Methylation marker and probe composition for detecting colorectal cancer and application of methylation marker and probe composition

Abstract

The invention discloses a methylation marker for detecting colorectal cancer, a probe composition and application of the methylation marker. The methylation marker is a CHGA gene or an SKOR2 gene. The methylation marker is used, the methylation state of the gene can be sensitively and specifically detected, so that the methylation marker can be used for detecting peripheral blood free DNA, the composition is used for screening asymptomatic people in a non-invasive mode, harm caused by invasive detection is reduced, and the application prospect is wide. The composition has higher sensitivity and accuracy, and can realize real-time monitoring.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a methylation marker, a probe composition and an application thereof for detecting colorectal cancer. Background Art

[0002] Colorectal cancer is a common cancer and a major health problem worldwide. According to statistics, about 900,000 people die from colorectal cancer each year, making it the fourth most deadly cancer. Currently, the incidence and mortality of colorectal cancer are on the rise, with 410,000 cases and 160,000 deaths. The high incidence and mortality of colorectal cancer are related to its frequent progression in an asymptomatic state. Patients in stage I who receive timely treatment have a 5-year survival rate of over 90%. Therefore, early diagnosis and treatment are crucial to the prognosis of colorectal cancer.

[0003] Currently, colonoscopy is the gold standard for diagnosing colorectal cancer. However, due to high costs, poor compliance and possible surgical risks, colonoscopy is difficult to be used on a large scale for screening of asymptomatic people. In addition, although fecal occult blood test (FOBT) and peripheral blood carcinoembryonic antigen (CEA) are easy to accept, their poor sensitivity and specificity also pose challenges to the early diagnosis and treatment of colorectal cancer.

[0004] Therefore, the discovery of a new biomarker for colorectal cancer can not only improve the diagnostic efficiency of colorectal cancer, but also facilitate the diagnosis and treatment of patients, which has important clinical significance. Research on the search for colorectal cancer biomarkers is ongoing. At present, many markers have been discovered and have been proven to play an important role in the early diagnosis and treatment of colorectal cancer. These colorectal cancer biomarkers can be molecules such as proteins, DNA, and RNA, which can detect and diagnose colorectal cancer through their specific expression or changes in colorectal cancer tissues or body fluids. Therefore, the discovery and research of colorectal cancer biomarkers is of great significance for the early diagnosis and treatment of colorectal cancer. Summary of the invention

[0005] In the prior art, colonoscopy, fecal occult blood test (FOBT) and peripheral blood carcinoembryonic antigen (CEA) are generally used for screening or diagnosis, but each has certain shortcomings.

[0006] For example, colonoscopy is a common method for screening colorectal cancer and polyps, but it also has some disadvantages that may affect its use in screening. Here are a few disadvantages of colonoscopy:

[0007] 1. Not suitable for all people: Colonoscopy requires patients to prepare their intestines and use a flexible probe through the anus, which may cause discomfort or pain to some patients. In addition, colonoscopy may be risky for some elderly or frail patients.

[0008] 2. Unable to fully evaluate the colorectum: Although colonoscopy can directly observe the colorectal mucosal surface, it can only observe the area that the lens can reach. Due to the colorectal tortuosity and stenosis, some colorectal areas may not be examined, which may lead to missing some polyps or tumors.

[0009] 3. Insensitive to small polyp detection: Due to the limitations of colorectal endoscopy, some small polyps may be missed. Although these small polyps may not have the risk of cancer, if they are not discovered and removed in time, they may gradually grow and eventually lead to cancer.

[0010] 4. Professional technical support is required: Colorectal endoscopy requires professional doctor training and qualification certification. In addition, the interpretation of the examination results also requires professional knowledge and experience, which may lead to some misdiagnosis or missed diagnosis.

[0011] These shortcomings indicate that colorectal endoscopy is not a perfect screening method. Therefore, when developing diagnostic and screening technologies for colorectal cancer, it is necessary to consider these shortcomings and try to solve them, so as to improve the diagnostic accuracy and screening efficiency of colorectal cancer.

[0012] Fecal occult blood test (FOBT) is a simple, non-invasive method for colorectal cancer screening, but it also has some disadvantages:

[0013] 1. Limited sensitivity and specificity: The sensitivity and specificity of the fecal occult blood test for colorectal cancer are not very high, and there may be false negatives or false positives, affecting the screening effect.

[0014] 2. Continuous sample collection is required: In order to improve the accuracy of the test, stool samples need to be collected for three consecutive days, which is inconvenient and can easily cause discomfort to patients.

[0015] 3. Unable to distinguish the source of bleeding: The fecal occult blood test can only detect the presence of occult blood, but cannot determine where the blood comes from and cannot accurately locate the tumor.

[0016] 4. Unable to detect early tumors: The amount of bleeding in the early stages of colorectal cancer is very small and may not be detected, so the early screening effect of the fecal occult blood test is limited.

[0017] In summary, although the fecal occult blood test is a simple and easy method for colorectal cancer screening, its sensitivity and specificity are limited. It cannot determine the location of the tumor or detect early tumors, and needs to be combined with other examination methods for comprehensive screening.

[0018] Peripheral blood carcinoembryonic antigen (CEA) has the following disadvantages and shortcomings in early screening of colorectal cancer:

[0019] 1. Lack of specificity: CEA is not only elevated in patients with colorectal cancer, but may also be elevated in other cancers, inflammation, and certain diseases. Therefore, an increase in CEA cannot completely determine whether you have colorectal cancer.

[0020] 2. Lack of sensitivity: CEA levels are not necessarily elevated in patients with early colorectal cancer, so the CEA test may miss early colorectal cancer.

[0021] 3. No uniform standard: The normal range of CEA varies depending on factors such as age, gender, and smoking history, and there is a lack of uniform standards.

[0022] 4. It cannot replace colonoscopy: Although CEA can be used as an auxiliary means of colorectal cancer screening, it cannot replace colonoscopy because colonoscopy can directly observe the situation inside the intestine and diagnose early colorectal cancer more accurately.

[0023] In summary, CEA has certain shortcomings and deficiencies in the early screening of colorectal cancer and needs to be combined with other examination methods for comprehensive judgment.

[0024] Based on this, the present application provides a marker, a probe composition and an application for detecting colorectal cancer, which can be used for screening of colorectal cancer. The marker is used in a non-invasive manner for screening of asymptomatic people and prognosis detection of cancer patients, reducing the harm caused by invasive detection, and has higher sensitivity and accuracy, and can achieve real-time monitoring.

[0025] The specific technical solutions of this application are as follows:

[0026] 1. A methylation marker for detecting colorectal cancer, wherein the methylation marker is CHGA gene or SKOR2 gene.

[0027] 2. The methylation marker according to item 1, wherein the target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12.

[0028] 3. A probe composition, wherein the probe composition comprises a probe targeting the methylation of the methylation marker target sequence described in item 1 or 2.

[0029] 4. The probe composition according to item 3, wherein the probe composition comprises a first probe composition with high methylation and a second probe composition with low methylation, the first probe composition is used to hybridize with a region with high methylation of CG converted by bisulfite, and the second probe composition is used to hybridize with a region with low methylation of CG converted by bisulfite;

[0030] Preferably, the first probe composition comprises n probes, and the n probes hybridize with each nucleotide of the sense strand and / or antisense strand of the CG hypermethylated region converted by bisulfite. Preferably, the second probe composition comprises m probes, and the m probes hybridize with each nucleotide of the sense strand and / or antisense strand of the CG hypomethylated region converted by bisulfite. Further preferably, n and m are any integers between 1 and 10.

