Rice NIGT gene family and its application in improving plant iron deficiency tolerance
By regulating the rice NIGT gene family, especially by overexpressing and mutants of the OsNIGT1 protein, the problem of iron deficiency in rice has been solved, the iron deficiency tolerance of rice has been improved, and plant health and crop yield have been enhanced.
Patent Information
- Application Number
- CN202411571933.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-06
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-11-06
AI Technical Summary
In existing technologies, the iron deficiency problem in rice makes it difficult to supplement iron nutrition through daily diet, which leads to health problems caused by iron deficiency among residents in some parts of the world. Furthermore, iron deficiency stress is harmful to rice growth, and there is a lack of effective gene regulation methods.
By overexpressing the rice NIGT gene family, especially the OsNIGT1 protein and mutants of the OsNIGT gene, the iron deficiency tolerance of rice can be improved, thereby enhancing the rice's ability to adapt to iron deficiency by regulating iron homeostasis.
Significantly improving the tolerance of rice plants to iron deficiency, alleviating iron deficiency symptoms, and improving plant health and crop yield has important theoretical and practical significance.
Smart Images
Figure CN119351414B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of plant genetic engineering, and particularly relates to a rice NIGT gene family and its application in improving the iron deficiency tolerance of plants. BACKGROUND
[0002] Iron is an essential trace element for plant growth and development, and plays an important role in many physiological and metabolic processes such as DNA and protein synthesis, photosynthesis and respiration, electron transport, and enzymatic reactions. At the same time, iron is also the most needed trace element for the human body, and is involved in the synthesis of hemoglobin and the transport of oxygen in the human body. Therefore, iron deficiency is one of the major nutritional deficiencies in the world, and restricts the health of about 2 billion people globally, leading to a variety of adverse effects such as anemia, fatigue, poor fetal development, and cognitive impairment in children. Although there are many iron nutritional supplements, the high cost makes it difficult for residents in poor and developing countries to afford them, and the "hidden hunger" caused by iron deficiency is still a major livelihood problem in these regions. Supplementing iron nutrition from daily meals is the most direct and economical solution, and rice is one of the three major food crops in the world, with more than 50% of the world's population relying on rice as their staple food. Therefore, improving the iron deficiency tolerance of rice provides a new method for solving the above problems.
[0003] Iron is often present in the form of insoluble Fe 3+ in soil, and the water-soluble and exchangeable Fe 2+ that can be absorbed and utilized by plants is relatively small, resulting in poor Fe availability in soil and iron deficiency. To cope with iron deficiency stress, plants have evolved two sets of iron absorption strategies. Non-herbaceous plants use a reduction strategy: iron reductase FRO2 reduces Fe 3+ to Fe 2+ , and iron transporter IRT1 transports Fe 2+ into cells for absorption and utilization; herbaceous plants use a chelation strategy: plants secrete deoxymugineic acid to chelate Fe 3+ in soil, and iron transporter YSL family transports chelated Fe 3+ into the cell body. In addition, in dicotyledonous plants, iron deficiency activates the expression of transcription factor FIT / AtbHLH29 , FIT interacts with other transcription factors (including bHLHs and EIN3 / EIL1 ), and induces the expression of iron uptake gene FRO2 and IRT1 . AtBTS / AtBTSL1 / AtBTSL2 and OsHRZ1 / OsHRZ2OsIRO2, which is considered as a potential Fe sensor in Arabidopsis and rice, contains a hemerythrin domain at the N-terminal region that can bind Fe and a RING domain at the C-terminal region that contributes to ubiquitination by E3 ubiquitin ligase activity to regulate Fe homeostasis.
[0004] IRON MAN IMA OsIRO2, which is considered as a potential Fe sensor in Arabidopsis and rice, contains a hemerythrin domain at the N-terminal region that can bind Fe and a RING domain at the C-terminal region that contributes to ubiquitination by E3 ubiquitin ligase activity to regulate Fe homeostasis. NIGT (NITRATE-INDUCIBLE GARP-TYPE TRANSCRIPTIONAL REPRESSOR ) SUMMARY
[0005] The present application aims to provide a rice NIGT gene family and its application in improving the iron deficiency tolerance of plants.
[0006] The present application aims to provide a rice NIGT gene family, which comprises OsNIGT1 OsIRO1 gene, OsNIGT2 OsIRO2 gene and OsNIGT3 OsIRO3 gene, the polynucleotide sequence of which is shown in (a), (b), (c) or (d):
[0007] (a) the polynucleotide shown in SEQ ID No: 1-3; or
[0008] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1-3 under stringent hybridization conditions, the protein encoded by the polynucleotide still having the function of improving the iron deficiency tolerance of plants;
[0009] (c) a polynucleotide that is at least 90% or more homologous to the polynucleotide shown in SEQ ID No: 1-3; or
[0010] (d) a polynucleotide mutant obtained by deleting, substituting or inserting one or more bases on the basis of the polynucleotide shown in SEQ ID No: 1-3, and the protein encoded by the polynucleotide mutant still having the function of improving the iron deficiency tolerance of plants.
