Composition for detecting bloodstream infection pathogens based on high-throughput sequencing

Abstract

The invention belongs to the field of biological detection. The invention provides a composition for detecting bloodstream infection pathogens based on high-throughput sequencing. Comprising staphylococcus aureus, streptococcus pneumoniae, human herpes B virus type 5, staphylococcus epidermidis, streptococcus agalactiae, orientia tsutsugamushi, coxiella burnetii, chlamydia psittaci, human herpes virus type 2, human herpes virus type 4, human herpes virus type 6, candida tropicalis, enterococcus avium, staphylococcus haemolyticus, streptococcus intermedius and plasmodium vivax. And at least 4 targets in 32 blood flow infection pathogens such as human adenovirus type C, escherichia coli, torque teno virus, corynebacterium striatum and the like. By using the composition disclosed by the invention, a plurality of targets can be amplified and enriched in one tube at the same time, so that the data volume required by subsequent sequencing is remarkably reduced, the analysis work is simplified, and the whole detection is more accurate and efficient.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and in particular, relates to a composition for high-throughput sequencing detection, and more particularly, relates to a composition for high-throughput sequencing detection of bloodstream infection pathogens. Background Art

[0002] Bloodstream infection refers to a systemic inflammatory response syndrome caused by the invasion of various pathogenic microorganisms and their toxins into the blood circulation. The 2020 expert consensus on bloodstream infection in critically ill patients mentioned that bloodstream infection accounts for 40% of community-acquired and hospital-acquired sepsis and septic shock cases, and about 20% of ICU-acquired cases.

[0003] Sepsis is an important clinical problem faced by critical care medicine due to its complex pathogenesis, severe condition, high morbidity and mortality. In 2016, the American Society of Critical Care Medicine (SCCM) and the European Society of Intensive Care Medicine (ESICM) jointly released a new definition of sepsis, defining it as a clinical syndrome (Sepsis 3.0) in which the body's inflammatory response to infection is dysregulated, causing physiological and organ dysfunction. Septic shock is defined as sepsis combined with severe circulatory, cellular and metabolic disorders, and its risk of death is higher than that of simple sepsis. The new definition of sepsis emphasizes organ dysfunction caused by infection, reflecting a more complex pathophysiological state than that of ordinary infected patients. In short, sepsis involves multiple areas of infection. It is not an independent disease, but a complex, dynamic clinical syndrome with a series of physiological functions and metabolic disorders. Common sepsis detection methods include microbial culture, immunological detection, molecular biological diagnosis and other methods, but based on factors such as timeliness, accuracy, sensitivity and cost, which method is the best still needs in-depth research and discussion.

[0004] Pathogen targeted sequencing technology combines super-multiplex PCR amplification and high-throughput sequencing to detect dozens to hundreds of known pathogenic microorganisms in the sample to be tested. Pathogen targeted sequencing focuses on common bloodstream infection pathogens in clinical practice. By designing specific primers and using a super-multiplex PCR library construction system, the target sequence is targeted for amplification and enrichment, and then high-throughput sequencing is used for synchronous detection of amplified products. Since only the nucleic acid of the pathogen is sequenced during sequencing, the detection sensitivity of the pathogen can be greatly improved.

[0005] Therefore, there is a need in the art for a composition that can enrich bloodstream infection-related pathogen targets, thereby significantly reducing the amount of data required for subsequent sequencing and achieving efficient and accurate high-throughput sequencing that can detect multiple bloodstream infection pathogens in a relatively short period of time. Summary of the invention

[0006] In view of this, in a first aspect, the present invention provides a composition for detecting bloodstream infection pathogens based on high-throughput sequencing, comprising at least 4 of the following primer sets:

[0007] A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 1 to 4;

[0008] A primer set for amplifying Streptococcus pneumoniae as shown in SEQ ID NOs. 5 to 8;

[0009] A primer set for amplifying human herpes virus type 5 as shown in SEQ ID NOs. 9 to 12;

[0010] A primer set for amplifying Staphylococcus epidermidis as shown in SEQ ID NOs. 13 to 16;

[0011] A primer set for amplifying Streptococcus agalactiae as shown in SEQ ID NOs. 17 to 20;

[0012] A primer set for amplifying Orientia tsutsugamushi as shown in SEQ ID NOs. 21 to 28;

