylase integration vector into escherichia coli, the lysine decarboxylase integration vector comprising a suicide replicon, a promoter, a target gene, a resistance gene and an integration site; screening a positive strain, and knocking out a suicide replicon and a resistance gene in the positive strain to obtain the engineering strain, the suicide type replicon is an R6K replicon; the target gene is a lysine decarboxylase gene CadA; the promoter at the upstream of the target gene is a T7 promoter; the resistance gene is a chloramphenicol resistance gene; the integration site is an IS sequence, the IS sequence is an IS3 sequence, and the base sequence of the IS3 sequence is shown as SEQ ID No.2. The engineering strain has higher environmental adaptability, can better produce pentamethylene diamine, and has important application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the creation of Escherichia coli integrated with exogenous lysine decarboxylase and its application, and especially to an engineering strain for producing pentamethylenediamine and its application. Background Art

[0002] Pentamethylenediamine is a product of lysine decarboxylation. It can be used with monomeric dibasic acids to synthesize a variety of bio-based nylon 5X, such as nylon 52, 5T, 54, 56, etc. Different types of nylon 5X have the characteristics of high temperature resistance, medium-high temperature resistance, medium-low temperature resistance and low temperature resistance. Therefore, compared with traditional petroleum-based nylons, such as nylon 6 and nylon 66, its advantages are more obvious. It is a new nylon material recognized worldwide and has more development prospects in the fields of fibers and engineering plastics in the future.

[0003] At present, there are two main ways to biosynthesize pentamethylenediamine at home and abroad, namely, de novo synthesis by microbial fermentation and whole-cell catalysis. Lysine decarboxylase, as a key enzyme in the biosynthesis of pentamethylenediamine, has a wide range of sources, such as Escherichia coli, Hafnia alvei, Bacillushalodurans, Bacillus cereus, Bacterium cadaveris, Burkholderia vietnamensia, Chromobacterium violaceum, Salmonella typhimurium and other bacteria. Therefore, the creation of efficient lysine decarboxylase engineering strains is the key to the biosynthesis of pentamethylenediamine.

[0004] E. coli is easy to manipulate genes and has many vectors for protein expression in vivo. It is currently the most commonly used expression host. At present, the metabolic engineering strategy based on E. coli generally uses plasmids as expression vectors, but the presence of plasmids often leads to excessive metabolic burden on strains, unstable separation, and loss of functional plasmids during passage and industrial amplification. At present, in the research on the production of pentamethylenediamine using E. coli, plasmids are basically used as expression vectors. Although its yield is higher than that of the original strain, the genetic stability of the target gene in the host bacteria has not been solved. Therefore, in order to effectively solve this series of problems, it is particularly important to integrate the target gene into the E. coli genome. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention aims to provide an engineered strain for stably producing pentamethylenediamine and its application. The present invention integrates exogenous lysine decarboxylase into the common Escherichia coli protein expression host genome, thereby improving the genetic stability of the target gene in the host bacteria, thereby changing the growth characteristics of Escherichia coli, making it have stronger environmental adaptability and better prospects for pentamethylenediamine production.

[0006] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides an engineered strain for stably producing pentamethylenediamine, wherein the engineered strain is prepared by a method comprising the following steps:

[0008] Introducing a lysine decarboxylase integration vector into Escherichia coli, wherein the lysine decarboxylase integration vector includes a suicide replicon, a promoter, a target gene, a resistance gene and an integration site; screening positive strains, knocking out the suicide replicon and the resistance gene in the positive strains, and obtaining the engineered strain;

[0009] The suicide replicon is an R6K replicon;

[0010] The target gene is a lysine decarboxylase gene CadA, and the lysine decarboxylase gene is from Hafnia alvei, Bacillus halodurans, Bacillus cereus, Bacterium cadaveris, Burkholderia vietnamensia, Chromobacterium violaceum, Vibrio cholerae, Streptomyces polosus, Selenomonas ruminantium, Edwardsiella tarda, Salmonella typhimurium, Salmonella bongori, Serratia, Bordetella, Vibrio cholerae. Any one of the lysine decarboxylase genes and mutants thereof of bacteria such as Aeromonas cholerae, unclassified Aeromonas or Klebsiella;

[0011] The promoter upstream of the target gene is a T7 promoter;

[0012] The resistance gene is a chloramphenicol resistance gene;

[0013] The integration site is an IS sequence, the IS sequence is an IS3 sequence, and the base sequence of the IS sequence is shown in SEQ ID No. 2.

