Method for in-situ hybridization tissue permeabilization of thick tissue

Abstract

The invention relates to the technical field of in-situ hybridization sample treatment, in particular to a method for in-situ hybridization tissue permeabilization of thick tissue. The method specifically comprises the following steps: fixing a sample, permeabilizing by using a hydrochloric acid solution, and incubating by using a hydrochloric acid solution containing pepsin, so as to complete the tissue permeabilization of the thick tissue. Compared with the prior art, the method for in-situ hybridization tissue permeabilization of the thick tissue has the advantages that the detection performance of in-situ hybridization is better, meanwhile, the efficiency of detecting the type of the thick tissue by an original in-situ detection method can be improved, and the sample application range of an in-situ detection technology is widened.

Description

Technical Field

[0001] The present application relates to the technical field of in situ hybridization sample processing, and in particular to a method for tissue permeabilization for in situ hybridization of thick tissues. Background Art

[0002] In situ studies of RNA molecules in thick tissue samples are usually more conducive to understanding gene expression patterns and spatial position relationships. However, since thick tissues often have low transparency and high autofluorescence background, techniques including single-molecule in situ hybridization are difficult to achieve high signal-to-noise ratio detection. The hybridization chain reaction (HCR) relies on a cascade signal amplification pathway, does not require enzyme participation in the entire process, and can be adapted to a variety of different environments. It is widely used in in situ RNA analysis studies of intact vertebrate embryos.

[0003] RNA in situ detection technology based on dual-ligation probes and rolling circle amplification has been applied to the detection of a variety of samples of conventional thickness, including cell slides, (fixed) frozen tissue sections (thickness 10μm) and paraffin sections (thickness 5μm). However, there are still limitations for the detection of intact embryonic tissues (thickness of tens to hundreds of μm).

[0004] Therefore, it is necessary to further explore and develop how to apply this detection technology to the detection of tissue samples with higher thickness. Summary of the invention

[0005] The present application provides a method for tissue permeabilization of thick tissues for in situ hybridization. The method is applicable to tissue permeabilization of thick tissues based on dual-ligation probes and rolling circle amplification in situ detection technology, which improves the detection performance of in situ hybridization and increases the sample application range of in situ detection technology.

[0006] The present application provides a method for tissue permeabilization for in situ hybridization of thick tissues, using the following technical solution:

[0007] A method for tissue permeabilization for in situ hybridization of thick tissues, the method specifically comprising: fixing the sample and first permeabilizing it with a hydrochloric acid solution, and then incubating it with a hydrochloric acid solution containing pepsin, thereby completing the tissue permeabilization of the thick tissue.

[0008] Optionally, the temperature for permeabilization using hydrochloric acid solution is 25-46°C.

[0009] Optionally, the temperature for permeabilization using hydrochloric acid solution is 37°C.

[0010] Optionally, the incubation temperature using the hydrochloric acid solution containing pepsin is 25-46°C.

[0011] Optionally, the incubation temperature using the hydrochloric acid solution containing pepsin is 37°C.

[0012] Optionally, the permeabilization time using the hydrochloric acid solution is 5-120 min.

[0013] Optionally, the permeabilization time using the hydrochloric acid solution is 30 minutes.

[0014] Optionally, the incubation time with the hydrochloric acid solution containing pepsin is 5-120 min.

[0015] Optionally, the incubation time with the hydrochloric acid solution containing pepsin is 30 minutes.

[0016] Optionally, in the pepsin-containing hydrochloric acid solution, the concentration of pepsin is 0.1-0.5 mg / mL.

[0017] Optionally, in the pepsin-containing hydrochloric acid solution, the concentration of pepsin is 0.3 mg / mL.

[0018] Optionally, the hydrochloric acid concentration in the hydrochloric acid solution is 0.01-0.2M;

[0019] Optionally, the hydrochloric acid concentration in the hydrochloric acid solution is 0.1M.

[0020] Optionally, the hydrochloric acid concentration in the pepsin-containing hydrochloric acid solution is 0.01-0.2 M;

[0021] Optionally, the hydrochloric acid concentration in the pepsin-containing hydrochloric acid solution is 0.1M.