[0013] A primer set for amplifying Coxiella burnetii as shown in SEQ ID NOs. 29 to 34;

[0014] A primer set for amplifying Chlamydia psittaci as shown in SEQ ID NOs. 35 to 38;

[0015] A primer set for amplifying human herpesvirus type 2 as shown in SEQ ID NOs. 39 to 44;

[0016] A primer set for amplifying human herpesvirus type 4 as shown in SEQ ID NOs. 45 to 50;

[0017] A primer set for amplifying human herpesvirus type 6 as shown in SEQ ID NOs. 51 to 56;

[0018] A primer set for amplifying Candida tropicalis as shown in SEQ ID NOs. 57 to 60;

[0019] A primer set for amplifying Enterococcus avium as shown in SEQ ID NOs. 61 to 64;

[0020] A primer set for amplifying hemolytic Staphylococcus as shown in SEQ ID NOs. 65 to 70;

[0021] A primer set for amplifying Streptococcus intermedius as shown in SEQ ID NOs. 71 to 74;

[0022] A primer set for amplifying Plasmodium malariae as shown in SEQ ID NOs. 75 to 78;

[0023] A primer set for amplifying human adenovirus type C as shown in SEQ ID NOs. 79 to 84;

[0024] A primer set for amplifying Escherichia coli as shown in SEQ ID NOs. 85 to 90;

[0025] A primer set for amplifying parvovirus as shown in SEQ ID NOs. 91 to 96;

[0026] A primer set for amplifying Corynebacterium striatum as shown in SEQ ID NOs. 97 to 102;

[0027] A primer set for amplifying Staphylococcus capitis as shown in SEQ ID NOs. 103-104;

[0028] A primer set for amplifying Staphylococcus lugdunensis as shown in SEQ ID NOs. 105 to 108;

[0029] A primer set for amplifying Mycoplasma hominis as shown in SEQ ID NOs. 109 to 110;

[0030] A primer set for amplifying Veillonella parvum as shown in SEQ ID NOs. 111 to 116;

[0031] A primer set for amplifying Micromonas parvum as shown in SEQ ID NOs. 117 to 120;

[0032] A primer set for amplifying Nocardia pseudomallei as shown in SEQ ID NOs. 121 to 122;

[0033] A primer set for amplifying Toxoplasma gondii as shown in SEQ ID NOs. 123 to 126;

[0034] A primer set for amplifying Streptococcus constellatus as shown in SEQ ID NOs. 127 to 130;

[0035] A primer set for amplifying Saccharomyces cerevisiae as shown in SEQ ID NOs. 131 to 136;

[0036] A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 137 to 142;

[0037] A primer set for amplifying Streptococcus pyogenes as shown in SEQ ID NOs. 143 to 148; or

[0038] The primer set for amplifying Streptococcus pseudopneumoniae is shown in SEQ ID NOs. 149-154.

[0039] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising at least 8 sets of primer sets as shown above.

[0040] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising at least 10 sets of primer sets as shown above.

[0041] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising at least 20 sets of primer sets as shown above.

[0042] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising at least 25 of the primer sets shown above.

[0043] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising at least 30, 31, or 32 sets of targets in the primer sets shown above.

[0044] By using the composition of the present invention, multiple targets can be amplified and enriched simultaneously in one tube, so that the amount of data required for subsequent sequencing is significantly reduced, the analysis work is simplified, and the entire detection is made more accurate and efficient.

[0045] It should be noted that those skilled in the art know that if 32 targets can be amplified by PCR in one tube at the same time, any combination of the 32 targets (e.g., any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32) can be amplified by PCR in one tube, which is beyond doubt. The present invention also protects any combination of the detection primers of any of the above-mentioned targets.