[0014] The sequence of the lysine decarboxylase gene CadA in the present invention is a codon-optimized sequence, and the synonymous codons of the gene are adjusted according to the codon preference of Escherichia coli to achieve the purpose of eliminating rare codons, thereby improving translation efficiency.

[0015] The invention provides a genetically engineered bacterium integrated with exogenous lysine decarboxylase, and also provides an Escherichia coli genome integration vector. The integration method is simple and genetically stable, and can ultimately achieve stable and efficient expression of the exogenous lysine decarboxylase, thereby promoting the production of pentamethylenediamine.

[0016] In the present invention, the integration vector uses a suicide replicon, preferably an R6K replicon. The plasmid containing the R6K replicon can only be replicated and amplified in a host bacteria containing the pir gene. In ordinary strains (such as the Escherichia coli host in the present invention), it can only grow on a resistant culture medium if it is integrated into the genome. This eliminates the background interference of the plasmid template and facilitates the subsequent screening of strains.

[0017] Preferably, the method for constructing the lysine decarboxylase integration vector comprises the following steps:

[0018] (1) constructing a lysine decarboxylase gene expression cassette, wherein the expression cassette is: promoter T7-protein binding site-RBS-target gene CadA-terminator;

[0019] (2) constructing an integration frame, wherein the integration frame is: integration site IS3--R6K replicon--chloramphenicol resistance gene fragment;

[0020] (3) constructing a lysine decarboxylase gene integration vector, and connecting the integration frame and the lysine decarboxylase gene expression frame by enzyme cutting to obtain a lysine decarboxylase integration vector, wherein the lysine decarboxylase integration vector comprises: integration site IS3--R6K replicon--chloramphenicol resistance gene fragment--lysine decarboxylase gene expression frame.

[0021] Preferably, the IS3 sequence in the genome is used as the integration site, and the λ-Red recombination system in the pECCas plasmid is used to assist in the integration of lysine decarboxylase.

[0022] In the present invention, the integration site is a transposable element IS sequence. The IS sequence is a normal component of the E. coli genome, has a large number of copies, and as the simplest transposable element, does not contain any host gene; based on the integration vector, the IS sequence is used as a homologous sequence to achieve recombination between the integration vector and the E. coli genome using the single exchange principle, thereby achieving the integration of multiple copies of the target gene into the E. coli genome.

[0023] Preferably, the suicide replicon and resistance gene in the positive transformed bacteria are knocked out using CRISPR / Cpf1 combined with λ-Red recombination system.

[0024] The present invention provides an Escherichia coli gene knockout strategy based on CRISPR / Cpf1 combined with λ-Red recombination system, which can achieve the knockout of target fragments in Escherichia coli B series strains to some extent.

[0025] The conventional CRISPR / Cas9 gene editing system of Escherichia coli (pCas plasmid and pTargetF double plasmid system) is difficult to achieve the knockout of the target gene in the B series strains of Escherichia coli (such as E.coli BL21 (DE3)), which is manifested as difficulty in obtaining knockout transformants. In order to solve the above technical problems and eliminate the resistance screening markers in the integrated strains of the present invention, the present invention provides an Escherichia coli gene editing strategy based on CRISPR / Cpf1 combined with λ-Red recombination system, which mainly includes plasmid pJYS3_ΔcrtYf based on CRISPR / Cpf1 system, and plasmid pECCas containing λ-Red recombination system eliminates the resistance screening marker. The above-mentioned Escherichia coli gene editing strategy was successfully used to achieve the knockout of the R6K replicon-chloramphenicol resistance gene fragment in the exogenous lysine decarboxylase integrated strain.

[0026] Preferably, the knockout step is specifically as follows: transferring the pEC_ΔR6K-CM plasmid and the upstream and downstream homologous arms of the R6K replicon-chloramphenicol resistance gene into the positive transformed bacteria, and knocking out the R6K replicon-chloramphenicol resistance gene fragment.

[0027] Preferably, the pEC_ΔR6K-CM plasmid includes FnCpf1 nuclease, RED recombinase and crRNA recognition sequence.

[0028] Preferably, the crRNA recognition sequence is a crRNA that recognizes the R6K replicon-chloramphenicol resistance gene fragment.

[0029] Preferably, the base sequence of the crRNA that recognizes the R6K replicon-chloramphenicol resistance gene fragment is shown in SEQ ID No.19.

[0030] SEQ ID No.19:

[0031] 5'-ttagccatgagagcttagtacgtt-3'.

[0032] Preferably, the base sequence of the upstream and downstream homologous arms of the R6K replicon-chloramphenicol resistance gene is as shown in SEQ ID No.20.

