Detection method for insertion or deletion polymorphism of GNG4 gene of down producing goat and application of detection method

Abstract

The invention relates to the technical field of gene breeding, in particular to a detection method for insertion or deletion polymorphism of a GNG4 gene of a down producing goat and application of the detection method. The invention relates to an application of an insertion or deletion polymorphic site of a GNG4 gene NC030835.1: g.3706536937065370 of a down producing goat in goat growth trait-assisted selective breeding, which comprises the following steps: by taking a down producing goat whole genome to be detected as a template, amplifying the GNG4 gene through PCR (Polymerase Chain Reaction); carrying out agarose gel electrophoresis on the PCR amplification product, and identifying the mutation site according to an electrophoresis result; and carrying out assisted selective breeding on the growth traits of the goats according to the genotype of the mutation site. According to the application method for early breeding of the GNG4 gene InDel locus deletion / deletion polymorphic locus of the down producing goat, which is established by the invention, as an excellent growth character, the breeding process of an improved variety of the down producing goat can be accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of gene breeding, and in particular to a method for detecting insertion or deletion polymorphism of a cashmere goat GNG4 gene and an application thereof. Background Art

[0002] The goat breeding industry is one of the important pillars of the rapid development of my country's animal husbandry, and the Shaanxi White Cashmere Goat is a famous cashmere breed in my country, with the characteristics of tolerance to roughage and delicious meat. With the development of the economy, people's demand for Shaanxi White Cashmere Goats is growing, so the selection and breeding of individuals with excellent growth traits has always been an important issue in the goat industry, and the use of traditional breeding methods to breed goats with excellent growth traits is time-consuming and cumbersome.

[0003] Animal breeding technology mainly includes conventional breeding technology based on phenotype and phenotypic value and molecular breeding technology based on DNA polymorphism. Molecular marker-assisted selection refers to the selection of target trait genotypes with the help of molecular markers by analyzing the genotypes of molecular markers closely linked to the target gene. Molecular marker-assisted breeding shortens the breeding period, speeds up the breeding process, improves breeding efficiency, and makes the breeding process more accurate and efficient.

[0004] Insertion and Deletion (InDel) refers to the insertion or deletion of small fragments in the genome sequence, with a length of 1-50bp. The changes involved in InDel are not just on a single base, but one or more bases are inserted or deleted at a certain site on the DNA sequence compared to the reference sequence. Based on the high accuracy and stable variation of InDel markers, they are widely used in the construction of genetic maps of animal and plant populations, molecular-assisted breeding, and medical diagnosis.At present, the existing Indel research has been reported in livestock related reports: Mao et al. reported that the 11bp InDel of the DYRK2 gene was significantly associated with six different milk traits (Mao C, Ju X, Cheng H, Huang X, Jiang F, Yao Y, Lan X, Song E. Determination of genetic variation within the DYRK2 gene and its associations with milk traits in cattle. Arch Anim Breed. 2020 Sep9; 63(2): 315-323. doi: 10.5194 / aab-63-315-2020. PMID: 32964102; PMCID: PMC7500071.); Kang et al. found that the 13bp insertion and deletion mutation of the AKAP12 gene in the northern Shaanxi white cashmere goat was significantly associated with litter size (Kang Z, Bai Y, Lan X, Zhao H. Goat AKAP12: Indel Mutation Detection, Association Analysis With LitterSize and Alternative Splicing Variant Expression. Front Genet. 2021May 21;12:648256.doi:10.3389 / fgene.2021.648256.PMID:34093646;PMCID:PMC8176285.); Chen et al. detected the insertion and deletion of the porcine SOX9 gene and the corresponding expression level analysis of the SOX9 gene in Sertoli cells of 7-day-old and 5-month-old pigs and found that the insertion and deletion polymorphism and expression of SOX9 were significantly correlated with pig reproductive traits (Chen M, Wang J, Liu N, Cui W, Dong W, Xing B, Pan C. Pig SOX9: Expression profiles of Sertoli cell (SCs) and a functional 18 bp indel affecting testis weight. Theriogenology. 2019 Oct 15; 138: 94-101. doi: 10.1016 / j. theriogenology. 2019.07.008. Epub 2019 Jul 9. PMID: 31319268.). The above studies all show that InDel mutations have research value and reference significance for molecular assisted breeding of livestock.