[0022] In summary, the present application includes at least one of the following beneficial technical effects:

[0023] The present application provides a method for tissue permeabilization for in situ hybridization of thick tissues, wherein 0.01-0.2M hydrochloric acid is used to permeabilize the tissue at 25-46°C, and the action time is 5-120min for intact embryos at different developmental stages. After multiple washes to remove the hydrochloric acid, a 0.01-0.2M hydrochloric acid solution containing a final concentration of 0.1-0.5mg / ml pepsin is added to digest the tissue at 25-46°C for 5-120min to achieve the purpose of permeabilization and perforation, so that the double-ligated probes and enzyme reaction reagents in the subsequent process can enter the cells to reach the target nucleic acid detection site.

[0024] Compared with the prior art, the method of tissue permeabilization for in situ hybridization of thick tissues in the present application improves the detection performance of in situ hybridization, and at the same time can improve the efficiency of the original in situ detection method for thick tissue type detection, thereby increasing the sample applicability of the in situ detection technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1The in situ hybridization test results of the G0 amphioxus embryo sample were obtained by the method of Example 1.

[0026] Figure 2 The in situ hybridization test results of G0 amphioxus embryo samples were obtained by the comparative example method.

[0027] Figure 3 The in situ hybridization test results of the G5 amphioxus embryo sample were obtained using the method of Example 2.

[0028] Figure 4 The in situ hybridization test results of the N0 amphioxus embryo sample were obtained using the method of Example 3.

[0029] Figure 5 The in situ hybridization test results of the N2 amphioxus embryo sample were obtained using the method of Example 4.

[0030] In the figure, the blue is the cell nucleus and the red is the signal point of the Wnt gene. DETAILED DESCRIPTION

[0031] Before describing the embodiments of the present application in detail, it should be understood that the terms used herein are only used for the purpose of describing specific embodiments. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by ordinary technicians in the field to which the terms belong.

[0032] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of this application, unless otherwise specified, the meaning of "plurality" is two or more.

[0033] The endpoints and any values ​​of the ranges disclosed in this application are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0034] In the present application, the terms "comprise" or "include" are open expressions, that is, including the contents specified in the present application but not excluding other contents.

[0035] The present application provides a method for tissue permeabilization for in situ hybridization of thick tissues.

[0036] The method is specifically as follows: after fixing the sample, first use 0.01-0.2M hydrochloric acid solution for permeabilization at 25-46°C for 5-120 minutes, and then incubate with 0.01-0.2M hydrochloric acid solution containing 0.1-0.5mg / mL pepsin at 25-46°C for permeabilization for 5-120 minutes, thereby completing the tissue permeabilization of the thick tissue.

[0037] In order to make the purpose, technical scheme and advantages of the present application clearer, the technical scheme in the embodiments of the present application will be clearly and completely described below in conjunction with the accompanying drawings. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without making creative work belong to the scope of protection of the present application. The embodiments described below are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.

[0038] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0039] The present application is further described in detail below in conjunction with the embodiments, drawings and test results.

[0040] The complete embryos of amphioxus were used as experimental samples. Considering that embryos at different developmental stages have different tissue structures and different thicknesses (embryo tissue thickness is more than 70 μm), the tissue permeabilization method of the present application was used to carry out in situ hybridization based on double-ligated probes and rolling circle amplification on embryos at different developmental stages to explore the applicability of the tissue permeabilization method of the present application to samples of different thicknesses.

[0041] The sample preparation scheme for amphioxus is as follows: samples at different developmental stages were fixed with 4% PFA-MOPS (polyformaldehyde-3-morpholinepropanesulfonic acid buffer), then placed in methanol, stored at -20°C, and taken out before in situ detection.

[0042] Example

[0043] Example 1

[0044] This embodiment provides a method for tissue permeabilization for thick tissue in situ hybridization. The subject is G0 amphioxus embryo. The specific process is as follows:

[0045] (1) Sampling: Use a pipette to draw about 10 embryo pellets into a 1.5 mL centrifuge tube. Centrifuge until the sample sinks to the bottom of the tube, and then carefully remove the methanol supernatant.