[0033] SEQ ID No.20:

[0034] 5'tcccacgaaaaagtgaaagtactcaacgagctaaggcagttttatcctcttgatgagcttctcagggctgcggagataccgcgcagta'.

[0035] Preferably, the Escherichia coli is E. coli BL21 (DE3).

[0036] In a second aspect, the present invention provides a use of the engineered strain for stably producing pentamethylenediamine as described in the first aspect in producing pentamethylenediamine.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] In the Escherichia coli engineered strain constructed by the present invention, after the target gene is integrated into the genome, the problem of unstable plasmid separation in traditional engineered strains is avoided, the genetic stability of the exogenous gene is effectively maintained, and it can be used for the efficient and stable production of pentamethylenediamine. In addition, no additional antibiotics need to be added during its production, further reducing the production cost, the operation steps and the production cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the integration vector map constructed by the present invention.

[0040] Figure 2 It is a schematic diagram of the creation of the lysine decarboxylase integrated strain of the present invention.

[0041] Figure 3 This is the knockout vector map constructed by the present invention.

[0042] Figure 4 This is a comparison of the pentamethylenediamine production after catalysis by the integrated strain EC-IS3_ΔR6K-Chl and the engineered strain M6 whole cells. DETAILED DESCRIPTION

[0043] The technical solution of the present invention is further described below by specific implementation methods. It should be understood by those skilled in the art that the embodiments are only to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0044] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0045] The integration vector construction method in the following embodiments is referenced to: Su, B., Song, D. & Zhu, H. Homology-dependent recombination of large synthetic pathways into E. coli genome via λ-Red and CRISPR / Cas9dependent selection methodology. Microb Cell Fact 2020, 19: 108.; the method for detecting lysine and pentamethylenediamine is referenced to: Patent application number CN115125229A, invention name: A Chinese patent for a lysine decarboxylase mutant for synthesizing pentamethylenediamine.

[0046] The plasmids and their sources in the present invention are as follows:

[0047] pKD3 plasmid: https: / / www.addgene.org / 45604 / (Addgene:Plasmid#45604).

[0048] pDM4 plasmid: http: / / www.miaolingbio.com / plasmid / P0103.html (Miaoling Bio: Plasmid#P0103).

[0049] pECCas plasmid: https: / / www.addgene.org / 73227 / (Addgene:Plasmid#73227).

[0050] pJYS3_ΔcrtYf plasmid: https: / / www.addgene.org / 85542 / (Addgene:Plasmid#85542).

[0051] Example 1 Integration site IS sequence determination

[0052] The genome of Escherichia coli BL21 (DE3) with a total sequence length of 4.6 Mbp (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_013167015.1 / ) was searched for IS sequences on the ISfinder online website (https: / / www-is.biotoul.fr / blast.php), and the IS3 sequence in the genome was finally selected as the integration site. The integration sequence contained 5 copies in the genome, and the homologous sequence length was about 1000 bp.

[0053] The base sequence of the IS3 sequence is SEQ ID No.2:

[0054] 5’ atcactggtctttccgaaaggctgtaagaaataacttcgttgttgaagagatctattactggagacaaatacagcttgcgcccattgactg caaattcagtaacatcggtaacccacttctcgtttggccgcgtagccttgaaatctctttggagaacattaggggcggtttgccctacctctcctctgtaagagcggtatcgcttgaccttaatcgctgctttaagtgagagggttcccatcaggcgctgaacagctttatggttaatctgtttcccttctcgatgaagagacagcgttaccctacggtatccgtatcggcctctattctcgtgataaatctcactaatacgctttttaacgtccgcatacttgtcaggcttgctgagagcctttagatgataataaaacgtactgcgcggtatctccgcagccctgagaagctcatcaagaggataaaactgccttagctcgttgagtactttcactttttcgtgggatgagctaaggctttcagcttttttagatacataagccgcgtttcaagaaatcgaacttgcctttcaagatcctcaatgcgtcggtcttttgacagctccaatgctgatgccgctttttctggatcaactgatattgcaatgtttcttttggtgccaatcttgagcgcgcgtaaaccagcttctccgcgctcttcatagaccttcagccacctggctacagaaccactaccagcaagcataaagtgagcagcagcctgattaagggacatgtgctgctcgatcacagctttcacgaccttaatacgcaactctggatcagcactaacgcctttaggtttgggaattaaacctttttctccatgtttttcatagagggcaacccatgtcctgacctgggttcgggggacaccaaaacgtgccgaga 3’。

[0055] Construction of the integration vector in Example 2

[0056] Using pKD3 or pDM4 plasmid as template, primers Chl_R6K_F and Chl_R6K_R were used to amplify R6K replicon and chloramphenicol resistance gene carrying FRT site. Using E. coli BL21 (DE3) genome as template, primers IS3_F and IS3_R were used to amplify integration site IS3. Using overlapping PCR principle, IS3 sequence was linked with R6K replicon and chloramphenicol resistance to obtain IS3-R6K-Chl fragment (integration site IS3 fragment--R6K replicon--chloramphenicol resistance gene).