[0005] G protein subunit γ4 (GNG4) is a member of the G protein trimer γ family and is expressed in visceral tissues such as the brain, ovary and colon. Studies have shown that GNG4 is involved in regulating ossification, B cell activation and cell cycle, and is related to the vitality, proliferation and invasion of some cancer cells.

[0006] So far, there is no report on the correlation between GNG4 gene and growth traits of cashmere goats. Summary of the invention

[0007] The purpose of the present invention is to provide a detection method for an insertion / deletion marker of a cashmere goat GNG4 gene and an application thereof, which is helpful for early breeding of early growth traits of goats by screening and combining molecular marker-assisted breeding.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The invention provides an application of an insertion or deletion polymorphic site of NC_030835.1:g.37065369_37065370 of a cashmere goat GNG4 gene in auxiliary selection breeding of goats' growth traits, wherein the nucleotide sequence of the insertion or deletion polymorphic site is shown in SEQ ID NO.1.

[0010] Furthermore, the goat growth traits include at least one of the following: body length, chest depth, chest circumference, and chest width.

[0011] Further, the insertion or deletion polymorphic site of the cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 includes three genotypes: insertion / insertion genotype, insertion / deletion genotype, and deletion / deletion genotype;

[0012] The missing / missing genotype is a genotype of excellent growth traits of cashmere goats.

[0013] The present invention provides a detection kit for insertion / deletion polymorphism of cashmere goat GNG4 gene, the kit comprising a primer pair for PCR amplification of NC_030835.1:g.37065369_37065370 position of cashmere goat GNG4 gene and a PCR reaction solution;

[0014] The primer pair comprises:

[0015] Upstream primer: 5′-CCAAGTGTCAACAGGCTCCA-3′;

[0016] Downstream primer: 5′-TCGGAACTGAGTGATGAGCG-3′.

[0017] The present invention provides a method for auxiliary selection breeding of goat growth traits, comprising the following steps:

[0018] The whole genome of the cashmere goat to be tested was used as a template to amplify the GNG4 gene by PCR, and a fragment containing the cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 was obtained;

[0019] Performing agarose gel electrophoresis on the PCR amplification product, and identifying whether the mutation site is: insertion / insertion genotype, insertion / deletion genotype, deletion / deletion genotype according to the electrophoresis result;

[0020] Assisted selection breeding of goat growth traits is carried out based on the genotype of the mutation site.

[0021] Furthermore, when amplifying the GNG4 gene by PCR, the primer pair used was:

[0022] Upstream primer: 5′-CCAAGTGTCAACAGGCTCCA-3′;

[0023] Downstream primer: 5′-TCGGAACTGAGTGATGAGCG-3′.

[0024] Further, the PCR reaction procedure is:

[0025] Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 10 min, and storage at 4°C;

[0026] The electrophoresis used agarose gel with a mass concentration of 3%.

[0027] Furthermore, the nucleic acid electrophoresis of the insertion / insertion genotype showed a band of 347 bp; the nucleic acid electrophoresis of the insertion / deletion genotype showed two bands of 347 bp and 323 bp; the nucleic acid electrophoresis of the deletion / deletion genotype showed a band of 323 bp.

[0028] Furthermore, the goat breed is the Shaanxi white cashmere goat.