[0046] Furthermore, the present invention provides a composition based on high-throughput sequencing detection, comprising:

[0047] A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 1 to 4;

[0048] A primer set for amplifying Streptococcus pneumoniae as shown in SEQ ID NOs. 5 to 8;

[0049] A primer set for amplifying human herpes virus type 5 as shown in SEQ ID NOs. 9 to 12;

[0050] A primer set for amplifying Staphylococcus epidermidis as shown in SEQ ID NOs. 13 to 16;

[0051] A primer set for amplifying Streptococcus agalactiae as shown in SEQ ID NOs. 17 to 20;

[0052] A primer set for amplifying Orientia tsutsugamushi as shown in SEQ ID NOs. 21 to 28;

[0053] A primer set for amplifying Coxiella burnetii as shown in SEQ ID NOs. 29 to 34;

[0054] A primer set for amplifying Chlamydia psittaci as shown in SEQ ID NOs. 35 to 38;

[0055] A primer set for amplifying human herpesvirus type 2 as shown in SEQ ID NOs. 39 to 44;

[0056] A primer set for amplifying human herpesvirus type 4 as shown in SEQ ID NOs. 45 to 50;

[0057] A primer set for amplifying human herpesvirus type 6 as shown in SEQ ID NOs. 51 to 56;

[0058] A primer set for amplifying Candida tropicalis as shown in SEQ ID NOs. 57 to 60;

[0059] A primer set for amplifying Enterococcus avium as shown in SEQ ID NOs. 61 to 64;

[0060] A primer set for amplifying hemolytic Staphylococcus as shown in SEQ ID NOs. 65 to 70;

[0061] A primer set for amplifying Streptococcus intermedius as shown in SEQ ID NOs. 71 to 74;

[0062] A primer set for amplifying Plasmodium malariae as shown in SEQ ID NOs. 75 to 78;

[0063] A primer set for amplifying human adenovirus type C as shown in SEQ ID NOs. 79 to 84;

[0064] A primer set for amplifying Escherichia coli as shown in SEQ ID NOs. 85 to 90;

[0065] A primer set for amplifying parvovirus as shown in SEQ ID NOs. 91 to 96;

[0066] A primer set for amplifying Corynebacterium striatum as shown in SEQ ID NOs. 97 to 102;

[0067] A primer set for amplifying Staphylococcus capitis as shown in SEQ ID NOs. 103-104;

[0068] A primer set for amplifying Staphylococcus lugdunensis as shown in SEQ ID NOs. 105 to 108;

[0069] A primer set for amplifying Mycoplasma hominis as shown in SEQ ID NOs. 109 to 110;

[0070] A primer set for amplifying Veillonella parvum as shown in SEQ ID NOs. 111 to 116;

[0071] A primer set for amplifying Micromonas parvum as shown in SEQ ID NOs. 117 to 120;

[0072] A primer set for amplifying Nocardia pseudomallei as shown in SEQ ID NOs. 121 to 122;

[0073] A primer set for amplifying Toxoplasma gondii as shown in SEQ ID NOs. 123 to 126;

[0074] A primer set for amplifying Streptococcus constellatus as shown in SEQ ID NOs. 127 to 130;

[0075] A primer set for amplifying Saccharomyces cerevisiae as shown in SEQ ID NOs. 131 to 136;

[0076] A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 137 to 142;

[0077] A primer set for amplifying Streptococcus pyogenes as shown in SEQ ID NOs. 143 to 148; and

[0078] The primer set for amplifying Streptococcus pseudopneumoniae is shown in SEQ ID NOs. 149-154.

[0079] By using the composition of the present invention, 32 targets can be amplified and enriched simultaneously in one tube, so that the amount of data required for subsequent sequencing is significantly reduced, which provides a high-throughput sequencing method that is efficient and accurate and can detect multiple bloodstream infection pathogens in a short time.

[0080] Furthermore, the primer sets all carry adapter sequences to facilitate sequencing.

[0081] Furthermore, the upstream primer linker sequence is ACACGACGCTCTTCCGATCT, and the downstream primer linker sequence is CTTGGCACCCGAGAATTCCA.

[0082] In some specific embodiments, the components of the composition are present in the same package.

[0083] Furthermore, the components of the composition of the present invention are present in a mixed form.

[0084] In a second aspect, the present invention provides a use of the above-mentioned composition in preparing a kit for high-throughput sequencing detection of bloodstream infection pathogens.

[0085] In a third aspect, the present invention provides a kit for detecting bloodstream infection pathogens by high-throughput sequencing, comprising the above-mentioned composition.

[0086] Furthermore, the kit also includes at least one of the following: a nucleic acid extraction reagent, a nucleic acid amplification reagent, and a library construction reagent.