[0046] (2) Washing: Take 500 μL of PBST (1×PBS containing 0.1% Tween-20) in a sample centrifuge tube, gently blow the sample several times, let it stand for about 10 seconds, centrifuge it to let the sample sink to the bottom of the tube, and discard the supernatant.

[0047] (3) Fixation: Take 500 μL of 4% PFA in a sample centrifuge tube and gently blow to resuspend the sample. After fixation at room temperature for 10 min, centrifuge the sample to sink to the bottom of the tube and discard the supernatant.

[0048] (4) Cleaning: Take 500 μL of PBST in a sample centrifuge tube and gently blow the sample several times. After standing for about 10 seconds, centrifuge the sample to let it sink to the bottom of the tube and discard the supernatant.

[0049] (5) Permeabilization: Take 500 μL of 0.1 M hydrochloric acid in a sample centrifuge tube and gently pipette to resuspend the sample. After permeabilization for 5 min in a 37°C constant temperature incubator, centrifuge to allow the sample to sink to the bottom of the tube and discard the supernatant.

[0050] (6) Preheating hydrochloric acid: When there are about 10 minutes left in step (5), take 850 μL of 0.1 M HCl into a new 1.5 mL centrifuge tube and place it in a 37°C constant temperature incubator for preheating.

[0051] (7) Cleaning: Take 500 μL of PBST in a sample centrifuge tube and gently blow the sample several times. After standing for about 10 seconds, centrifuge the sample to allow it to sink to the bottom of the tube and discard the supernatant.

[0052] (8) Enzyme treatment: Add 150 μL of 2 mg / mL pepsin stock solution to 850 μL of preheated 0.1 M HCl to make the final concentration of pepsin 0.3 mg / mL. Mix and centrifuge to obtain the pepsin working solution. Add 200 μL of pepsin working solution to each sample centrifuge tube, gently blow to resuspend the sample, and then incubate the sample at 37°C for 30 min. After incubation, centrifuge the sample to allow it to sink to the bottom of the tube and discard the supernatant.

[0053] (9) Cleaning: Take 500 μL of PBST in a sample centrifuge tube and gently blow the sample several times. After standing for about 10 seconds, centrifuge the sample to allow it to sink to the bottom of the tube and discard the supernatant.

[0054] (10) Draw the tissue circle: Take a clean slide and use ImmEdge TM Use a pen to draw a hydrophobic circle with a diameter of 1 cm. Wait until the circle is fully dry before use.

[0055] (11) Sample transfer: After transferring the sample into the hydrophobic circle, take 50 μL PBST into the hydrophobic circle (the specific amount of PBST used for cleaning should be sufficient to completely cover the sample), let it stand for 10 seconds and then discard the liquid. Wash three times in total.

[0056] Comparative Example

[0057] This comparative example provides a method for tissue permeabilization for in situ hybridization of thick tissues. The difference between this comparative example and Example 1 is that there is no pepsin treatment step in this comparative example. The specific process is as follows:

[0058] (1) Sampling: Use a pipette to draw about 10 embryo pellets into a 1.5 mL centrifuge tube. Centrifuge until the sample sinks to the bottom of the tube, and then carefully remove the methanol supernatant.

[0059] (2) Washing: Take 500 μL of PBST (1×PBS containing 0.1% Tween-20) in a sample centrifuge tube, gently blow the sample several times, let it stand for about 10 seconds, centrifuge it to let the sample sink to the bottom of the tube, and discard the supernatant.

[0060] (3) Fixation: Take 500 μL of 4% PFA in a sample centrifuge tube and gently blow to resuspend the sample. After fixation at room temperature for 10 min, centrifuge the sample to sink to the bottom of the tube and discard the supernatant.

[0061] (4) Cleaning: Take 500 μL of PBST in a sample centrifuge tube and gently blow the sample several times. After standing for about 10 seconds, centrifuge the sample to let it sink to the bottom of the tube and discard the supernatant.

[0062] (5) Permeabilization: Take 500 μL of 0.1 M hydrochloric acid in a sample centrifuge tube and gently pipette to resuspend the sample. After permeabilization for 5 min in a 37°C constant temperature incubator, centrifuge to allow the sample to sink to the bottom of the tube and discard the supernatant.