[0029] The present invention has at least the following beneficial effects:

[0030] The invention designs primers according to the mutation site of GNG4 gene of cashmere goats, takes genomic DNA of cashmere goats as template, and can accurately, quickly and at low cost detect the insertion / deletion polymorphism of NC_030835.1:g.37065369_37065370 of GNG4 gene of cashmere goats through PCR amplification, agarose gel electrophoresis and direct sequencing technology;

[0031] The present invention utilizes PCR amplification technology to detect the insertion / deletion polymorphism of the GNG4 gene of cashmere goats, and performs genotype and allele frequency analysis, and for the first time finds that the GNG4 gene is significantly correlated with the growth traits of northern Shaanxi white cashmere goats, and can be used as an effective DNA marker for the genetic breeding of growth traits of northern Shaanxi white cashmere goats. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying any creative work.

[0033] Figure 1 The results of 3% agarose gel electrophoresis of the product of the primer pair amplifying the GNG4 gene of cashmere goats. Note: M stands for Marker; II stands for insertion\insertion genotype; ID stands for insertion\deletion genotype; DD stands for deletion\deletion genotype.

[0034] Figure 2 This is the sequencing diagram of the PCR amplification product of the GNG4 gene. Note: The part marked by the black box represents the 24bp insertion sequence: NC_030835.1:g.37065369_37065370, and the insertion sequence is the 24bp insertion sequence: AGGATCAAGTGCCTGCGTTGGTCA. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0036] The present invention mainly utilizes PCR and agarose gel electrophoresis methods to detect the insertion / deletion polymorphism that may be caused by mutation at the 37065369_37065370 position of goat GNG4 gene, and performs association analysis with the goat growth traits to verify that it can be used as a molecular marker for auxiliary selection in goat growth traits.

[0037] Embodiment 1:

[0038] 1. Experimental drugs and reagents

[0039] Biochemical and biological reagents: ① Taq DNA polymerase (purchased from Fermantas, MBI); ② Marker I (purchased from Tiangen Biochemical (Beijing) Co., Ltd.); ③ Proteinase K (purchased from Huamei Engineering Biology Company).

[0040] General reagents: General reagents were purchased from Huamei Engineering Biological Company and are imported packaged products: glucose, citric acid, sodium citrate, Tris, EDTA, NaCl, NaOH, Kcl, Na2HPO4, KH2PO4, Tris saturated phenol, isoamyl alcohol, chloroform, anhydrous ethanol, sodium acetate, sodium dodecyl sulfate (SDS), ethidium bromide (EB), bromophenol blue, dimethylbenzocyanate FF, sucrose, boric acid, acetic acid, agarose, etc.

[0041] Solutions and buffers: All solutions and buffers were prepared with deionized ultrapure water. The autoclave conditions were 15 bf / in (1.034×105 Pa) and 25 min. The reagent preparation methods were all based on the Molecular Cloning Experiment Guide compiled by Sambrook et al.

[0042] 1) Solution used for extracting tissue sample DNA

[0043] ① Public solution used for extracting genomic DNA;

[0044] ②2mol / LNaCl: 11.688g dissolved in water, dilute to 100mL and sterilize under high temperature and high pressure;

[0045] ③Tissue DNA extraction solution (100mL): 1mL of 1mol / L Tris-HCl (pH 8.0), 5mL of 2mol / L NaCl, 20mL of 0.5mol / L EDTA (pH 8.0), make up to 100mL.

[0046] 2) Solution used for agarose gel electrophoresis analysis

[0047] ①0.5X TBE buffer: take 50mL of 10X TBE and make up to 1000mL;

[0048] ② Loading buffer: contains 0.25% bromophenol blue and 0.25% dimethylbenzocyanate FF, and the solvent is 40.0% (w / v) sucrose aqueous solution.