[0057] Using the pET-Duet-Δldc-pelB-CadB plasmid previously preserved in the laboratory as a template (the plasmid has been disclosed in patent application number CN115125229A, invention name: A Chinese patent application for a lysine decarboxylase mutant for synthesizing pentamethylenediamine), primers CadA_F and CadA_R were used to amplify promoter T7, CadA gene, and terminator to obtain a target gene expression cassette (promoter T7-protein binding site-RBS-target gene CadA-terminator).

[0058] The target gene is a mutant of lysine decarboxylase from Edwardsiella, and the base sequence of the target gene is SEQ ID No. 1:

[0059]

[0060] The IS3-R6K-Chl fragment and the target gene expression frame were digested separately and connected with T4 DNA ligase to construct a recombinant plasmid. The recombinant plasmid was transformed into Escherichia coli competent cells DH5α (λpir + ), pick chloramphenicol resistance (Chl + The colonies grown on the plate with resistance (50 mg / L) were extracted and sequenced, and the verified recombinant plasmid was named: pRC-IS3 (integration vector map see Figure 1 ).

[0061] The specific sequences of the primers are as follows:

[0062] Chl_R6K_F, SEQ ID No.3:

[0063] 5'-aaaactgcagagtagggaactgccaggcatcaa-3';

[0064] Chl_R6K_R, SEQ ID No.4:

[0065] 5'-agtggggagatctcactaaggtgcctcactgattaagcattgg-3';

[0066] IS3_F, SEQ ID No.5:

[0067] 5'-ccggaattcaagagattttcttgtcccgcatg-3';

[0068] IS3_R, SEQ ID No.6:

[0069] 5'-tgcttaatcagtgaggcaccttagtgagatctctcccactgacgtat-3';

[0070] CadA_F, SEQ ID No.7:

[0071] 5'-ccggaattcgagctcagctttattgagt-3';

[0072] CadA_R, SEQ ID No.8:

[0073] 5'-aaaactgcagtgctggtttaccggtttattgacta-3'.

[0074] Example 3 Construction of integrated genetically engineered bacteria

[0075] Schematic diagram of the creation of lysine decarboxylase integrated strain Figure 2 The pECCas plasmid was transformed into Escherichia coli BL21 (DE3) chemically competent cells and cultured at 37°C in a medium containing kanamycin (Kanamycin + The screening was carried out on LB solid plates containing 50 mg / L.

[0076] Pick the positive clones and add them to 5 mL LB (with Kan + The cells were cultured in shaker at 37°C overnight in culture tubes.

[0077] Take out the positive clones cultured overnight, take 500 μL and mix it in 50 mL LB (Kan + The cells were cultured in shake flasks at 37°C and 200 rpm, during which arabinose with a final concentration of 50 mM was added to induce full expression of the RED recombinase.

[0078] Waiting for OD 600 =0.5-0.6, take out the shaking flask, put it in an ice bath for 15 min, centrifuge it at 4°C, 4000 rpm for 10 min, and discard the supernatant.

[0079] Add 50 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0080] Add 25 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0081] Add 15 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0082] Add 10 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0083] Add 500 μL of pre-cooled 10% glycerol to resuspend, and dispense 100 μL each into 5 sterile 1.5 mL EP tubes for later use, named here as pECCas electroporation competent state, and store at -80°C.

[0084] Extract the pRC-IS3 plasmid, take 10 μL of pRC-IS3 plasmid and 100 μL of pECCas to electroporate competent cells, mix well and place in an ice bath for 2 to 3 minutes, then transfer all into a pre-cooled 0.1 cm electroporation cup, 1.8 KV, 5 ms after electroporation, immediately add 1 mL of LB (antibiotic-free) medium and aspirate into a sterile EP tube and culture at 37 ° C, 180 rpm for 1.5 hours.

[0085] After the culture was completed, the mixture was centrifuged at 4000 rpm for 3 min, and 100 μL was resuspended and coated on the double antibody (Kan+ +Chl + The strains were screened on resistant plates. The colonies that could grow on the resistant plates were the strains whose plasmids were integrated into the genome. The strains whose genomes were extracted and verified to be correct were named RC-IS3. The exogenous gene fragments in the integrated strains were expressed as multiple copies.

