Lhfpl5 gene enhancer and application thereof

Abstract

The invention discloses an Lhfpl5 gene enhancer and application thereof, and belongs to the field of gene engineering. According to the invention, the Lhfpl5 gene enhancer is found, the enhancer can obviously enhance the expression of the Lhfpl5 gene or other genes in inner ear internal and external hair cells, and the gene enhancer can be used for gene therapy of deafness by utilizing the capability of specifically enhancing the gene expression in the inner ear internal and external hair cells; the recombinant DNA containing the Lhfpl5 gene enhancer, or a carrier and other biological materials are prepared through integration, gene expression regulation and control research is carried out, and the application prospect is good.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to an Lhfpl5 gene enhancer and a use thereof. Background Art

[0002] Enhancers are typical cis-regulatory elements in the genome, located upstream, downstream or within the gene transcription start point, and can be far away from or even span hundreds of thousands of base pairs. The core function of enhancers is to enhance the transcriptional activity of target genes by binding to proteins such as transcription factors. They play a key role in the spatiotemporal regulation of gene expression, that is, expressing specific genes at a specific time and space to ensure the normal cell differentiation, organ development and physiological functions. During development, different cell types need to express different genes, and enhancers can precisely regulate the spatiotemporal expression of these genes. The characteristics of enhancers make them have potential application value in cell and gene therapy.

[0003] The LHFPL5 (Lipoma HMGIC Fusion Partner-Like 5) gene is located on human chromosome 6q14.1 and encodes a four-transmembrane protein. This protein is mainly expressed in the inner and outer hair cells of the inner ear, helping the hair cells sense the mechanical vibrations of sound waves and convert them into electrical signals. It also works with TMC1, another important protein in the auditory mechanical channel, to ensure the normal operation of the ion channel. The absence or mutation of LHFPL5 may lead to loss of channel function, leading to sensorineural hearing loss. For deafness caused by LHFPL5 gene mutation, the normal function of the gene can be restored by gene replacement or gene repair to restore hearing. Mouse model studies have shown that hearing can be partially restored by injecting a vector carrying the normal Lhfpl5 gene into the cochlea, but non-specific expression of the normal Lhfpl5 gene may be harmful to the host.

[0004] The enhancer in the Lhfpl5 gene can regulate the activation of the gene in a specific developmental stage or cell type to ensure that the gene is expressed at the right time and place to avoid its non-specific expression causing harm to the host. However, there has been no research and application of the enhancer of the Lhfpl5 gene. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a Lhfpl5 gene enhancer, the nucleotide sequence of the enhancer is shown in SEQ ID No.1.

[0006] The present invention also provides a recombinant vector, which is a plasmid containing an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No. 1.

[0007] Furthermore, the target gene includes Lhfpl5 gene and / or reporter gene EGFP.

[0008] Furthermore, the plasmid includes a pWHERE vector plasmid vector.

[0009] The present invention also provides the aforementioned enhancer and the use of the aforementioned recombinant vector in preparing a reagent for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea.

[0010] Furthermore, the target gene includes Lhfpl5 gene and / or reporter gene EGFP.

[0011] The present invention also provides the aforementioned enhancer and the use of the aforementioned recombinant vector in preparing a medicine for treating deafness.

[0012] The present invention also provides a method for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea for non-therapeutic purposes, comprising introducing the aforementioned enhancer or the aforementioned recombinant vector into an organism.

[0013] Furthermore, the method includes injecting the recombinant vector into animal fertilized eggs.

[0014] The present invention also provides the use of the transgenic animals obtained by the above method in the research of gene expression regulation.

[0015] Compared with the prior art, the present invention has the following significant effects:

[0016] The present invention studies and analyzes the physical and functional units of the Lhfpl5 gene, and according to the genomic location, determines that the enhancer shown in SEQ ID No. 1 is the Lhfpl5 gene enhancer. The enhancer can significantly enhance the expression of the Lhfpl5 gene itself or other genes in the inner and outer hair cells of the inner ear, and can be used for gene therapy of deafness by utilizing its ability to specifically enhance gene expression in the inner and outer hair cells of the inner ear; it can be integrated and prepared into recombinant DNA containing the Lhfpl5 gene enhancer, or vectors and other biological materials for conducting gene expression regulation research, and has good application prospects.

[0017] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0018] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the vector structure after Lhfpl5 enhancer and EGFP were cloned into the pWHERE plasmid;

[0020] Figure 2 Comparison of the fluorescence effect of the mouse inner ear when using different enhancers; among them: Group A empty vector-EGFP has no fluorescence signal in the mouse cochlea; Group B Lhfpl5 gene enhancer-EGFP fluorescence signal in the mouse cochlea (top: whole inner ear cochlear basilar membrane; middle: magnified view; bottom: side view). DETAILED DESCRIPTION

[0021] The raw materials, reagents and equipment used in the specific embodiments of the present invention are all known products and can be purchased commercially.