[0031] Preferably, there are x1 nucleotide overlaps between the n-1th probe and the nth probe, and preferably, x1 is any integer between 0 and 100;

[0032] Preferably, there are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0 and 100;

[0033] Further preferably, the first probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 13-16; and the second probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 17-20.

[0034] 5. Use of a nucleic acid for detecting a methylation marker target sequence in preparing a kit for detecting colorectal cancer, wherein the methylation marker is a CHGA gene or a SKOR2 gene.

[0035] 6. The use according to item 5, wherein the target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12;

[0036] Preferably, the nucleic acid is used to target a target sequence of a methylated marker of colorectal cancer after methylation;

[0037] Preferably, the nucleic acid is the probe composition described in any one of items 3-4.

[0038] 7. The use according to any one of items 5-6, wherein the nucleic acid comprises:

[0039] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CHGA gene or SKOR2 gene, and the fragment contains at least one CpG dinucleotide sequence;

[0040] Preferably, the nucleic acid further comprises:

[0041] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the CHGA gene or SKOR2 gene under moderately stringent or stringent conditions, wherein the fragment comprises at least one CpG dinucleotide sequence;

[0042] Preferably, the nucleic acid further comprises:

[0043] Blockers that preferentially bind to target sequences in their unmethylated state.

[0044] 8. A composition for colorectal cancer detection, wherein the composition comprises a nucleic acid for detecting methylation of a CHGA gene or a SKOR2 gene.

[0045] 9. The composition according to item 8, wherein the target sequence of the CHGA gene or SKOR2 gene is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12;

[0046] Preferably, the nucleic acid comprises the probe composition described in any one of items 3-4.

[0047] 10. The composition according to item 8 or 9, wherein the nucleic acid comprises:

[0048] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the methylation marker, and the fragment contains at least one CpG dinucleotide sequence;

[0049] Preferably, the nucleic acid further comprises:

[0050] The probe hybridizes to at least a 15-nucleotide fragment in the target sequence of the methylation marker under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0051] 11. The composition according to any one of items 8 to 10, further comprising an agent for converting the unmethylated cytosine base at position 5 of the target sequence of the CHGA gene or SKOR2 gene into uracil;

[0052] Preferably, the nucleic acid further comprises:

[0053] Blockers that preferentially bind to target sequences in their unmethylated state.

[0054] 12. The composition according to any one of items 8 to 11, wherein the methylation state of the methylation marker is characterized by the methylation of the target sequence of the methylation marker.

[0055] 13. A kit comprising a reagent for detecting the methylation marker described in Item 1 or 2, the probe composition described in Item 3-4, or the composition described in any one of Items 8-12.

[0056] 14. A chip comprising a reagent for detecting the methylation marker described in Item 1 or 2, the probe composition described in Item 3-4, or the composition described in any one of Items 8-12.

[0057] Effects of the Invention

[0058] The methylation markers described in this application have the following technical effects:

[0059] 1. Early detection and diagnosis of colorectal cancer: The DNA methylation marker detection technology used in this application can detect and diagnose colorectal cancer in its early stages. Because DNA methylation markers can change in the early stages of colorectal cancer, it can improve the accuracy and sensitivity of early screening for colorectal cancer, thereby effectively improving treatment outcomes and survival rates.

[0060] 2. Avoid the defects of traditional colorectal cancer screening methods: Traditional colorectal cancer screening methods such as colonoscopy, fecal occult blood test (FOBT) and peripheral blood carcinoembryonic antigen (CEA) have some defects, such as strong invasiveness, high compliance requirements, low accuracy, etc. This application uses methylation markers for detection, which can avoid these defects, improve the safety and compliance of patients, and also improve the accuracy and sensitivity of colorectal cancer screening.

[0061] 3. Improved treatment effect and prognosis of colorectal cancer: This application uses methylation markers for detection, which can detect and diagnose colorectal cancer at an early stage, thereby improving the treatment effect and prognosis of colorectal cancer. Because early colorectal cancer is easy to cure, early detection of colorectal cancer can avoid disease progression and metastasis, thereby improving treatment effect and survival rate.

[0062] 4. Reduced risk of colorectal cancer screening: Traditional colorectal cancer screening methods have certain risks. This application uses methylation markers for detection, which can reduce the risk of colorectal cancer screening and improve the efficiency and safety of colorectal cancer screening.

[0063] The present application uses the methylation marker for detection, which can improve the accuracy and sensitivity of early screening for colorectal cancer, avoid the defects of traditional colorectal cancer screening methods, improve the treatment effect and prognosis of colorectal cancer, and also reduce the cost and risk of colorectal cancer screening.

[0064] In addition, the inventors of the present application used epigenomic and bioinformatics techniques to analyze the whole genome methylation data of colorectal cancer and found two methylation genes related to colorectal cancer. They also determined the target sequence of the colorectal cancer methylation gene where methylation abnormalities occur. Moreover, through the target sequence of this methylation gene, the methylation status of the gene can be sensitively and specifically detected, which can be used for the detection of free DNA in peripheral blood.

[0065] The composition described in the present application is used for screening asymptomatic people in a non-invasive manner, reducing the harm caused by invasive testing. The composition has higher sensitivity and accuracy and can achieve real-time monitoring. DETAILED DESCRIPTION

[0066] The present invention is described in detail below. Although specific embodiments of the present invention are shown, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0067] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in the functions of the components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present invention, but the description is based on the general principles of the specification and is not intended to limit the scope of the present invention. The scope of protection of the present invention shall be determined by the attached claims.

[0068] "DNA methylation" of the present application refers to the addition of a methyl group to the 5-position of cytosine (C), which is usually (but not necessarily) in the case of a CpG (cytosine followed by guanine) dinucleotide. "Increased methylation" or "significant methylation" as used herein refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0069] "Homology", "identity" and "similarity" in this application are used interchangeably to refer to the sequence similarity between two nucleic acid molecules. "Homology", "identity" or "similarity" can be determined by comparing the positions in each sequence, and the sequences can be aligned for the purpose of comparison. When equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid (for example, similar in spatial properties or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the function of the number of identical or similar amino acids at the positions shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity with the sequences of this application. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In a specific embodiment, two or more sequences or subsequences are considered to be substantially or significantly homologous, similar or identical if their sequences are about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a specified region, as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection provided online by, for example, the National Center for Biotechnology Information (NCBI). This definition also relates to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context of the present invention, for example, if the nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, then the nucleotide sequence that is complementary to a specified target sequence or a variant thereof is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences that can encode the same or similar polypeptide products, and any allowed variants of any of the above. Circumstances in which similarity must be limited to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region that is at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region that is more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0070] The "sensitivity" in this application refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal detected in a certain normal human sample, and its calculation formula is: Specificity = (detected negative / total negative).

[0071] The present application provides a methylation marker for detecting colorectal cancer, wherein the methylation marker is CHGA gene or SKOR2 gene. In some embodiments, the target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12.