[0011] The present application aims to provide a rice NIGT protein family, which comprises OsNIGT1 protein, OsNIGT2 protein and OsNIGT3 protein, the amino acid sequence of which is shown in (a), (b) or (c):
[0012] (a) the amino acid sequence shown in SEQ ID No: 4-6; or
[0013] (b) an amino acid having at least 90% or above homology with the amino acid shown in SEQ ID No: 4-6; or
[0014] (c) a protein mutant obtained by deleting, substituting or inserting one or more amino acids based on the protein shown in SEQ ID No: 4-6, and the protein still has the function of improving the iron deficiency tolerance of plants.
[0015] The vector containing the rice NIGT gene.
[0016] The engineering bacteria containing the vector of the rice NIGT gene.
[0017] The primer for amplifying any fragment of the rice NIGT gene.
[0018] The rice NIGT gene in improving the iron deficiency tolerance of plants.
[0019] A method for improving the iron deficiency tolerance of rice, which improves the expression level of NIGT protein in rice.
[0020] The beneficial effects of the present application: the present application first identifies NIGT the gene expression can obviously improve the iron deficiency tolerance of rice plants, OsNIGT1 protein, OsNIGT2 protein, OsNIGT3 protein mutation and its combined mutation make the iron deficiency symptom of rice leaf serious, and the overexpression of OsNIGT1 protein makes the iron deficiency symptom of rice leaf alleviate. The protein and its encoding gene of the present application have important theoretical and practical significance for improving the iron deficiency symptom of plants and the yield of crops, will play an important role in crop genetic breeding, and has wide application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The rice OsNIGT gene family members are identified and the conserved domain analysis is carried out;
[0022] In the figure, A is the rice OsNIGT gene family evolution and conserved motif analysis; B is the conserved domain analysis of the rice OsNIGT gene family members; C is the expression pattern analysis of the rice OsNIGT gene family members under different treatment conditions.
[0023] Figure 2 The identification of the rice OsNIGT gene transgenic plants;
[0024] Figure A is a rice osnigt1 gene, rice osnigt2 gene and rice osnigt3 sequencing identification peak map of gene edited plants; B is a rice OsNIGT1-OE western blot identification map of overexpression plants.
[0025] Figure 3 for rice OsNIGT1-OE and osnigt123-cas9 analysis under different iron nutrient conditions;
[0026] Figure A is a rice SSBM, OsNIGT1-OE and osnigt123-cas9 phenotype analysis of the strain under different nutrient conditions; B is a rice SSBM, OsNIGT1-OE and osnigt123-cas9 SPAD value analysis of the strain under different nutrient conditions. DETAILED DESCRIPTION
[0027] In order to facilitate the understanding of the present application, the present application will be described more fully below. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.
[0028] Experimental materials used in the following examples: rice inbred line material: SSBM; strains: E. coli strain DH5a, Agrobacterium strain EHA105; vectors: overexpression vector pPZP122-3xFLAG, gene editing vector pYLCRISPR-Cas9P35s.
[0029] Example 1 Identification and expression pattern analysis of rice OsNIGT gene family
[0030] Experimental method: Taking the AtNIGT protein sequence of Arabidopsis (http: / / www.arabidopsis.org) as the reference sequence, the local BLASTP of the Linux system was used to screen the threshold of 1e-5, and the protein sequence of the candidate gene was obtained. Combined with SMART (http: / / smart.embl.de / smart / batch.pl) and NCBI-CDD (https: / / www.ncbi.nlm.nih.gov / cdd / ) verification of the candidate sequence containing the MYB conserved domain, after removing the redundant sequence, the OsNIGT gene family member sequence of rice was obtained, and was named according to the position of the gene on the chromosome skeleton. NJ phylogenetic tree was constructed using MegaX, with bootstrap parameter of 1000 and other parameters by default. The motif arrangement distribution of OsNIGT protein was analyzed using online website MEME (https: / / meme-suite.org / meme / tools / meme). The rice RNA-Seq samples were treated as follows: after SSBM was cultured in normal nutrient solution for 7 days, it was further cultured in normal nutrient solution, phosphorus-deficient nutrient solution and iron-deficient nutrient solution for 14 days, respectively. The 4th leaf of rice was taken, RNA was extracted and RNA-seq library sequencing was performed, three biological replicates were taken for each treatment, and three technical replicates were included.