[0086] Example 4 Elimination of pECCas plasmid in RC-IS3 strain

[0087] Take the RC-IS3 strain from the -80℃ freezer and plate it on a resistance plate (Kan + +Chl + ) and cultured at 37°C overnight.

[0088] A single clone was picked from the resistant plate and cultured in a culture tube containing 5 mL LB liquid medium (containing 5 g / L glucose) at 37°C overnight. Then 50 μL was spread on a LB solid plate containing 5 g / L glucose and 10 g / L sucrose and cultured at 37°C overnight.

[0089] Pick a single clone from the plate and culture it in 900 μL LB liquid medium at 37°C, 200 rpm for 3-4 hours. + Resistance, Chl + Streak on the resistance plate, culture at 37℃ overnight, Chl + See the bacteria growing on the resistant plate + The absence of bacteria on the resistance plates indicated that the pECCas plasmid was successfully eliminated.

[0090] From Chl + Single clones were picked from the resistance plates and incubated in 5 mL LB liquid medium (Chl + ), LB liquid medium (Kan + ) and cultured overnight at 37°C. + Resistance does not grow bacteria, Chl + The growth of resistant bacteria indicated that the target gene integrated strain of Escherichia coli BL21 (DE3) without pECCas plasmid had been successfully obtained. The bacteria were preserved at -80°C with 50% glycerol, and the obtained strain was named EC-IS3.

[0091] Prepare EC-IS3 electroporation competent cells. The preparation steps are as follows:

[0092] Take 100 μL of EC-IS3 strain from -80℃ cryotube and mix it in 5 mL LB (with Chl + The cells were cultured in shaker at 37°C overnight in culture tubes.

[0093] Take 500 μL of overnight cultured bacterial solution and mix it in 50 mL LB (Chl +Resistance) were cultured in a shake flask at 37°C, 200 rpm, and the OD 600 =0.5-0.6, take out the shaking flask, put it in an ice bath for 15 min, centrifuge it at 4°C, 4000 rpm for 10 min, and discard the supernatant.

[0094] Add 50 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0095] Add 25 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0096] Add 15 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0097] Add 10 mL of pre-cooled 10% glycerol to resuspend, centrifuge at 4000 rpm for 15 min at 4°C, and discard the supernatant.

[0098] Add 500 μL of pre-cooled 10% glycerol to resuspend, and dispense 100 μL each into 5 sterile 1.5 mL EP tubes for later use, here named EC-IS3 electroporation competent state, and stored at -80°C.

[0099] Example 5 Knockout of the R6K-Chl fragment in the EC-IS3 strain

[0100] This embodiment provides an E. coli knockout strategy based on CRISPR / Cpf1 combined with λ-Red recombination system, which can achieve the knockout of target fragments in E. coli B series strains to some extent.

[0101] Using the pECCas plasmid as a template, primers pECCas_F and pECCas_R were used to amplify the other parts except the Cas9 nuclease, which was named EC.

[0102] Using pJYS3_ΔcrtYf plasmid as template, primers FnCpf1_F and FnCpf1_R were used to amplify the FnCpf1 nuclease and crRNA recognition sequences, which were named FnCpf1.

[0103] Based on the principle of homologous recombination, The Ultra One Step Cloning Kit assembled EC and FnCpf1 by the Gibson method and transformed them into E. coli DH5α competent cells. After verification, the plasmid pEC_FnCpf1 was obtained. The map of the constructed knockout vector is shown in Figure 3 shown.

[0104] Using pEC_FnCpf1 as a template, primers R6K-Chl_crRNA_F and R6K-Chl_crRNA_R were used to amplify the whole plasmid PCR to replace the crRNA of the crtYf gene with the crRNA of the R6K-Chl fragment, which is named fragment A here; the base sequence of the crRNA that recognizes the R6K replicon-chloramphenicol resistance gene fragment is shown in SEQ ID No.19.

[0105] SEQ ID No. 19: 5'-ttagccatgagagcttagtacgtt-3'.

[0106] use Fragment A was circularized using the Ultra One Step Cloning Kit and transformed into E. coli DH5α competent cells. After verification, the plasmid pEC_ΔR6K-CM was obtained.

[0107] Using pRC-IS3 plasmid as template, primers R6K-Chl_Up_F and R6K-Chl_Up_R were used to amplify the upstream homology arm of the R6K-Chl fragment, which was named fragment B here; primers R6K-Chl_Down_F and R6K-Chl_Down_R were used to amplify the downstream homology arm of the R6K-Chl fragment, which was named fragment C here.