[0072] Among them, the sequence of SEQ ID NO: 1 (CHGA gene) is:

[0073] GGTGCCCGGCCCCACACCGCCAGCTGCTCGGCGCCCGGGTCCGCCATGCGCTCCGCCGCT The sequence of SEQ ID NO: 2 (SKOR2 gene) is:

[0074] AGAGTCCGCGGGCGGCGTGGAGCCCGCGCTGCAGTCCCCGCCGCTGCCGCCCGGGGGCGACTCGAAGAGCGCGTCGCGAGAGCCGGCGCCCCC

[0075] The sequence of SEQ ID NO:3 (an extreme case of hypermethylation of the sequence of SEQ ID NO:1) is:

[0076] GGTGTTCGGTTTTATATCGTTAGTTGTTCGGCGTTCGGGTTCGTTATGCGTTTCGTCGTT

[0077] The sequence of SEQ ID NO:4 (an extreme case of hypomethylation of the sequence of SEQ ID NO:1) is:

[0078] GGTGTTTGGTTTTATATTGTTAGTTGTTTGGTGTTTGGGTTTGTTATGTGTTTTGTTGTT

[0079] The sequence of SEQ ID NO:5 (the reverse complementary sequence of SEQ ID NO:1) is:

[0080] AGCGGCGGAGCGCATGGCGGACCCGGGCGCCGAGCAGCTGGCGGTGTGGGGCCGGGCACC

[0081] The sequence of SEQ ID NO:6 (an extreme case of hypermethylation of the sequence of SEQ ID NO:5) is:

[0082] AGCGGCGGAGCGTATGGCGGATTCGGGCGTCGAGTAGTTGGCGGTGTGGGGTCGGGTATT

[0083] The sequence of SEQ ID NO:7 (an extreme case of hypomethylation of the sequence of SEQ ID NO:5) is:

[0084] AGTGGTGGAGTGTATGGTGGATTTGGGTGTTGAGTAGTTGGTGGTGTGGGGTTGGGTATT

[0085] The sequence of SEQ ID NO:8 (an extreme case of hypermethylation of the sequence of SEQ ID NO:2) is:

[0086] AGAGTTCGCGGGCGGCGTGGAGTTCGCGTTGTAGTTTTCGTCGTTGTCGTTCGGGGGCGATTCGAAGAGCGCGTCGCGAGAGTCGGCGTTTTT

[0087] The sequence of SEQ ID NO:9 (an extreme case of hypomethylation of the sequence of SEQ ID NO:2) is:

[0088] AGAGTTTGTGGGTGGTGTGGAGTTTGTGTTGTAGTTTTTGTTGTTGTTGTTTGGGGGTGATTTGAAGAGTGTGTTGTGAGAGTTGGTGTTTTT

[0089] The sequence of SEQ ID NO:10 (the reverse complementary sequence of SEQ ID NO:2) is:

[0090] GGGGGCGCCGGCTCTCGCGACGCGCTCTTCGAGTCGCCCCCGGGCGGCAGCGGCGGGGACTGCAGCGCGGGCTCCACGCCGCCCGCGGACTCT

[0091] The sequence of SEQ ID NO: 11 (an extreme case of hypermethylation of the sequence of SEQ ID NO: 10) is:

[0092] GGGGGCGTCGGTTTTCGCGACGCGTTTTTCGAGTCGTTTTCGGGCGGTAGCGGCGGGGATTGTAGCGCGGGTTTTACGTCGTTCGCGGATTTT

[0093] The sequence of SEQ ID NO: 12 (an extreme case of hypomethylation of the sequence of SEQ ID NO: 10) is:

[0094] GGGGGTGTTGGTTTTTGTGATGTGTTTTTTGAGTTGTTTTTGGGTGGTAGTGGTGGGGATTGTAGTGTGGGTTTTATGTTGTTTGTGGATTTT

[0095] In the present application, the sequences SEQ ID NOs: 1-2 and SEQ ID NOs: 5 and 10 refer to sequences that have not been converted with bisulfite.

[0096] In this application, the methylation refers to the methylation process of the 5th carbon atom on cytosine in CpG dinucleotides. As a relatively stable modification state, it can be inherited to the new offspring DNA during the DNA replication process under the action of DNA methyltransferase. It is an important epigenetic mechanism. When DNA is methylated, the methylation of the gene promoter region can lead to the transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes high methylation of tumor suppressor genes and DNA repair genes, low methylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are related to the occurrence of various tumors.

[0097] The methylation described herein may be a methylation level, a methylation degree or a methylation state. When analyzing the methylation of such a target sequence, those skilled in the art may use a quantitative measurement method to determine the methylation.

[0098] In this application, the hypermethylation refers to CG hypermethylation, and the CG hypermethylated region refers to the region where the target sequence is more methylated. Since the methylation status of each person is different, the extreme CG hypermethylated region refers to the region where all CGs of the target sequence are methylated.

[0099] The hypermethylation refers to CG hypomethylation, and the region of CG hypomethylation refers to the region where the target sequence is less methylated. In the present application, the region of extreme CG hypomethylation refers to the region where all CGs in the target sequence are not methylated.

[0100] The CG hypermethylated region after bisulfite conversion refers to the conversion of base C to base T after the target sequence is converted by bisulfite, but if it is a base CG, since the 5-methylcytosine residue (5mC) is resistant to it, the C in CG will not be converted, so the base C remains unchanged;

[0101] The CG hypomethylated region after bisulfite conversion means that after bisulfite conversion, since all or most of the bases CG on the target sequence are not methylated, all or most of the bases C are converted to base T.

[0102] Since the methylation state of each person is different, the sequence obtained by bisulfite conversion is also different. Therefore, the present application shows an extreme case of each methylation marker, that is, all CGs in the segment are in a high methylation state, and shows the high methylation state sequence of its complementary chain. Similarly, the present application also shows an extreme case of low methylation of each methylation marker, for example, SEQ ID NO: 3 is an extreme case of high methylation of SEQ ID NO: 1, and similarly, SEQ ID NO: 4 is an extreme case of low methylation of SEQ ID NO: 1.

[0103] SEQ ID NO:5 is the reverse complementary sequence of SEQ ID NO:1, SEQ ID NO:6 is an extreme case of hypermethylation of SEQ ID NO:5, and SEQ ID NO:7 is an extreme case of hypomethylation of SEQ ID NO:5.

[0104] Those skilled in the art can also understand that the target sequence of the CHGA gene or SKOR2 gene is not limited to the specific sequences listed above. The target sequence of the CHGA gene should include a sequence that contains one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-6, but is still substantially functionally the same, and also includes a sequence that has 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-6. The target sequence of the SKOR2 gene should include a sequence that contains one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 7-12, but is still substantially functionally the same, and also includes a sequence that has 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 7-12.

[0105] The present application provides a probe composition, wherein the probe composition comprises a methylated probe targeting the above-mentioned methylation marker target sequence.

[0106] In the present application, the probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs. It can utilize the molecular denaturation, renaturation and high accuracy of base complementary pairing to hydrogen bond (hybridize) with the complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). After washing away the unpaired bound probe, the hybridization reaction result can be detected by a detection system such as radioautography or enzyme-linked reaction. In the present application, the area complementary to or hybridized with the probe is a specific target area, and multiple probes are combined into a probe composition.

[0107] In one embodiment, the probe composition comprises a first hypermethylated probe composition and a second hypomethylated probe composition, wherein the first probe composition is used to hybridize with a region of CG hypermethylation converted by bisulfite, and the second probe composition is used to hybridize with a region of CG hypomethylation converted by bisulfite.

[0108] In some embodiments, the first probe composition includes n probes that hybridize to each nucleotide of the sense strand and the antisense strand of the bisulfite-converted CG hypermethylated region.

[0109] The second probe composition includes m probes that hybridize to each nucleotide of the sense strand and / or antisense strand of the bisulfite-converted CG hypomethylated region.

[0110] The present invention does not impose any limitation on the number of probes in the first probe composition and the second probe composition, and those skilled in the art may select the number as needed. For example, m and n may be any integer between 1 and 10, and m and n may be the same or different.

[0111] For example, m and n can be any integer of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Preferably, m=n=2.

[0112] In one embodiment, there are x1 nucleotide overlaps between the n-1th probe and the nth probe, preferably, x1 is any integer between 0 and 100;

[0113] Preferably, there are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0-100.