[0087] Furthermore, the nucleic acid extraction reagent may be a reagent for extracting DNA from a sample such as blood.

[0088] Furthermore, the nucleic acid amplification reagent includes DNA polymerase, dNTP and buffer.

[0089] Furthermore, the library construction reagents include fragmentation reagents, end repair reagents, adapter ligation reagents, and library amplification reagents.

[0090] In a fourth aspect, the present invention provides a use of preparing a composition for high-throughput sequencing detection of bloodstream infection pathogens, wherein the detection comprises:

[0091] 1) Extracting or releasing nucleic acid from the sample to be tested;

[0092] 2) amplifying using the composition as described above to obtain an amplified product;

[0093] 3) Processing the amplified products and building a library; and

[0094] 5) Sequencing and analyzing the results.

[0095] Furthermore, the conditions for the amplification are:

[0096] BRIEF DESCRIPTION OF THE DRAWINGS

[0097] Figure 1 Construct a flow chart for the library;

[0098] Figure 2 Build schematics for the library;

[0099] Figures 3-4 This is the result diagram of library fragment size. DETAILED DESCRIPTION

[0100] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0101] Example 1: Primers used in the present invention

[0102] The primer sets used in the present invention are shown in Table 1.

[0103] Table 1

[0104]

[0105]

[0106]

[0107]

[0108] Example 2: Method for detecting different targets based on high-throughput sequencing

[0109] The specific library construction process is as follows Figure 1 The principle is as follows. Figure 2 As shown, in brief, specific primers are designed based on the target region of the pathogenic microorganism, and the first round of amplification is performed using the nucleic acid to be tested as a template. The resulting amplified product is fragmented, and a universal sequence is added to the 5' end. After adding the label primer, a second round of amplification is performed to complete the library construction.

[0110] The synthesized multiple amplification primers (100 μM) were mixed in the same volume.

[0111] 1. Sample preparation

[0112] This method uses a magnetic bead blood genomic DNA extraction kit (DM101) for nucleic acid extraction, and the steps are as follows:

[0113] a) Add 2 times the volume of blood sample Buffer EL to the sample, invert 10 times to mix thoroughly, centrifuge at 10,000rpm (11,500×g) for 1min, discard the supernatant, keep the white blood cell pellet, add 50μL PBS to the white blood cell pellet, vortex to mix thoroughly, and then proceed to the next step of the experiment. Add 20μL proteinase K and 300μL Buffer DCL, vortex to mix for 30sec, then place the centrifuge tube in a 65℃ water bath for 15min, invert and mix 3 times, 5 times each time

[0114] b) Add 20 μL MagΜLtra Beads and 350 μL isopropanol to the above reaction system, shake and mix for 5 min, and let stand at room temperature for 2 min.

[0115] c) Centrifuge briefly and place the centrifuge tube on a magnetic rack for 1 min. Wait until the magnetic beads are completely adsorbed and carefully discard the supernatant.

[0116] d) Remove the centrifuge tube from the magnetic rack, add 700 μL Buffer WA, and vortex to mix for 1 min.

[0117] e) After instant centrifugation, place the centrifuge tube on the magnetic rack and let it stand for 30 seconds until the magnetic beads are completely adsorbed, then carefully discard the supernatant.

[0118] f) Repeat steps d and e once more.

[0119] g) Remove the centrifuge tube from the magnetic rack, add 700 μL Buffer WB, and vortex to mix for 1 min.

[0120] h) After instant centrifugation, place the centrifuge tube on a magnetic rack and let it stand for 30 seconds until the magnetic beads are completely adsorbed, then carefully discard the supernatant.

[0121] i) Keep the centrifuge tube on the magnetic rack, open the tube cover, and dry it at room temperature.

[0122] j) Remove the centrifuge tube from the magnetic rack, add 50 μL Elution Buffer, vortex and mix for 30 seconds, place in a 75°C water bath for 5 minutes, invert and mix twice, and each time for 5 times.

[0123] k) After instant centrifugation, place the centrifuge tube on a magnetic rack and let it stand for 2 minutes. After the magnetic beads are completely adsorbed, transfer the DNA solution to a new centrifuge tube.