[0049] 2. Design of Primers for the InDel Site of Cashmere Goat GNG4 Gene

[0050] The sequence of goat GNG4 gene was searched on NCBI, and primers capable of amplifying DNA fragments of candidate InDel sites of GNG4 gene were designed using Primer 5.0. The primer pair capable of amplifying the InDel site of the 37065369_37065370 region of the 5' upstream regulatory region of cashmere goat GNG4 gene was P8, and the primer sequences are shown in Table 1:

[0051] Table 1 Primers for candidate InDel sites of GNG4 gene in cashmere goats

[0052]

[0053] 3. PCR amplification of the 5' upstream regulatory region fragment of the cashmere goat GNG4 gene to be tested

[0054] 3.1 Collection of Cashmere Goat Ear Tissue Samples

[0055] The animals used in the experiment were selected from the Shaanxi white cashmere goats raised in a sheep farm in Yulin City, Shaanxi Province, with a total of 1241 samples. Ear tissue samples of the experimental sheep about the size of soybeans were cut with ear clippers, preserved in 70% ethanol, and stored in a -80℃ refrigerator after being brought back to the laboratory in an ice box.

[0056] 3.2 Extraction of genomic DNA from tissue samples

[0057] Refer to Sambrook et al. Molecular Cloning Experiment Guide (2002) and the following references: Bai Yangyang. Study on mRNA expression, InDel and CNV detection of PPP3CA and PPP6C genes in Shaanxi white cashmere goats and their association with important economic traits [D]. Northwest Agriculture and Forestry University, 2023.

[0058] 3.3 DNA detection by agarose gel electrophoresis

[0059] Refer to "Molecular Cloning Laboratory Manual" edited by Sambrook et al. (2002).

[0060] 3.4 DNA purification

[0061] Refer to "Molecular Cloning Laboratory Manual" edited by Sambrook et al. (2002).

[0062] 3.5 Spectrophotometric DNA detection

[0063] Use a UV photometer to measure the OD value of the extracted DNA sample at 260nm and 280nm. Calculate the DNA content and OD 260 / OD 280 The ratio of OD 260 / OD 280 If the ratio is less than 1.6, it means that the sample contains more protein or phenol and should be purified; if the ratio is greater than 1.8, consider removing RNA for purification.

[0064] DNA concentration (ng / μL) = 50 × OD 260 Value × dilution factor

[0065] After the DNA test is completed, a certain amount is taken out and diluted to 20 ng / μL, and stored in a -20°C refrigerator for later use, and the remaining samples are stored in a -80°C refrigerator.

[0066] 4. PCR Amplification

[0067] The PCR reaction adopted the mixed addition method. According to the quantity of each component required for each reaction system and the number of PCR reactions required for one reaction, the total amount of each reaction component was calculated, mixed in a 2mL centrifuge tube, and mixed thoroughly by pipetting and centrifuging instantly. Then, the mixture was dispensed into 0.2mL PCR tubes in turn, and template DNA was added in turn. PCR amplification was carried out after instant centrifugation.

[0068] The PCR reaction system includes 6.5 μL of 2×Taq SuperMix (including Taq DNA polymerase, dNTPsHE optimized reaction buffer, concentration is 2X), 0.3 μL of upstream and downstream primers (upstream and downstream primers are 10 pmol / μL each), 0.7 μL of genomic DNA (concentration is 20 ng / μL), and 5.2 μL of deionized water; a total volume of 13 μL of PCR amplification system.

[0069] PCR reaction procedure

[0070] The PCR reaction program for primer pair P1 was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 10 min, and storage at 4°C;

[0071] 5. PCR product agarose gel electrophoresis analysis

[0072] 1) Prepare a 3% agarose gel, stain with ethidium bromide (EB) nucleic acid dye, spot 6 μL of sample and perform electrophoresis at 110 V for 1 to 2 hours;

[0073] 2) After DNA fragments of different molecular weights are separated clearly, images are taken using the Invitrogen iBright gel imaging system;

[0074] 3) Analyze genotyping based on agarose gel electrophoresis results;