[0114] Among them, x1 and x2 can be the same or different. When x1 is 0, it indicates that the tail of the n-1th probe is connected to the head of the nth probe. Similarly, when x2 is 0, it indicates that the tail of the m-1th probe is connected to the head of the mth probe.

[0115] The present application hybridizes the probe composition with the target sequence converted by bisulfite, wherein the highly methylated first probe composition hybridizes with the CG highly methylated region, and the low-methylated second probe composition hybridizes with the CG low-methylated region, thereby being able to efficiently and accurately detect the methylation level of the target sequence, and can further be used for colorectal cancer screening.

[0116] In one embodiment, the hypermethylated first probe composition includes nucleotide sequences as shown in SEQ ID NO:13-16. For example, for the CHGA gene, its hypermethylated first probe composition is as shown in SEQ ID NO:13 and SEQ ID NO:14, and for the SKOR2 gene, its hypermethylated first probe composition is as shown in SEQ ID NO:15 and SEQID NO:16.

[0117] Wherein, the nucleotide sequence shown in SEQ ID NO: 13 is:

[0118] TTACCCGACGCAAAACAAAAAAACCAAAACAACGACGAAACGCATAACGAACCCGAACGCCGAACAACTAACGATATAAAACCGAACACCTAAACACCGAACGAAAAACGACTAAACTAA

[0119] The nucleotide sequence shown in SEQ ID NO:14 is:

[0120] CCAATCCAACCGCCCCTCGCCCGATACCTAAATACCCGACCCCACACCGCCAACTACTCGACGCCCGAATCCGCCATACGCTCCGCCGCTATCCTAACTCTTCTACTCTACGCCGAACAA

[0121] The nucleotide sequence shown in SEQ ID NO:15 is:

[0122] CACCTCCTCCTACCGAAAACGCCGACTCTCGCGACGCGCTCTTCGAATCGCCCCCGAACGACAACGACGAAAACTACAACGCGAACTCCACGCCGCCCGCGAACTCTATAACAACTACCG

[0123] The nucleotide sequence shown in SEQ ID NO:16 is:

[0124] CGACAACTACCACAAAATCCGCGAACGACGTAAAACCCGCGCTACAATCCCCGCCGCTACCGCCCGAAAACGACTCGAAAAACGCGTCGCGAAAACCGACGCCCCCGACAAAAAAAAATA

[0125] The hypomethylated second probe composition includes nucleotide sequences as shown in SEQ ID NOs: 17-20. For example, for the CHGA gene, its hypomethylated first probe composition is as shown in SEQ ID NOs: 17 and 18, and for the SKOR2 gene, its hypomethylated first probe composition is as shown in SEQ ID NOs: 19 and 20.

[0126] The nucleotide sequence shown in SEQ ID NO:17 is:

[0127] TTACCCAACACAAAACAAAAAAACCAAAACAACAACAAAACACATAACAAACCCAAACACCAAACAACTAACAATATAAAACCAAACACCTAAACACCAAACAAAAAACAACTAAACTAA

[0128] The nucleotide sequence shown in SEQ ID NO:18 is:

[0129] CCAATCCAACCACCCTCACCCAATACCTAAATACCCAACCCCACACCACCAACTACTCAACACCCAAATCCACCATACACTCCACCACTATCCTAACTCTTCTACTCTACACCAAACAA

[0130] The nucleotide sequence shown in SEQ ID NO:19 is:

[0131] CACCTCCTCCTACCAAAAACACCAACTCTCACAACACACTCTTCAAATCACCCCCAAACAACAACAAAAAACTACAACACAAACTCCACACCACCCACAAACTCTATAACAACTACCA

[0132] The nucleotide sequence shown in SEQ ID NO:20 is:

[0133] CAACAACTACCACAAAATCCACAAACAATAAAACCCACACTACAATCCCCACCACTACCACCCAAAAACAACTCAAAAAACACATCACAAAAACCAACACCCCCAACAAAAAAAAATA

[0134] The present application provides the use of a nucleic acid for detecting a methylation marker in the preparation of a kit for detecting colorectal cancer, wherein the marker is a CHGA gene or a SKOR2 gene. In some embodiments, the target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12. In some embodiments, the nucleic acid is used to target the target sequence of the methylation marker after methylation of colorectal cancer. In some embodiments, the nucleic acid is the probe composition described above.

[0135] In some embodiments, the nucleic acid comprises:

[0136] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CHGA gene or SKOR2 gene, and the fragment contains at least one CpG dinucleotide sequence;

[0137] Preferably, the nucleic acid further comprises:

[0138] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the CHGA gene or SKOR2 gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0139] That is, in the present application, when the nucleic acid includes primers and probes, if the test sample NDA is converted using bisulfite, the nucleic acid includes a fragment of at least 9 nucleotides in the sequence after the target sequence of the CHGA gene or SKOR2 gene is converted with bisulfite, and the fragment contains at least one CpG dinucleotide sequence.

[0140] In some embodiments, the nucleic acid further comprises:

[0141] Blockers that preferentially bind to target sequences in their unmethylated state.

[0142] The blocker is used to improve the amplification specificity of the PCR amplification primer. The 5' end of the blocker nucleotide sequence has an overlap region of greater than or equal to 5 nucleotides with the 3' end nucleotide sequence of the forward or reverse primer. The blocker and the forward or reverse primer are complementary to the same strand of the target gene target sequence DNA. The melting temperature of the blocker is higher than that of the forward or reverse primer by more than (including) 5°C. The nucleotide sequence of the blocker contains at least one CpG dinucleotide sequence and is complementary to the sequence of the target gene target sequence DNA that has not been methylated after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be detected is a mixture of methylated and unmethylated states, especially when the DNA in the methylated state is far less than the DNA in the unmethylated state, the DNA in the unmethylated state will preferentially bind to the blocker after bisulfite conversion, thereby inhibiting the binding of the DNA template to the PCR primer, so that PCR amplification does not occur, while the DNA in the methylated state does not bind to the blocker, and thus binds to the primer, PCR amplification occurs, and then the fragments obtained by amplification are directly or indirectly detected.

[0143] The present application provides a composition for colorectal cancer detection, wherein the composition comprises a nucleic acid for detecting methylation of a CHGA gene or a SKOR2 gene. In some embodiments, the target sequence of the CHGA gene or the SKOR2 gene is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12. In some embodiments, the nucleic acid comprises the probe composition described above.

[0144] In some embodiments, the nucleic acid comprises:

[0145] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CHGA gene or SKOR2 gene, and the fragment contains at least one CpG dinucleotide sequence. In some embodiments, the nucleic acid further includes:

[0146] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the CHGA gene or SKOR2 gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0147] In some embodiments, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the CHGA gene or the SKOR2 gene into uracil.

[0148] In the present application, the 5-position unmethylated cytosine base refers to the cytosine that has not received a methyl group on the fifth carbon, that is, the cytosine has not undergone methylation modification.

[0149] In the present application, the reagent may be, for example, bisulfite or the like.

[0150] In some embodiments, the nucleic acid further comprises:

[0151] Blockers that preferentially bind to target sequences in their unmethylated state.

[0152] The present application provides a kit comprising a reagent for detecting the marker described above, the probe composition described above, or the composition described above. In some embodiments, the kit further comprises a container for accommodating a biological sample of a subject. In some embodiments, the kit further comprises instructions for using and interpreting the test results.

[0153] In the present application, the biological sample may be, for example, whole peripheral blood, plasma or serum.