[0022] Example 1 Cloning and activity analysis of the Lhfpl5 gene enhancer sequence

[0023] 1. Acquisition and localization of the Lhfpl5 gene enhancer

[0024] The Lhfpl5 gene (NCBI accession number LOCUS NC_000083) is specifically expressed in the hair cells of the inner ear of animals, and has no expression activity in other cell types of the inner ear. For this reason, the physical and functional units of the Lhfpl5 gene were studied and analyzed in the early stage, and an enhancer that enables the Lhfpl5 gene to be specifically expressed in the inner ear was found, and its nucleotide sequence is SEQ ID No. 1:

[0025] GCAGACCCGATTCTCAGTCTGACACCCCGGCCACTCACCTGGCCTGAGTTCTCCCC

[0026] AGAGGTCTGTTTCCAAGCCTTAGTGGGCAGGAGGGGACAACAGGCCATGATGATCA

[0027] TATCAGGAAGAGGCAGTGGAGATTGAGTCCAAAGAGTAGTGAGATGGCTGTGCTTG

[0028] CCAGCTGTTCTTCCACCGCAGGGCTCGGGATGATGTGGAGACACACCATCCTTTCTT

[0029] AGAGCTTTCTGCCCACCTCCAGCATCATCCAATAGGTGTGCTTGCTGAGCAGGCAAT

[0030] AGAAATGAGACCTGGGTGGAGGAACACCAGGCCATTTGAGCCAGACGCTATTCTGGG

[0031] TCACAGAGCCGGTAGCAGAGATGGCTAAGTGCCATCCCATGAAGCATTTATGTGGAG

[0032] CAAAGAAAAAGGTGGTGCCATGTTCCACTCTGTGTCAGGGAGGAGAGGGCTGAAC

[0033] AGGTGTTTCTCATAGCCATCAACTGGGGGATTCATGTGTCAGCTCAAAAATTTCCAC

[0034] AAAGCCAGAGGATGGGGGTAGGAGAAGAGAACTGATGCCCCTGCAAAGGTGGCGG

[0035] CACTCAGATGGAGCTCAGGGTGCAGGCTGAGCATGGGCTCAGTTGTTTTCCCTGAG

[0036] TCTTGGTAACCTCCTGCCTTAGTGAGACTGTATTATTATCCAAATTCCCATACATGAAG

[0037] GAGCCTAGACAACAGGCATTTCTTC

[0038] According to genomic positioning, the enhancer shown in SEQ ID No. 1 is located in the intron of the Lhfpl5 gene, and it is determined that the enhancer is the Lhfpl5 gene enhancer.

[0039] 2. Validation of enhanced target gene expression

[0040] 1. Methods

[0041] (1) The Hsp68 promoter (vector PCR4-Hsp68::lacZ-H11 from addgene, Plasmid #139099) sequence was cloned upstream of the reporter gene EGFP, and the activity of the enhancer was tested by detecting the expression of the EGFP gene. The pWHERE vector, EGFP gene and Hsp68 promoter sequence were connected by Qingke Biotechnology Co., Ltd., and the successfully connected vector was named pWHERE-promoter vector, in which the nucleotide sequence of the reporter gene EGFP (SEQ ID No. 2) was: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGA GCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGAT CCGCCACAACATCGAGGACGGCAGTGCAGCTCGCCGACCACTACCAGCAGAACCCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0042] (2) extracting DNA from the inner ear tissue of mice and amplifying the enhancer sequence of the Lhfpl5 gene (shown in SEQ ID No. 1, with a sequence length of 703 bp);

[0043] The primer pairs used for PCR amplification of the enhancer region of the Lhfpl5 gene are as follows:

[0044] Lhfpl5-F: 5'-CGCGGATCCGCAGACCCGATTCTCAGTCT-3' (SEQ ID No. 3) Lhfpl5-R: 5'-CCGCTCGAGCCTGTTGTCTAGGCTCCTTCA-3' (SEQ ID No. 4).

[0045] (3) The enhancer sequence was transferred into the pWHERE-promoter vector using the BamHI and XhoI restriction sites. The constructed plasmid is shown in Figure 1 .

[0046] (4) Preparation of linearized transgenic DNA: Use restriction endonuclease PacI to cut the plasmid to linearize the exogenous DNA from the vector, and then purify the exogenous DNA to remove impurities and enzymes. Finally, dissolve the purified DNA in TE buffer and adjust the concentration to 1-2 ng / μL, and store at 4°C for future use.

[0047] (5) Obtaining mouse fertilized eggs: Select healthy, age-appropriate female mice (usually 3-4 weeks old) for superovulation. 12-14 hours after superovulation, mate these female mice with healthy, sexually mature male mice. The next morning, dissect the female mice and collect the fertilized eggs in their oviducts.