[0031] The experimental results are shown in Figure 1 , as shown in Figure 1 A and Figure 1 B, five OsNIGT gene family members were identified in the whole genome of rice, and were named OsNIGT1 - OsNIGT5 Bioinformatics analysis found that they had similar conserved motif arrangement, and all contained MYB conserved domain. Based on the expression pattern analysis of transcriptome sequencing (C), the OsNIGT gene family in rice was strongly induced under phosphorus deficiency conditions, and was inhibited under iron deficiency conditions, suggesting that the gene was an activator of phosphorus deficiency response, and was an inhibitor of iron deficiency response, which may play an important role in the response of rice to phosphorus deficiency and iron deficiency. The next step of this study will continue to explore the function of the gene. Figure 1 OsNIGT OsNIGT
[0032] Example 2 Preparation of rice OsNIGT1 overexpression and osnigt123 three mutant transgenic plants
[0033] According to OsNIGT1 The full-length CDS sequence of the gene was cloned using RT-PCR method with primer 5.0 software to design primers: 5'-ATGGAGGTGGACCACGCGGACCGCG-3' (SEQ ID No: 7) and 5'-CGCGGTCCGCGTGGTCCACCTCCAT-3' (SEQ ID No: 8) OsNIGT1 The full-length of the gene was constructed and the 35S::pPZP122-3xFLAG-OsNIGT1 overexpression vector was constructed by Infusion method. The osnigt1 / 2 / 3-cas9 vector was constructed with the target primers of "osnigt1-U6b-F: gttGCGCGCCGTCGCGGTCCGCG (SEQ ID No: 9)", "osnigt1-U6b-R: AAACCGCGGACCGCGACGGCGCG (SEQ ID No: 10)", "osnigt2-U6a-F: gccGGCGCTTAGCTTGCAGGCTC (SEQ ID No: 11)", "osnigt2-U6a-R: AAACGAGCCTGCAAGCTAAGCGC (SEQ ID No: 12)", "osnigt3-U3-F: ggcACATCTTGAGATCCAGGCTC (SEQ ID No: 13)", and "osnigt3-U3-R: AAACGAGCCTGGATCTCAAGATG (SEQ ID No: 14)". After the above vectors were successfully constructed, they were transformed into EHA105a Agrobacterium competent cells, and the rice callus was infected. After tissue culture, the successfully edited T0 generation transgenic plants were obtained. After the seeds were collected by continuous culture, the homozygous vector-free T1 generation rice plants were obtained. osnigt123 Three mutants.
[0034] The experimental results are shown in Figure 2 After gene cloning, vector construction, genetic transformation and tissue culture, the T1 generation transgenic rice plants were obtained. After PCR identification and sequencing, it was found that OsNIGT1 the gene was mutated and 1 bp was deleted, resulting in a frameshift mutation Figure 2 A); after PCR identification and sequencing, it was found that OsNIG2 the gene was deleted by 2 bp, resulting in a frameshift mutation Figure 2 A), after PCR identification and sequencing, it was found that OsNIG3 a base substitution occurred, resulting in a gene mutation Figure 2 A). Figure 2 B analysis showed that after western blot test, the target gene band could be detected using anti-flag antibody, indicating that the constructed overexpression vector had been transformed into the plant body, and theOsNIGT1-OE Overexpression plants. The transgenic plant materials obtained in the above experiments provide materials for further experimental research.
[0035] Example 3 Application of rice OsNIGT gene family in improving iron deficiency tolerance of plants
[0036] SSBM, OsNIGT1-OE and osnigt123-cas9 Rice seeds were directly germinated in normal rice nutrient solution, phosphorus-deficient rice nutrient solution, iron-deficient rice nutrient solution, and phosphorus-deficient and iron-deficient rice nutrient solution. After seven days of treatment, the phenotypes were recorded by taking photos and the SPAD values of rice leaves were measured.
[0037] The experimental results are shown in Figure 3 . As shown in Figure 3 A, under normal culture conditions, SSBM, OsNIGT1-OE and osnigt123- cas9 The leaves of the rice plants of the lines did not show differences and were green. Under iron-deficient conditions, the leaves of the rice plants of all lines showed the symptoms of yellowing due to deficiency, but it was observed that OsNIGT1-OE The overexpression plants showed relatively weak symptoms of iron deficiency under iron-deficient conditions and the leaves could maintain a light green color, while osnigt123-cas9 The leaves of the rice plants showed more severe symptoms of iron deficiency and the SPAD values were significantly lower than those of the SSBM lines under iron-deficient conditions Figure 3 B. The above results show that OsNIGT is a positive regulator under iron-deficient conditions in rice, overexpression of OsNIGT can improve the iron deficiency tolerance of rice plants, and mutation of OsNIGT results in a decrease in the tolerance of rice plants under iron-deficient conditions.
[0038] The above examples only express several embodiments of the present application and are described in more detail and in more detail, but should not be construed as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.
Claims
1. overexpression OsNIGT1 The use of genes in improving iron deficiency tolerance in rice, characterized in that, The OsNIGT1 The nucleotide sequence of the gene is shown as SEQ ID No:
1.
2. A method for increasing iron deficiency tolerance in rice, characterized by, increasing the expression level of OsNIGT1 protein in rice; the amino acid sequence of the OsNIGT1 protein is shown as SEQ ID No: 4.