[0154] The present application does not impose any limitation on the method for detecting the methylation level of the target sequence using the above-mentioned kit, and those skilled in the art can select it as needed. For example, the present application provides a method for detecting the methylation level of the methylation marker target sequence using the above-mentioned kit, which comprises the following steps:

[0155] Collect samples from subjects;

[0156] Extracting and purifying DNA from the sample;

[0157] Constructing a DNA library for sequencing from the purified DNA sample;

[0158] The constructed DNA library is transformed with bisulfite;

[0159] Pre-PCR amplification of the bisulfite-converted DNA library;

[0160] Using the probe composition to perform hybridization capture on the sample amplified by the pre-PCR;

[0161] Amplify the products captured by hybridization using PCR;

[0162] Perform high-throughput next-generation sequencing on the products amplified by PCR and captured by hybridization;

[0163] Analyze the sequencing data to determine the methylation level of the sample;

[0164] The threshold of each marker is calculated based on the methylation status of existing samples, and the disease condition of the patient is judged based on the methylation level of a marker in the sample. If the methylation level of a marker in the sample exceeds the threshold, it is a cancer sample, and if it is lower than the threshold, it is a healthy person sample.

[0165] For example, the present application provides a method for detecting the methylation level of a target sequence of a methylation marker using the above-mentioned kit, which comprises the following steps:

[0166] (1) Draw peripheral blood from the subject and separate plasma or serum;

[0167] (2) extracting free DNA from plasma or serum;

[0168] (3) treating the free DNA obtained in step (2) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the marker is converted into uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0169] (4) contacting the free DNA treated in step (3) with a DNA polymerase and a primer of the target sequence of the marker, so that the target sequence of the treated marker is amplified to produce an amplification product or is not amplified; if the target sequence of the treated marker undergoes a DNA polymerization reaction, an amplification product will be produced; if the target sequence of the treated marker does not undergo a DNA polymerization reaction, it will not be amplified;

[0170] (5) detecting the amplified product with a probe;

[0171] (6) Based on the presence or absence of the amplification product, determining the methylation status of at least one CpG dinucleotide of the target sequence of the marker, thereby determining the methylation level of the target sequence of the marker.

[0172] The present application provides a chip, which comprises a reagent for detecting the marker described above or the probe composition described above or the composition described above.

[0173] The chip is also called a gene chip. Its sequencing principle is a hybridization sequencing method, that is, a method of determining the nucleic acid sequence by hybridization with a group of nucleic acid probes of known sequences. Probes of target nucleotides with known sequences are fixed on the surface of a substrate. When the nucleic acid sequence with a fluorescent marker in the solution produces a complementary match with the nucleic acid probe at the corresponding position on the gene chip, a group of probe sequences with completely complementary sequences are obtained by determining the probe position with the strongest fluorescence intensity.

[0174] The chip is prepared mainly by using a glass sheet or a silicon sheet as a carrier, and using in-situ synthesis and micro-matrix methods to arrange oligonucleotide fragments or cDNA as probes in sequence on the carrier.

[0175] The chip described in the present application is based on signal detection of DNA sequence hybridization after bisulfite treatment. The bisulfite treatment converts non-methylated cytosine into uracil, while the methylated cytosine remains unchanged. Uracil is then converted into thymine, and finally chip hybridization is performed. Finally, the type of added base is judged according to the fluorescent color, thereby determining whether the site is methylated.

[0176] The present application provides a method for colorectal cancer screening, which comprises:

[0177] Detecting the methylation level of methylation markers, and

[0178] The risk of the subject suffering from colorectal cancer is judged based on the methylation level, and the methylation marker is the CHGA gene or the SKOR2 gene.

[0179] Example

[0180] The present invention provides general and / or specific descriptions of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % represents wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0181] Example 1 Screening markers

[0182] 1) Sample collection: A total of 38 plasma samples from colorectal cancer patients and 99 plasma samples from healthy subjects were collected from cooperating hospitals for whole genome methylation sequencing;

[0183] 2) Candidate marker analysis: DSS software was used to perform differential analysis of the methylation sites obtained from sequencing data between healthy people and colorectal cancer patients. Filtering criteria: P < 0.05, the difference between the means of the two groups was greater than 0.1, and a total of 137 differentially methylated regions were obtained.

[0184] 3) Marker verification: Probe capture was designed for the above 137 differentially methylated regions, and the Borchen plasma sample data (number of colorectal cancer samples = 38 and number of healthy human samples = 99) were used for verification. Finally, two methylation markers that can distinguish colorectal cancer from healthy subjects were obtained, and their target sequences are shown in SEQ ID NO: 1-SEQ ID NO: 2, respectively.

[0185] According to the obtained target sequence region, a probe composition (panel) is customized, which includes a first probe composition with high methylation and a second probe composition with low methylation, wherein the first probe composition includes two probes, the nucleotide sequences of which are respectively shown in SEQ ID NOs: 13-16, and the second probe composition includes two probes, the nucleotide sequences of which are respectively shown in SEQ ID NOs: 17-20, wherein when the methylation marker is the CHGA gene, the sequence of the first probe composition is shown in SEQ ID NOs: 13-14, and the sequence of the second probe composition is shown in SEQ ID NOs: 17-18;

[0186] When the methylation marker is the SKOR2 gene, the sequence of the first probe composition is shown in SEQ ID NOs: 15-16, and the sequence of the second probe composition is shown in SEQ ID NOs: 19-20;

[0187] The sequence of SEQ ID NO:13 is as follows:

[0188] TTACCCGACGCAAAACAAAAAAACCAAAACAACGACGAAACGCATAACGAACCCGAACGCCGAACAACTAACGATATAAAACCGAACACCTAAACACCGAACGAAAAACGACTAAACTAA

[0189] The sequence of SEQ ID NO: 14 is as follows:

[0190] CCAATCCAACCGCCCCTCGCCCGATACCTAAATACCCGACCCCACACCGCCAACTACTCGACGCCCGAATCCGCCATACGCTCCGCCGCTATCCTAACTCTTCTACTCTACGCCGAACAA

[0191] The sequence of SEQ ID NO:15 is as follows:

[0192] CACCTCCTCCTACCGAAAACGCCGACTCTCGCGACGCGCTCTTCGAATCGCCCCCGAACGACAACGACGAAAACTACAACGCGAACTCCACGCCGCCCGCGAACTCTATAACAACTACCG

[0193] The sequence of SEQ ID NO:16 is as follows:

[0194] CGACAACTACCACAAAATCCGCGAACGACGTAAAACCCGCGCTACAATCCCCGCCGCTACCGCCCGAAAACGACTCGAAAAACGCGTCGCGAAAACCGACGCCCCCGACAAAAAAAAATA

[0195] The sequence of SEQ ID NO:17 is as follows:

[0196] TTACCCAACACAAAACAAAAAAACCAAAACAACAACAAAACACATAACAAACCCAAACACCAAACAACTAACAATATAAAACCAAACACCTAAACACCAAACAAAAAACAACTAAACTAA. The sequence of SEQ ID NO:18 is as follows:

[0197] CCAATCCAACCACCCCTCACCCAATACCTAAATACCCAACCCCACACCACCAACTACTCAACACCCAAATCCACCATACACTCCACCACTATCCTAACTCTTCTACTCTACACCAAACAA

[0198] The sequence of SEQ ID NO:19 is as follows:

[0199] CACCTCCTCCTACCAAAAACACCAACTCTCACAACACACTCTTCAAATCACCCCCAAACAACAACAACAAAAACTACAACACAAACTCCACACCACCCACAAACTCTATAACAACTACCA

[0200] The sequence of SEQ ID NO:20 is as follows:

[0201] CAACAACTACCACAAAATCCACAAACAATAAAACCCACACTACAATCCCCACCACTACCACCCAAAAACAACTCAAAAAACACATCACAAAAACCAACACCCCCAACAAAAAAAAATA

[0202] Then it was validated in plasma samples using Qiagen Circulating Nucleic Acid Kit was used to prepare cfDNA, catalog number 55114. METHYL-SEQ DNA LIBRARY KIT was used to prepare the library. The catalog number is 30096. The experimental detection method is as follows:

[0203] 1.1.cfDNA extraction and purification:

[0204] 1.1.1. Preparation of plasma samples:

[0205] Centrifuge the blood sample at 4°C, 2000 g for 10 min and transfer the plasma to a new centrifuge tube. Centrifuge the plasma sample at 4°C, 16000 g for 10 min and proceed to the next step depending on the type of collection tube used. The type of collection tube used in this experiment is Other.