[0108] Based on the principle of overlap extension PCR, primers R6K-Chl_Up_F and R6K-Chl_Down_R were used to amplify fragments B and C, and the resulting extension product was named fragment D (R6K replicon - upstream and downstream homologous arms of chloramphenicol resistance gene).

[0109] The base sequence of fragment D is shown in SEQ ID No.20:

[0110] 5’tcccacgaaaaagtgaaagtactcaacgagctaaggcagttttatcctcttgatgagcttctcagggctgcggagataccgcgcagta cgttttattatcatctaaaggctctcagcaagcctgacaagtatgcggacgttaaaaagcgtattagtgagatttatcacgagaatagaggccgatacggataccgtagggtaacgctgtctcttcatcgagaagggaaacagattaaccataaagctgttcagcgcctgatgggaaccctctcacttaaagcagcgattaaggtcaagcgataccgctcttacagaggagaggtagggcaaaccgcccctaatgttctccaaagagatttcaaggctacgcggccaaacgagaagtgggttaccgatgttactgaatttgcagtcaatgggcgcaagctgtatttgtctccagtaatagatctcttcaacaacgaagttatttcttacagcctttcggaaagaccagtgatcgagagtagggaactgccaggcatcaaataaaatgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgggagcggatttgaacgttgcgaagcaacggcccggagggtggcgggcaggacgcccgccataaactgccaggcatcaaattaagcagaaggccatcctgacggatggcctttttgcgtggccagtgccaagcttgcatgcagattgcagcattacacgtcttgagcgattgtgtaggctggagctgcttc-3’。

[0111] Extract pEC_ΔR6K-CM plasmid, take 10μL pEC_ΔR6K-CM plasmid and fragment D with a total amount of about 300ng, mix well, and transform 100μL EC-IS3 electroporation competent cells. After ice bathing for 2-3 minutes, transfer all into a pre-cooled 0.1cm electroporation cup, 1.8KV, 5ms after electroporation, immediately add 1mL LB (antibiotic-free) medium and aspirate into a sterile EP tube at 37℃, 180rpm and culture for 1.5h. After the culture is completed, centrifuge at 4000rpm for 3min, keep 100μL and resuspend and apply on Kan + Screening was performed on plates, and the colonies on the resistant plates were verified by colony PCR and the correct strain was named EC-IS3-1 after the genome was extracted.

[0112] The pEC_ΔR6K-CM plasmid was eliminated from the EC-IS3-1 strain in the same manner as in Example 4. The strain that was successfully eliminated was named EC-IS3_ΔR6K-Chl. Thus, the R6K-Chl fragment was successfully knocked out from the EC-IS3 strain.

[0113] The specific sequences of the primers are as follows:

[0114] pECCas_F, SEQ ID No.9:

[0115] 5'-cagtagaaattcagtatattttagatgaagattatttc-3';

[0116] pECCas_R, SEQ ID No.10:

[0117] 5'-agatggacatttttgcctcctaaaataaa-3';

[0118] FnCpf1_F, SEQ ID No.11:

[0119] 5'-gaggcaaaaatgtccatctaccaag-3';

[0120] FnCpf1_R, SEQ ID No.12:

[0121] 5'-tctaaaatatactgaatttctactgttgtagat-3';

[0122] R6K-Chl_Up_F, SEQ ID No.13:

[0123] 5'-tccattatactcccacgaaaaagtgaaagtactcaacgag-3';

[0124] R6K-Chl_Up_R, SEQ ID No.14:

[0125] 5'-ctactctcgatcactggtctttccgaaaggc-3';

[0126] R6K-Chl_Down_F, SEQ ID No.15:

[0127] 5'-gaccagtgatcgagagtagggactgcc-3';

[0128] R6K-Chl_Down_R, SEQ ID No.16:

[0129] 5'-caaaagtaggaagcagctccagcctacacaatc-3';

[0130] R6K-Chl_crRNA_F, SEQ ID No.17:

[0131] 5'-atttcattatggtatctacaacagtagaaattc-3';

[0132] R6K-Chl_crRNA_R, SEQ ID No.18:

[0133] 5'-ttgtagataccataatgaaataagatcactacatttaaataaaacgaaaggctcagt-3';

[0134] Example 6 Integration of genetically engineered bacteria EC-IS3_ΔR6K-Chl whole cell catalysis

[0135] In this example, the ability of whole cells of the lysine decarboxylase mutant M6 containing the pET-Duet-Δldc-pelB-CadB plasmid and the integrated genetically engineered bacterium EC-IS3_ΔR6K-Chl to catalyze the production of pentamethylenediamine was detected. By comparison, the performance of the integrated strain EC-IS3_ΔR6K-Chl in producing pentamethylenediamine was evaluated.