[0063] (6) Cleaning: Take 500 μL of PBST in a sample centrifuge tube and gently blow the sample several times. After standing for about 10 seconds, centrifuge the sample to let it sink to the bottom of the tube and discard the supernatant.

[0064] (7) Draw the group circle: Take a clean slide and use ImmEdge TM Use a pen to draw a hydrophobic circle with a diameter of 1 cm. Wait until the circle is fully dry before use.

[0065] (8) Sample transfer: After transferring the sample into the hydrophobic circle, take 50 μL PBST into the hydrophobic circle (the specific amount of PBST used for cleaning should be sufficient to completely cover the sample), let it stand for 10 seconds and then discard the liquid. Wash three times in total.

[0066] Test result 1

[0067] The amphioxus samples were treated by the tissue permeabilization method provided in Example 1 and the tissue permeabilization method of the comparative example to obtain G0 amphioxus embryo samples at the same developmental stage. RNA in situ hybridization was performed on the Wnt gene of the G0 amphioxus embryo samples obtained above.

[0068] The in-situ detection process is as follows:

[0069] (1) Dual-ligation probe hybridization

[0070] Add 50 μL of hybridization mixture containing 0.1 μM dual-ligation probe (Shanghai Bioengineering, the same as dual-ligation probe below), 6×SSC (Sigma), and 10% formamide (Sigma) to the tissue, and hybridize at 46°C for 4 h to allow the dual-ligation probes designed for different target genes to fully bind to their targets, and then wash the tissue three times with PBST; then use a dual-ligation probe washing solution containing 2×SSC and 20% formamide to wash the tissue three times at 46°C for 5 min each time, and then wash the tissue three times with PBST.

[0071] The double ligation probe sequences used are specifically SEQ ID NOs: 1 to 30 shown in Table 1.

[0072] Table 1 Probe sequences used

[0073]

[0074]

[0075] (2) First step of ligation of dual ligation probes

[0076] 50 μL of a ligation reaction mixture containing 25% glycerol (Sigma), 0.2 μg / μL BSA, 1× SplintR buffer (NEB), 0.25 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the tissue and incubated at 37°C for 30 min, followed by washing the tissue three times with PBST.

[0077] (3) Circularization of dual-ligation probes

[0078] Add 50 μL of a circularization mixture containing 0.5 μM circularization template sequence ST, 2 mM ATP, 0.2 μg / μL BSA, 1×T4 DNA Ligase buffer, 1 U / μL T4 DNA Ligase and 1 U / μL RiboLock RNase inhibitor to the tissue, incubate at 37°C for 30 min, and then wash the tissue three times with PBST. Wherein, the circularization template sequence is the nucleotide sequence shown in SEQ ID NO: 31, specifically: TCTTAAACAGCTTGATACCG.

[0079] (4) Rolling circle amplification

[0080] Add 50 μL of rolling circle amplification reaction solution containing 1 mM dNTP (Thermo), 5% glycerol, 0.2 μg / μL BSA, 1×phi29 buffer, 1 U / μL phi29 DNA polymerase and 1 U / μL RiboLock RNase inhibitor to the tissue, incubate at 30°C for 12-16 hours, and then wash the tissue three times with PBST.

[0081] (5) Fluorescent probe detection

[0082] Add 50 μL of detection reaction solution containing 2×SSC, 20% formamide, and 0.1 μM fluorescent detection probe to the tissue and incubate at room temperature for 30 min; then wash the tissue three times with PBST.

[0083] After the tissue was naturally air-dried, Slowfade anti-fluorescence quencher (Thermo) containing 0.5 μg / mL DAPI was added and incubated at room temperature for about 5 min before fluorescence microscopy imaging.

[0084] Wherein, the fluorescence detection probe sequence is shown in Table 2.

[0085] Table 2 Fluorescent probe sequences

[0086] SEQ ID NO: name Sequence information (5' to 3') 5' modification 3' modification 32 DP-1-Cy3 AGTAGCCGTGACTATCGACT Cy3 -

[0087] Test results such as Figure 1 and Figure 2 As shown. Among them, Figure 1 The test results of the G0 amphioxus embryo sample were obtained by the method of Example 1. Figure 2 The test results of the G0 lancelet embryo sample were obtained by the comparative example method.