[0206] 1.1.2. Lysis and binding:

[0207] 1.1.2.1. Pipette 100 μl, 200 μl, 300 μl, 400 μl, or 500 μl of QIAGEN Proteinase K into a 50 ml centrifuge tube.

[0208] 1.1.2.2. Add 1 ml, 2 ml, 3 ml, 4 ml, or 5 ml of plasma or serum to the above 50 ml centrifuge tube.

[0209] 1.1.2.3. Add 0.8ml, 1.6ml, 2.4ml, 3.2ml, 4.0ml Buffer ACL (containing 1.0μg carrier RNA), cover and vortex for 30s; Note: Mix thoroughly to ensure complete lysis; proceed to the next step immediately.

[0210] 1.1.2.4. Incubate at 60°C for 30 min.

[0211] 1.1.2.5. Take out the centrifuge tube, place it on the test bench, and unscrew the tube cap.

[0212] 1.1.2.6. Add 1.8ml, 3.6ml, 5.4ml, 7.2ml and 9.0ml of Buffer ACB into a 50ml centrifuge tube; cover the tube and mix for 15-30s.

[0213] 1.1.2.7. Incubate the lysis mixture on ice for 5 min.

[0214] 1.1.2.8. Insert the QIAamp Mini column into the vacuum pump connector adapter and insert the 20 ml tube extender into the column; Note: Make sure the tube extender is firmly inserted into the QIAamp Mini column to avoid sample leakage.

[0215] 1.1.2.9. Carefully add the lysate-buffer ACB mixture from step 7 to the tube extender of the QIAamp Mini column and turn on the vacuum pump. When all the lysate has been completely pumped out of the Mini column, turn off the vacuum pump and release the pressure to 0 mbar. Carefully remove and discard the tube extender.

[0216] 1.1.3. Washing:

[0217] 1.1.3.1. Add 600 μl Buffer ACW1 to the Mini column, open the cover, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0218] 1.1.3.2. Add 750 μl Buffer ACW2 to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0219] 1.1.3.3. Add 750 μl of ethanol (96-100%) to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0220] 1.1.3.4. Cover the QIAamp Mini column cap, remove it from the adapter, and discard the VacConnector. Place the QIAamp Mini column in a clean 2 ml collection tube and centrifuge at high speed (20,000 g; 14,000 rpm) for 3 min.

[0221] 1.1.3.5. Place the QIAamp Mini column in a new 2 ml collection tube. Open the tube cap and incubate at room temperature for 5 min to allow the membrane to dry completely.

[0222] 1.1.4. Elution of cfDNA:

[0223] 1.1.4.1. Place the QIAamp Mini column in a 1.5 ml elution tube and discard the 2 ml collection tube in step 1.1.3.5. Add 20-150 μl of Buffer AVE to the center of the Mini membrane; cover the tube and incubate at room temperature for 3 minutes.

[0224] 1.1.4.2. Centrifuge at full speed (20000g; 14000rpm) for 1 min to elute the nucleic acid.

[0225] For cfDNA samples, Agilent2100 performed fragment detection and Qubit was directly used for subsequent experiments.

[0226] 1.2.Bisulfite conversion and purification:

[0227] 1.2.1..Prepare CT Conversion Reagent:

[0228] 1.2.1.1. Add 700 μl NF water, 300 μl M-Dilution Buffer and 50 μl M-Dissolving Buffer to a tube of CT conversion reagent, mix well at room temperature, and vortex or shake frequently for 10 minutes.

[0229] 1.2.1.2. After mixing, divide the mixture into 10 reaction volumes.

[0230] 1.2.2. Perform bisulfite conversion on the DNA library and prepare the reaction system according to the table below.

[0231] Table 1

[0232] Components High concentration sample (1ng-2μg) volume Samples from the previous step 40μl CT Conversion Reagent 110μl Total volume 150μl

[0233] 1.2.3. Adjust the pipette to 100 μl, gently pipette and mix 6 times, then divide into two tubes and place on the PCR instrument.

[0234] 1.2.4. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0235] Table 2

[0236] temperature time 98℃ 10min 64℃ 2.5h 4℃ ∞

[0237] 1.2.5. Take a new 1.5ml centrifuge tube and add 600μl of M-Binding Buffer.

[0238] 1.2.6. After PCR, transfer the two tubes of the same sample to the corresponding 1.5ml centrifuge tubes mentioned above by brief centrifugation and mix well.

[0239] 1.2.7. Add the mixed sample to Zymo-Spin TM Invert the IC Column to mix, and centrifuge at 10,000 x g for 30 s.

[0240] 1.2.8. Add 100 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0241] 1.2.9. Add 200 μl of M-Desulphonation Buffer to the column, incubate at room temperature for 15-20 min, and centrifuge at 10,000 x g for 30 s.

[0242] 1.2.10. Add 200 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0243] 1.2.11. Repeat the previous step once.

[0244] 1.2.12. Place the column in a new collection tube and centrifuge again at 10,000 x g for 30 seconds.

[0245] 1.2.13. Place the recovery column in a new 1.5 ml EP tube, add 15 μl LOW EDTA buffer to the center of the column membrane, and centrifuge at 10,000 x g for 30 seconds.

[0246] 1.3. Transformation:

[0247] 1.3.1. Preheat the PCR instrument to 95°C.

[0248] 1.3.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0249] Table 3

[0250] temperature time 95℃ ∞ 95℃ 2min 95℃ ∞

[0251] 1.3.3. After incubation, immediately place the test tube on ice for 2 minutes.

[0252] 1.4. Connector ligation and purification:

[0253] 1.4.1. Configure the reaction system according to the following table:

[0254] Table 4

[0255] Components volume Low EDTA TE 11.5μl Buffer G1 4μl Reagent G2 4μl Reagent G3 2.5μl Enzyme G4 1μl Enzyme G5 1μl Enzyme G6 1μl DNA 15ul Total Volume 40ul

[0256] 1.4.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0257] Table 5

[0258] temperature time 37℃ ∞ 37℃ 15min 95℃ 2min 4℃ ∞

[0259] 1.5. Sample extension and purification:

[0260] 1.5.1. Configure the reaction system according to the following table:

[0261] Table 6

[0262] Components volume Reagent Y1 2μl Enzyme Y2 42μl totalVolume 44μl

[0263] 1.5.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0264] Table 7

[0265] temperature time 98℃ ∞ 98℃ 1min 62℃ 2min 65℃ 5min 4℃ ∞

[0266] 1.5.3. The liquid turns blue after adding DNA protection buffer. Mix by gently pipetting, then divide into two tubes and place on the PCR instrument.

[0267] 1.5.4. Set the following program and run: Heated lid 105°C.

[0268] Table 8

[0269] temperature time 95℃ 5min 60℃ 10min 95℃ 5min 60℃ 10min 4℃ ∞

[0270] 1.5.5. Prepare the purification system according to the following table:

[0271] Table 9

[0272] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 84ul 101μl(ratio:1.2) 15μl

[0273] 1.5.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0274] 1.5.7. Incubate at room temperature for 5 minutes.