[0075] 4) PCR amplification was performed on cashmere goats using the primer pair, and a fragment containing the 5' upstream regulatory region NC_030835.1:g.37065369_37065370 of the cashmere goat GNG gene was amplified. The electrophoresis detection diagram of the amplified fragment is shown in ( Figure 1 ), where II is the insertion / insertion genotype, which is shown as a band of 347 bp; ID is the insertion / deletion genotype, which is shown as two bands of 347 bp and 323 bp; DD is the deletion / deletion genotype, which is shown as a band of 323 bp; the amplified fragments were sequenced and identified (sequencing results are shown in Figure 2As shown), the expected sequencing sequence is an insertion / deletion of 24bpAGGATCAAGTGCCTGCGTTGGTCA, and the actual sequencing sequence is an insertion / deletion sequence of 24bpAGGATCAAGTGCCTGCGTTGGTCA.

[0076] The nucleotide sequence of the inserted or deleted fragment is SEQ ID NO.1: AGGATCAA GTGCCTGCGTTGGTCA.

[0077] 6. Statistical analysis of InDel site frequency of GNG4 gene in cashmere goats

[0078] Genotype frequency refers to the ratio of the number of a certain genotype to the total number of individuals in a population.

[0079] The genotype frequencies of the insertion / deletion polymorphic site NC_030835.1:g.37065369_37065370 in the 5' upstream regulatory region of the GNG4 gene in Shaanxi white cashmere goats are shown in Table 2.

[0080] Table 2 Gene frequency distribution of positions 37065369_37065370 of GNG4 gene in cashmere goats

[0081]

[0082] 7. Correlation analysis of gene benefits at the InDel site of GNG4 gene in cashmere goats

[0083] Genotype data: genotype identified by agarose gel electrophoresis and sequencing after PCR amplification; production data: body length, body height, cross height, chest depth, chest circumference, chest width, tube circumference, cashmere length, hair length, cashmere production and cashmere fineness data of Shaanxi White Cashmere Goats.

[0084] SPSS26.0 software was used to analyze the correlation between the InDel polymorphic sites of the GNG4 gene and the growth shape of the Shaanxi white cashmere goat. In the process of data processing, considering the individual effect, the interaction between genes and the genotype effect, the general linear model was used to analyze the influence of different parameters on the traits: Y ijk =μ+G i +E ij , where μ is the overall mean, G i represents the genotype fixed effect, E ij Represents random error. The results of correlation analysis are shown in Table 3.

[0085] Table 3 Association analysis between the polymorphic locus of GNG4 gene P8 and the hair and growth traits of Shaanxi white cashmere goats

[0086]

[0087]

[0088] Note: P-values ​​are used to measure the probability of the observed data (or more extreme data) occurring when the null hypothesis is true. If the P value is very small, usually less than a preset threshold (0.05), it is considered unlikely that the observed data is simply due to random variation, and the null hypothesis may be rejected.

[0089] As can be seen from Table 3, there are significant differences between different genotypes at positions 37065369_37065370 of the GNG4 gene in body length (P=0.011), chest depth (P=0.016), chest circumference (P=0.043), and chest width (P=0.022) of the Shaanxi white cashmere goats. (The corresponding P values ​​of the above four traits are all less than 0.05, which is generally considered to be the threshold of statistical significance. Therefore, it can be considered that there are significant differences between different genotypes at positions 37065369_37065370 of the GNG4 gene in these four traits)

[0090] In this example, the PCR amplification method was used to detect the insertion / deletion polymorphic site NC_030835.1:g.37065369_37065370 of the GNG4 gene of cashmere goats, and the correlation analysis was performed between the site and the growth traits of Shaanxi white cashmere goats. It was found that the site can be used as an effective molecular marker for genetic breeding of goat growth traits.