[0136] The lysine decarboxylase mutant M6 strain was inoculated into 5 mL LB liquid culture medium containing 100 mg / L ampicillin antibiotic, and cultured overnight at 200 rpm and 37°C to obtain seed solution; the EC-IS3_ΔR6K-Chl strain was inoculated into 5 mL LB liquid culture medium (without antibiotics), and cultured overnight at 200 rpm and 37°C to obtain seed solution.

[0137] The overnight seed solution was transferred to 50 mL LB liquid medium containing 100 mg / L ampicillin antibiotic and no antibiotics at a transfer volume of 1% by volume, and cultured at 200 rpm and 37°C until OD 600 =0.6-0.8, add IPTG with a final concentration of 0.1 mM for induction, continue to culture at 20°C for 20 h, centrifuge at 6000 rpm for 6 min, collect the bacteria, and freeze at -80°C for later use.

[0138] The bacteria were resuspended in pH 8.0, 50 mM phosphate buffer, and then 500 μL whole-cell catalysis was performed, wherein PLP 0.1 mM, lysine hydrochloride 1 M, the OD of the bacterial suspension was 1.5, 500 rpm, 50°C catalysis for 0.5 h, centrifugation at 12000 rpm for 2 min, the supernatant was diluted 100 times and the content of pentamethylenediamine was detected by high performance liquid chromatography.

[0139] The whole-cell catalytic results of mutant M6 and EC-IS3_ΔR6K-Chl strains containing pET-Duet-Δldc-pelB-CadB plasmid are shown in Figure 4 As shown, the initial concentration of lysine hydrochloride was 1M. After 0.5h of whole-cell catalysis in the EC-IS3_ΔR6K-Chl strain, the concentration of lysine hydrochloride decreased to 603.40±4.92mM, and the concentration of pentamethylenediamine increased to 405.13±1.68mM. After 0.5h of whole-cell catalysis in the mutant M6 strain, the concentration of lysine hydrochloride decreased to 649.17±1.11mM, and the concentration of pentamethylenediamine increased to 342.63±0.37mM. Figure 4 It can be seen that after the exogenous lysine decarboxylase was integrated into the genome, its pentamethylenediamine production performance was comparable to that of the mutant M6 containing the pET-Duet-Δldc-pelB-CadB plasmid.

[0140] Example 7 Whole-cell catalysis of integrated genetically engineered bacteria

[0141] This example constructs a new integration vector (1-3), which differs from pRC-IS3 in that:

[0142] The target gene on the integration vector 1 is from the lysine decarboxylase of Aeromonas sp., and is a lysine decarboxylase mutant of Aeromonas sp.;

[0143] The target gene on integration vector 2 is from lysine decarboxylase of Salmonella (Latin: salmonella), which is a lysine decarboxylase mutant of Salmonella;

[0144] The target gene on integration vector 3 is from lysine decarboxylase of Serratia (Latin: Serratia), and is a mutant of lysine decarboxylase of Serratia;

[0145] SEQ ID No.21 (Lysine decarboxylase mutant of Aeromonas spp.):

[0146]

[0147] SEQ ID No.22 (Lysine decarboxylase mutant of Salmonella):

[0148]

[0149] SEQ ID No.23 (Lysine decarboxylase mutant of Serratia spp.):

[0150]

[0151] The construction method of the integration vector refers to the construction method of pRC-IS3, and the above integration vectors are used to construct engineering strains for producing pentamethylenediamine, and engineering strain 1, engineering strain 2, and engineering strain 3 are obtained respectively.

[0152] Referring to the detection method of Example 6, the ability of different engineered strains to produce pentamethylenediamine was investigated. The detection results are shown in Table 1.

[0153] Table 1

[0154] Engineered strains Initial lysine concentration (M) Lysine concentration after 0.5h (mM) Pentylene diamine concentration after 0.5h (mM) Engineered strain 1 1.0 638.87±1.06 364.99±0.29 Engineered strain 2 1.0 634.24±2.69 355.22±0.26 Engineered strain 3 1.0 649.17±1.36 342.62±0.45

[0155] From the results in Table 1, it can be seen that the engineered strains 1-3 can all catalyze the synthesis of pentamethylenediamine from lysine. The catalytic abilities of the above-mentioned engineered strains are comparable, all have good catalytic effects, and have important application values.