[0275] 1.5.8. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0276] 1.5.9. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant, and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0277] 1.5.10. Repeat the above steps.

[0278] 1.5.11. Add low EDTA TE buffer in an optimal volume for elution and then shake to mix.

[0279] 1.5.12. Incubate at room temperature for 2 min.

[0280] 1.5.13. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0281] 1.5.14. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0282] 1.6. Connector ligation and purification:

[0283] 1.6.1. Prepare the library reaction system according to the following table:

[0284] Table 10

[0285] Components volume Buffer B1 3μl Reagent B2 10μl Enzyme B3 2μl TotalVolume 15μl

[0286] 1.6.2. Set the following program and run: Heated cover 0℃:

[0287] Table 11

[0288] temperature time 25℃ ∞ 25℃ 15min 4℃ ∞

[0289] 1.6.3. Prepare the purification system according to the following table:

[0290] Table 12

[0291] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 30ul 36μl(ratio:1.2) 20μl

[0292] 1.6.4. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0293] 1.6.5. Incubate at room temperature for 5 minutes.

[0294] 1.6.6. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0295] 1.6.7. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol on the inner wall of the dropper.

[0296] 1.6.8. Repeat the above steps.

[0297] 1.6.9. Add low EDTA TE buffer in an optimal volume for elution and then vortex to mix.

[0298] 1.6.10. Incubate at room temperature for 2 min.

[0299] 1.6.11. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0300] 1.6.12. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0301] 1.7. Library amplification and purification:

[0302] 1.7.1. Prepare the library reaction system according to the following table:

[0303] Table 13

[0304]

[0305]

[0306] 1.7.2. Set the following program and run: Heated lid 105℃:

[0307] Table 14

[0308]

[0309] 1.7.3. The recommended number of cycles is as follows:

[0310] Table 15

[0311] Input Recommended number of cycles 20ng cfDNA 10-11 100ng gDNA 9-10 20ng gDNA 11-12

[0312] 1.7.4. Prepare the purification system according to the following table:

[0313] Table 16

[0314] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 50μl 60μl(ratio:1.2) 22μl

[0315] 1.7.5. Transfer the PCR product into a 1.5 ml centrifuge tube.

[0316] 1.7.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0317] 1.7.7. Incubate at room temperature for 5 minutes.

[0318] 1.7.8. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0319] 1.7.9. Add 500 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0320] 1.7.10. Repeat the above steps.

[0321] 1.7.11. Place on the magnetic stand for 5-10 minutes until the beads are dry (avoid over-drying, which may result in reduced DNA recovery).

[0322] 1.7.12. Add low EDTA TE buffer to the optimal volume for elution and then vortex to mix.

[0323] 1.7.13. Incubate at room temperature for 2 min.

[0324] 1.7.14. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0325] 1.7.15. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0326] 1.7.16. Aspirate 1ul for qubit calibration and perform 2100 quality inspection.

[0327] 1.8. Hybridization of samples and probes:

[0328] 1.8.1. Mixed samples:

[0329] 1.8.1.1. The amount of DNA library can refer to the table below. The total amount can be more than 1500ng, but not more than 4μg;

[0330] Table 17

[0331] Number of mixed samples The amount of each library Total library volume per reaction 1 500ng 500ng 2 500ng 1000ng 3 500ng 1500ng 4 375ng 1500ng 8 187.5ng 1500ng

[0332] 1.8.1.2. Calculate the amount of different samples and mix them evenly in a centrifuge tube.

[0333] 1.8.1.3. Add the following pre-hybridization reagents to the mixed sample and mix well, trying not to create bubbles.

[0334] Table 18

[0335] Components volume Twist probe panel 4μl Universal sealer 8μl Blocking agent solution 5μl Methylation Enhancer 2μl

[0336] 1.8.1.4. Dry the mixed pre-hybridization reagents in a vacuum concentrator at room temperature (if heating is required, please use low temperature).

[0337] 1.8.2. Hybridization:

[0338] 1.8.2.1. Incubate Fast Hybridization Mix at 65℃ for 10 min or until all precipitates are dissolved. Vortex quickly and add 20 μl of the freeze-dried sample to resuspend the sample (do not allow the hybridization solution to return to room temperature). Mix gently with your fingertips to avoid creating bubbles.

[0339] 1.8.2.2. Rapidly centrifuge to remove bubbles and add 30 μl Hybridization Enhancer to the surface of the above reagents.

[0340] 1.8.2.3. Place the PCR tube in the preheated PCR instrument for hybridization.

[0341] 1.8.2.4. Set the following program and run: Heated lid 85°C.

[0342] Table 19

[0343] temperature time 95℃ ∞ 95℃ 5min 60℃ 15min-4h

[0344] 1.8.3. Combination:

[0345] 1.8.3.1. Shake the pre-equilibrated streptavidin magnetic beads until completely mixed, and add 100 μl of magnetic beads to a 1.5 ml centrifuge tube.

[0346] 1.8.3.2. Add 200 μl of binding buffer and mix well by pipetting.

[0347] 1.8.3.3. Place the centrifuge tube on the magnetic rack for 1 minute or until the solution becomes clear, discard the supernatant and remove the centrifuge tube.

[0348] 1.8.3.4. Repeat the above washing steps 2 times, for a total of 3 times.

[0349] 1.8.3.5. After the last wash, add 200 μl of binding buffer and resuspend by vortexing to mix thoroughly.

[0350] 1.8.3.6. After hybridization, open the lid of the PCR instrument and quickly transfer all the hybridization solution to the balanced magnetic beads.

[0351] 1.8.3.7. Mix the magnetic beads with hybridization solution thoroughly on a shaker, rocker or rotator at room temperature for 30 minutes.

[0352] 1.8.3.8. Remove the centrifuge tube from the mixer, centrifuge quickly and place it on the magnetic rack for 1 minute, remove the supernatant and remove the tube.

[0353] 1.8.3.9. Add 200 μl pre-heated Fast Wash Buffer 1 and mix well.

[0354] 1.8.3.10.Incubate at 63°C or 65°C for 5 min.

[0355] 1.8.3.11. Place the centrifuge tube on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0356] 1.8.3.12. Repeat the above steps, add 200 μl of preheated Wash Buffer 1 again and mix well.

[0357] 1.8.3.13. Incubate at 63°C or 65°C for 5 min.

[0358] 1.8.3.14. Transfer the liquid to a new tube; place it on the magnetic rack for 1 min, remove the supernatant and take out the tube.

[0359] 1.8.3.15. Add 200ul preheated wash buffer 2 and mix well using a pipette tip.

[0360] 1.8.3.16.Incubate at 48℃ for 5 min.

[0361] 1.8.3.17. Place on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0362] 1.8.3.18. Repeat (steps 3.15-3.17) and wash twice, for a total of three times.

[0363] 1.8.3.19. For the last time, use a 10μl pipette tip to aspirate the wash solution.

[0364] 1.8.3.20. Add 45 μl of water, mix well, and incubate the solution on ice.

[0365] 1.8.4. Post-capture PCR amplification, purification and quality control:

[0366] 1.8.4.1. Set the following program and run: Heated lid 105°C.

[0367] Table 20

[0368]

[0369]

[0370] 1.8.4.2. Mix the magnetic bead mixture in step 1.8.3.20 and pipette 22.5 μl into a 0.2 ml PCR tube.

[0371] 1.8.4.3. Add 2.5 μl amplification primers and 25 μl KAPA HiFi HotStart ReadyMix to a 0.2 ml PCR tube, for a total of 50 μl reaction system.

[0372] 1.8.4.4. Mix gently with a pipette tip, centrifuge quickly, place in PCR instrument and start amplification.