[0091] Example 2

[0092] This embodiment mainly discloses, based on the above embodiment, a method for auxiliary selection breeding of goat growth traits by using the measured results, that is, different genotypes at positions 37065369-37065370 of the GNG4 gene have significant differences in body length (P=0.011), chest depth (P=0.016), chest circumference (P=0.043), and chest width (P=0.022) of Shaanxi white cashmere goats, and the steps are as follows:

[0093] The whole genome of the cashmere goat to be tested was used as a template to amplify the GNG4 gene by PCR, and a fragment containing the cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 was obtained;

[0094] Performing agarose gel electrophoresis on the PCR amplification product, and identifying whether the mutation site is: insertion / insertion genotype, insertion / deletion genotype, deletion / deletion genotype according to the electrophoresis result;

[0095] Assisted selection breeding of goat growth traits is carried out based on the genotype of the mutation site.

[0096] Obviously, according to the above Example 1, we can know that when conducting assisted selection breeding, goats with missing / missing genotypes can be selected for excellent breeding.

[0097] Example 3

[0098] This embodiment mainly discloses a detection kit for insertion / deletion polymorphism of GNG4 gene of cashmere goats, the kit comprising a primer pair for PCR amplification of NC_030835.1:g.37065369_37065370 position of GNG4 gene of cashmere goats and a PCR reaction solution;

[0099] The primer pair comprises:

[0100] Upstream primer: 5′-CCAAGTGTCAACAGGCTCCA-3′;

[0101] Downstream primer: 5′-TCGGAACTGAGTGATGAGCG-3′.

[0102] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions only describe the principles of the present invention. The present invention may be subject to various changes and improvements without departing from the spirit and scope of the present invention. These changes and improvements fall within the scope of the present invention. The scope of protection claimed by the present invention is defined by the attached claims and their equivalents.

Claims

1. An application of the insertion or deletion polymorphic site of the GNG4 gene NC_030835.1:g.37065369_37065370 of cashmere goats in goat growth trait assisted selection breeding, characterized in that: The nucleotide sequence of the insertion or deletion polymorphic site is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The goat growth traits include at least one of the following: body length, chest depth, chest circumference, and chest width.

3. The use according to claim 1, characterized in that: The insertion or deletion polymorphic site of the cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 includes three genotypes: insertion / insertion genotype, insertion / deletion genotype, and deletion / deletion genotype; The missing / missing genotype is a genotype of excellent growth traits of cashmere goats.

4. A detection kit for insertion / deletion polymorphism of GNG4 gene in cashmere goats, characterized in that: The kit comprises a primer pair for PCR amplification of cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 and a PCR reaction solution; The primer pair comprises: Upstream primer: 5′-CCAAGTGTCAACAGGCTCCA-3′; Downstream primer: 5′-TCGGAACTGAGTGATGAGCG-3′.

5. A method for auxiliary selection breeding of goat growth traits, characterized in that: The following steps are involved: The whole genome of the cashmere goat to be tested was used as a template to amplify the GNG4 gene by PCR, and a fragment containing the cashmere goat GNG4 gene NC_030835.1:g.37065369_37065370 was obtained; Performing agarose gel electrophoresis on the PCR amplification product, and identifying whether the mutation site is: insertion / insertion genotype, insertion / deletion genotype, deletion / deletion genotype according to the electrophoresis result; Assisted selection breeding of goat growth traits is carried out based on the genotype of the mutation site.

6. The method according to claim 5, characterized in that When amplifying the GNG4 gene by PCR, the primer pairs used were: Upstream primer: 5′-CCAAGTGTCAACAGGCTCCA-3′; Downstream primer: 5′-TCGGAACTGAGTGATGAGCG-3′.

7. The method according to claim 5, characterized in that The PCR reaction procedure is: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 10 min, and storage at 4°C; The electrophoresis used agarose gel with a mass concentration of 3%.

8. The method according to claim 5, characterized in that The nucleic acid electrophoresis of the insertion / insertion genotype showed a band of 347 bp; the nucleic acid electrophoresis of the insertion / deletion genotype showed two bands of 347 bp and 323 bp; the nucleic acid electrophoresis of the deletion / deletion genotype showed a band of 323 bp.

9. The method according to claim 5, characterized in that The goat breed is the Shaanxi white cashmere goat.

Images