[0048] (6) Microinjection of exogenous DNA: The collected fertilized eggs are placed in a culture medium containing HEPES buffer, and the DNA solution is directly injected into the fertilized eggs using a microinjection needle. After the injection is completed, the fertilized eggs are transferred to a culture dish containing an appropriate culture medium and continue to incubate. They are implanted into the oviduct of a pseudopregnant mouse, usually 10-20 fertilized eggs are implanted into each mouse. After the transplantation is completed, the mouse is raised alone and its pregnancy status is observed. At the same time, a control is set up, that is, exogenous DNA linearized with the pWHERE-promoter vector without the Lhfpl5 gene enhancer sequence is microinjected in the same way as a control.

[0049] (7) Identification of transgenic mice: After successful embryo transfer, wait for the required period to take out the mouse embryo for testing. Cut off the head of the mouse embryo, open the skull, remove the brain tissue, expose the temporal bone and remove the cochlea. After the cochlea is removed, move it into a culture dish containing pre-cooled 1XPBS; under a dissecting microscope, use a sharp needle to pick up the bone wall of the volute at the apex of the cochlea, and then peel the volute along the gap between the spiral ligament and the volute until the complete spiral ligament is fully exposed; then use a sharp needle or tweezers to separate and remove the entire spiral ligament, and immediately transfer it to a 2ml centrifuge tube containing 4% paraformaldehyde and fix it at 4℃ for 30 minutes. After 30 minutes, remove the spiral ligament under a dissecting microscope, and lay the entire cochlear basement membrane flat on a slide, add DAPI and seal the slide. Finally, under a fluorescence microscope, select the DAPI fluorescence channel to observe the nuclear signal of the basement membrane, the 488nm laser excitation channel to observe the EGFP signal, and take pictures of the entire complete basement membrane, the top, middle and base of the local basement membrane.

[0050] 2. Results

[0051] according to Figure 2 It can be seen that in embryos injected with the Lhfpl5 gene enhancer-EGFP, the inner and outer hair cells of the cochlea showed green fluorescence ( Figure 2 B) In embryos injected with exogenous genes without the Lhfpl5 gene enhancer sequence, there is no fluorescent signal in the inner and outer hair cells of the cochlea ( Figure 2 A) This indicates that the EGFP gene can be specifically expressed in inner and outer hair cells under the action of the Lhfpl5 enhancer, but cannot be specifically expressed in inner and outer hair cells without the action of the Lhfpl5 gene enhancer.

[0052] The experimental results show that the Lhfpl5 gene enhancer can specifically enhance the expression of the EGFP gene in inner and outer hair cells, which is consistent with the expression characteristics of Lhfpl5 in existing literature, verifying that the enhancer is the Lhfpl5 gene enhancer.

[0053] In summary, the present invention determines that the enhancer shown in SEQ ID No. 1 is the Lhfpl5 gene enhancer, which can significantly enhance the expression of the Lhfpl5 gene itself or other genes in the inner and outer hair cells of the inner ear. By utilizing its ability to specifically enhance gene expression in the inner and outer hair cells of the inner ear, it can be used for gene therapy of deafness; it can be integrated into a recombinant DNA containing the Lhfpl5 gene enhancer, or a vector or other biological material for conducting gene expression regulation research, and has good application prospects.

Claims

1. A Lhfpl5 gene enhancer, characterized in that: The nucleotide sequence of the enhancer is shown in SEQ ID No.

1.

2. A recombinant vector, characterized in that: It is a plasmid containing an enhancer and a target gene as shown in the nucleotide sequence of SEQ ID No.

1.

3. The recombinant vector according to claim 2, characterized in that: The target gene includes Lhfpl5 gene and / or reporter gene EGFP.

4. The recombinant vector according to claim 2 or 3, characterized in that: The plasmid includes a pWHERE vector plasmid vector.

5. Use of the enhancer according to claim 1 and the recombinant vector according to any one of claims 2 to 4 in the preparation of an agent for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea.

6. The use according to claim 5, characterized in that: The target gene includes Lhfpl5 gene and / or reporter gene EGFP.

7. Use of the enhancer according to claim 1 and the recombinant vector according to any one of claims 2 to 4 in the preparation of a drug for treating deafness.

8. A method for promoting the specific expression of a target gene in inner and outer hair cells of the cochlea for non-therapeutic purposes, characterized in that: The method comprises introducing the enhancer according to claim 1 or the recombinant vector according to any one of claims 2 to 4 into an organism.

9. The method according to claim 8, characterized in that: The method comprises injecting the recombinant vector according to any one of claims 2 to 4 into an animal fertilized egg.

10. Use of the transgenic animal obtained by the method of claim 8 or 9 in research on gene expression regulation.

Images