[0373] 1.8.4.5. Vortex to thoroughly mix the pre-equilibrated DNA purification magnetic beads.

[0374] 1.8.4.6. Add 90 μl (1.8*) DNA purification magnetic beads to the amplified PCR product and vortex to mix thoroughly.

[0375] 1.8.4.7. Incubate at room temperature for 5 min.

[0376] 1.8.4.8. Place the centrifuge tube on the magnetic rack for 1 minute and remove the supernatant after the solution becomes clear.

[0377] 1.8.4.9. Without removing the centrifuge tube from the magnetic rack, add 200 μl of freshly prepared 80% ethanol directly, incubate for 1 min, and discard the supernatant; repeat the 80% ethanol wash once (2 times in total) and keep the centrifuge tube on the magnetic rack.

[0378] 1.8.4.10. Carefully remove the remaining ethanol with a 10μl pipette tip and leave at room temperature for 5-10 minutes or until the magnetic beads are dry. Be careful not to overdry the magnetic beads.

[0379] 1.8.4.11. Remove the tube from the magnetic rack and add 32μl of water, mix thoroughly by pipetting, and incubate at room temperature for 2 minutes.

[0380] 1.8.4.12. Place the centrifuge tube on the magnetic rack for 3 minutes or until the solution becomes clear.

[0381] 1.8.4.13. Transfer 30 μl of supernatant to a clean 0.2 ml centrifuge tube.

[0382] 1.8.4.14. Take 1 μl of library and use Qubit to quantify and record the library concentration.

[0383] 1.8.4.15. Take 1 μl of sample and use Agilent 2100 to measure the library fragment length.

[0384] 1.8.4.16. Sequencing was performed using the Illumina high-throughput sequencing platform.

[0385] 1.9. Methylation bioinformatics analysis process. It is roughly as follows: use fastp quality control software to check the sequencing quality, remove low-quality reads, then use Bismark alignment software to align the clean data after quality control to the reference genome, and use Bismar_methylation_extractor software to extract the corresponding methylation sites. Finally, calculate the methylation level of the target region. If the value exceeds the threshold, it is judged as cancer, and if it is lower than the threshold, it is judged as normal.

[0386] 1.10. Based on the training set of 38 colorectal cancer samples and 99 normal human samples, the above-mentioned methylation library construction method was used to screen out biomarkers related to colorectal cancer by using the differences in methylation levels in different groups (colorectal cancer and normal), and the site data was verified in independent data sets in normal and colorectal cancer samples. A total of 2 DNA fragments that most significantly distinguished normal and cancer samples were screened out. The 2 methylation biomarkers (hereinafter referred to as sites or markers) and the discrimination thresholds are shown in Table 1;

[0387] The calculation method for the methylation level threshold is: draw the ROC curve according to the data set (including the type and methylation level of each sample), and the confusion matrix corresponding to the optimal threshold point on the ROC curve will be the basis for us to calculate indicators such as sensitivity, specificity, and accuracy. Usually we will make a selection through the Youden index. The Youden index, also known as the correct index, refers to the sum of sensitivity and specificity minus 1: Youden index = Sensitivity + Specificity – 1. The Youden index ranges from 0 to 1, representing the total ability of the classification model to detect true patients and non-patients. The larger the Youden index, the better the performance of the classification model.

[0388] Table 21 Specific performance data of methylation markers

[0389] SEQ ID Threshold Specificity Sensitivity AUC SEQ ID NO.1 0.1303 0.92 0.90 0.91 SEQ ID NO.2 0.09 0.91 0.89 0.90

[0390] Example 2

[0391] 6 human samples (S1-3 are healthy samples, S4-6 are colorectal cancer patient samples), the methylation marker detection method of the present application is used, peripheral blood is collected according to the method of Example 1; a library is built, and sequencing is performed on the Illumina platform; the sequencing data is subjected to the above-mentioned bioinformatics analysis process to obtain the methylation level of each methylation marker, and the patient's disease condition is predicted according to the threshold value of each methylation marker. If it exceeds the threshold value, it is a cancer sample, and if it is below the threshold value, it is a healthy sample. The specific results are shown in the following table:

[0392] The judgment results are as follows: 0 represents normal classification, that is, healthy; 1 represents abnormal classification, that is, tumor.

[0393] Table 22

[0394]

[0395] In summary, the inventors of the present application have obtained a methylation gene associated with colorectal cancer and determined the target sequence of the colorectal cancer methylation gene where methylation abnormalities occur. Furthermore, through the target sequence of the methylation gene, the methylation state of the gene can be sensitively and specifically detected, thereby being used for the detection of free DNA in peripheral blood. The composition described in the present application can achieve real-time monitoring with higher sensitivity and accuracy.

[0396] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. A methylation marker for detecting colorectal cancer, wherein: The methylation marker is CHGA gene or SKOR2 gene.

2. The methylation marker according to claim 1, wherein The target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12.

3. A probe composition, wherein: The probe composition comprises a probe targeting the methylation of the methylation marker target sequence according to claim 1 or 2.

4. The probe composition according to claim 3, wherein The probe composition comprises a first probe composition with high methylation and a second probe composition with low methylation, wherein the first probe composition is used for hybridizing with a region with high methylation of CG converted by bisulfite, and the second probe composition is used for hybridizing with a region with low methylation of CG converted by bisulfite; Preferably, the first probe composition comprises n probes, and the n probes hybridize with each nucleotide of the sense strand and / or antisense strand of the CG hypermethylated region converted by bisulfite. Preferably, the second probe composition comprises m probes, and the m probes hybridize with each nucleotide of the sense strand and / or antisense strand of the CG hypomethylated region converted by bisulfite. Further preferably, n and m are any integers between 1 and 10. Preferably, there are x1 nucleotide overlaps between the n-1th probe and the nth probe, and preferably, x1 is any integer between 0 and 100; Preferably, there are x2 nucleotides overlapping between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0 and 100; Further preferably, the first probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 13-16; and the second probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 17-20.

5. Use of a nucleic acid for detecting a methylation marker target sequence in the preparation of a kit for detecting colorectal cancer, wherein: The methylation marker is CHGA gene or SKOR2 gene.

6. The use according to claim 5, wherein The target sequence of the methylation marker is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12; Preferably, the nucleic acid is used to target a target sequence of a methylated marker of colorectal cancer after methylation; Preferably, the nucleic acid is the probe composition according to any one of claims 3-4.

7. The use according to any one of claims 5-6, wherein The nucleic acid comprises: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the CHGA gene or SKOR2 gene, and the fragment contains at least one CpG dinucleotide sequence; Preferably, the nucleic acid further comprises: A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the CHGA gene or SKOR2 gene under moderately stringent or stringent conditions, wherein the fragment comprises at least one CpG dinucleotide sequence; Preferably, the nucleic acid further comprises: Blockers that preferentially bind to target sequences in their unmethylated state.

8. A composition for colorectal cancer detection, wherein: The composition comprises nucleic acid for detecting methylation of CHGA gene or SKOR2 gene.

9. The composition according to claim 8, wherein The target sequence of the CHGA gene or SKOR2 gene is as shown in any one of SEQ ID NOs: 1-12 or comprises a sequence as shown in any one of SEQ ID NOs: 1-12; Preferably, the nucleic acid comprises the probe composition according to any one of claims 3-4.

10. The composition according to claim 8 or 9, wherein The nucleic acid comprises: A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the methylation marker, and the fragment contains at least one CpG dinucleotide sequence; Preferably, the nucleic acid further comprises: The probe hybridizes to at least a 15-nucleotide fragment in the target sequence of the methylation marker under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

Images