[0156] In summary, the lysine decarboxylase integrated strain provided by the present invention can efficiently catalyze the synthesis of pentamethylenediamine, and the catalytic ability is equivalent to that of the mutant containing the plasmid. Since the target gene is integrated into the host genome, the genetic stability of the target gene in the host bacteria is improved, thereby changing the growth characteristics of Escherichia coli. Therefore, the engineered strain created in the present invention has stronger environmental adaptability and better prospects for pentamethylenediamine production.

[0157] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. An engineered strain for producing pentamethylenediamine, characterized in that: The engineered strain is prepared by a method comprising the following steps: Introducing a lysine decarboxylase integration vector into Escherichia coli, wherein the lysine decarboxylase integration vector includes a suicide replicon, a promoter, a target gene, a resistance gene and an integration site; screening positive strains, knocking out the suicide replicon and the resistance gene in the positive strains, and obtaining the engineered strain; The suicide replicon is an R6K replicon; The target gene is a lysine decarboxylase gene CadA, and the lysine decarboxylase gene is from Hafnia alvei, Bacillus halodurans, Bacillus cereus, Bacterium cadaveris, Burkholderia vietnamensia, Chromobacterium violaceum, Vibrio cholerae, Streptomyces polosus, Selenomonas ruminantium, Edwardsiella tarda, Salmonella typhimurium, Salmonella bongori, Serratia, Bordetella, Vibrio cholerae. cholerae), unclassified Aeromonas or Klebsiella, and any one of the lysine decarboxylase genes and mutants thereof; The promoter upstream of the target gene is a T7 promoter; The resistance gene is a chloramphenicol resistance gene; The integration site is an IS sequence, the IS sequence is an IS3 sequence, and the base sequence of the IS3 sequence is shown in SEQ ID No.

2.

2. The engineered strain for stably producing pentamethylenediamine according to claim 1, characterized in that: The method for constructing the lysine decarboxylase integration vector comprises the following steps: (1) constructing a lysine decarboxylase gene expression cassette, wherein the expression cassette is: promoter T7-protein binding site-RBS-target gene CadA-terminator; (2) constructing an integration frame, wherein the integration frame is: integration site IS3--R6K replicon--chloramphenicol resistance gene fragment; (3) constructing a lysine decarboxylase gene integration vector, and connecting the integration frame and the lysine decarboxylase gene expression frame by enzyme cutting to obtain a lysine decarboxylase integration vector, wherein the lysine decarboxylase integration vector comprises: integration site IS3--R6K replicon--chloramphenicol resistance gene fragment--lysine decarboxylase gene expression frame.

3. The engineered strain for stably producing pentamethylenediamine according to claim 2, characterized in that: The IS3 sequence in the genome was used as the integration site, and the λ-Red recombination system in the pECCas plasmid was used to assist in the integration of lysine decarboxylase.

4. The engineered strain for stably producing pentamethylenediamine according to any one of claims 1 to 3, characterized in that: The suicide replicon and resistance gene in the positive transformed bacteria were knocked out using CRISPR / Cpf1 combined with λ-Red recombination system.

5. The engineered strain for stably producing pentamethylenediamine according to claim 4, characterized in that: The knockout step is specifically as follows: the pEC_ΔR6K-CM plasmid and the upstream and downstream homologous arms of the R6K replicon-chloramphenicol resistance gene are transferred into the positive transformed bacteria, and the R6K replicon-chloramphenicol resistance gene fragment is knocked out.

6. The engineered strain for stably producing pentamethylenediamine according to claim 5, characterized in that: The pEC_ΔR6K-CM plasmid includes FnCpf1 nuclease, RED recombinase and crRNA recognition sequence; Preferably, the crRNA recognition sequence is a crRNA that recognizes the R6K replicon-chloramphenicol resistance gene fragment.

7. The engineered strain for stably producing pentamethylenediamine according to claim 6, characterized in that: The base sequence of the crRNA that recognizes the R6K replicon-chloramphenicol resistance gene fragment is shown in SEQ ID No.

19.

8. The engineered strain for stably producing pentamethylenediamine according to claim 5, characterized in that: The base sequence of the upstream and downstream homologous arms of the R6K replicon-chloramphenicol resistance gene is shown in SEQ ID No.

20.

9. The engineered strain for stably producing pentamethylenediamine according to any one of claims 1 to 8, characterized in that: The Escherichia coli is E. coli BL21 (DE3).

10. Use of the engineered strain stably producing pentamethylenediamine according to any one of claims 1 to 9 in producing pentamethylenediamine.

Images