[0088] The tissue permeabilization condition in Example 1 of the present application is 0.1M HCl at 37°C for 5 minutes, combined with 0.1M hydrochloric acid solution containing pepsin at a final concentration of 0.3mg / ml, and the tissue is digested at 37°C for 30 minutes; while the tissue permeabilization condition in the comparative example is only 0.1M HCl at 37°C for 5 minutes. Figure 1 and Figure 2 The results show that, Figure 2 No signal of Wnt gene was detected in the control group, indicating that the tissue permeabilization condition of the control group was insufficient. Figure 1 The Wnt gene signal was detected, indicating that the tissue permeabilization conditions in Example 1 of the present application were significantly better than those in the comparative example.

[0089] Example 2

[0090] This example provides a method for tissue permeabilization for thick tissue in situ hybridization. The difference between this method and Example 1 is that the subject is G5 amphioxus embryo. The remaining steps are consistent with Example 1.

[0091] Example 3

[0092] This embodiment provides a method for tissue permeabilization for thick tissue in situ hybridization. The difference between this embodiment and embodiment 1 is that the object is N0 amphioxus embryo. The remaining steps are consistent with embodiment 1.

[0093] Example 4

[0094] This embodiment provides a method for tissue permeabilization for thick tissue in situ hybridization. The difference between this embodiment and embodiment 1 is that the object is N2 amphioxus embryos. The remaining steps are consistent with embodiment 1.

[0095] Test result 2

[0096] The amphioxus samples were treated by the tissue permeabilization methods provided in Examples 2-4 to obtain amphioxus embryo samples at different developmental stages. RNA in situ hybridization was performed on the Wnt gene of the amphioxus embryo samples obtained above.

[0097] Test results such as Figure 3-Figure 5 As shown. Among them, Figure 3 The test results of the G5 amphioxus embryo sample were obtained by the method of Example 2. Figure 4 The test results of the N0 amphioxus embryo sample were obtained by the method of Example 3. Figure 5 The test results of the N2 amphioxus embryo sample were obtained by the method of Example 4.

[0098] Depend on Figure 3-Figure 5 The results show that, Figure 3-Figure 5 Signals of Wnt genes were detected in all samples, indicating that the tissue permeabilization conditions of the present application are suitable for pre-treatment of in situ hybridization of tissues of different thicknesses.

[0099] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example" or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for tissue permeabilization for in situ hybridization of thick tissues, characterized in that: The method specifically comprises: after fixing the sample, first permeabilizing it with a hydrochloric acid solution, and then incubating it with a hydrochloric acid solution containing pepsin, thereby completing the tissue permeabilization of the thick tissue.

2. The method according to claim 1, characterized in that The temperature for permeabilization with hydrochloric acid solution is 25-46°C; Optionally, the temperature for permeabilization using hydrochloric acid solution is 37°C.

3. The method according to claim 2, characterized in that The temperature of incubation with hydrochloric acid solution containing pepsin is 25-46°C; Optionally, the incubation temperature using the hydrochloric acid solution containing pepsin is 37°C.

4. The method according to claim 1, characterized in that: The permeabilization time using hydrochloric acid solution is 5-120 minutes; Optionally, the permeabilization time using the hydrochloric acid solution is 30 minutes.

5. The method according to claim 1, characterized in that The incubation time using the hydrochloric acid solution containing pepsin is 5-120 minutes; Optionally, the incubation time with the hydrochloric acid solution containing pepsin is 30 minutes.

6. The method according to claim 1, characterized in that In the hydrochloric acid solution containing pepsin, the concentration of pepsin is 0.1-0.5 mg / mL; Optionally, in the pepsin-containing hydrochloric acid solution, the concentration of pepsin is 0.3 mg / mL.

7. The method according to claim 1, characterized in that The hydrochloric acid concentration in the hydrochloric acid solution is 0.01-0.2M; Optionally, the hydrochloric acid concentration in the hydrochloric acid solution is 0.1M.

8. The method according to claim 1, characterized in that The hydrochloric acid concentration in the pepsin-containing hydrochloric acid solution is 0.01-0.2M; Optionally, the hydrochloric acid concentration in the pepsin-containing hydrochloric acid solution is 0.1M.

Images