[0124] 2. First round of multiplex amplification

[0125] The extracted gDNA (40 ng) was used as a template, and multiple PCR amplification was performed using Paragon Genomics mPCR amplification reagent and a mixed primer set. The amplification system is shown in Table 2. The GE series PCR instrument GE482-A of Boheng Technology was used, and the amplification parameters are shown in Table 3.

[0126] Table 2

[0127]

[0128] Table 3

[0129]

[0130] After the reaction, add 2 μL Stop buffer and mix by vortexing for 10 seconds.

[0131] 3. Purification after the first round of PCR amplification

[0132] Add 10 μL of nuclease-free water and 29 μL of Agencourt AMPure XP magnetic beads to each PCR product, shake and mix, let stand for 3 minutes, centrifuge, place on a magnetic rack and let stand for 5 minutes, and discard the supernatant after the magnetic beads are adsorbed.

[0133] Add 200 μL of 70% ethanol, rotate the centrifuge tube on the magnetic rack for two weeks, and discard the supernatant after the magnetic beads are adsorbed.

[0134] Then add 200 μL of 70% ethanol, rotate the centrifuge tube on the magnetic rack for two weeks, and discard the supernatant after the magnetic beads are adsorbed.

[0135] After discarding the supernatant, open the centrifuge tube and let it stand to dry for 5 minutes. After drying, add 10μL TE buffer, shake and mix, and let it stand for 3 minutes. After standing, centrifuge and place the centrifuge tube on a magnetic rack to transfer to a new centrifuge tube after the magnetic beads are adsorbed.

[0136] 4. Library fragmentation

[0137] Take 10 μL of the purified PCR product and use Paragon Genomics NGS Pane library construction kit, the reaction reagents were configured according to the following system and fragmented at 37°C for 10 min. Then 29 μL Agencourt AMPure XP magnetic beads were added for purification.

[0138] Table 4

[0139] Reagent name Volume (μL) PCR products 13 CP Reagent Buffer 2 CP Digestion Reagent 2 Nuclease-free water 3

[0140] 5. Library Amplification

[0141] Using the fragmented purified product as a template, the library amplification reaction system was configured according to Table 5. The i5 / i7index used was synthesized by itself, and the PCR reaction was performed according to the procedure. After the reaction was completed, 40 μL Agencourt AMPure XP magnetic beads were added for purification, and then the library construction was completed.

[0142] Table 5

[0143] Reagent name Volume (μL) Fragmentation products 10 5x 2nd PCR mix 8 i5 / i7 index 4 Nuclease-free water 18

[0144] Use the Bio-Tech GE series PCR instrument GE482-A and set the cycle parameters according to Table 6 for PCR amplification:

[0145] Table 6

[0146]

[0147] 6. Library quality inspection on the computer

[0148] use The dsDNAHS Assay Kit was used to measure the library concentration. The specific operation is as follows:

[0149] Preparation of standards: Divide 190 μL of Qubit dsDNA HS Master Mix into two centrifuge tubes for standards, add 10 μL of standards Qubit dsDNA HS Standard #1 and Qubit dsDNA HS Standard #2 respectively, vortex to mix well, and be careful not to form bubbles.

[0150] Take 1 μL of the sample to be tested and 199 μL of Qubit dsDNAHS Master Mix and vortex to mix.

[0151] 7. Sequencing

[0152] The library samples were sequenced using the NextSeq CN500 gene sequencer (registration certificate number: National Medical Device Registration No. 20153220460) using the SE758+8 mode, and the data volume of each library was 2M.

[0153] The prepared standards and samples were allowed to react at room temperature for 3 min, and the library concentration was measured using a Qubit 3.0fluorometer.

[0154] The fragment size of the library was detected by Qsep400. The fragment size should be concentrated in 100-200bp. The results of two parallel experiments are as follows: Figures 3-4 shown.

[0155] 8. Results Analysis

[0156] The sequencing results show that this set of primers can specifically amplify the target sequence and detect pathogens with a data volume of 2M. The amount of data required for this experimental method is much smaller than the amount of data required for metagenomic sequencing (20M). While ensuring accurate and reliable results, it is more economical and efficient, greatly reducing the workload.

[0157] Example 3: Test results of the test samples of the composition of the present invention

[0158] The gDNA mixed samples of 32 bloodstream infection pathogens were detected in the manner of Example 2 using the composition shown in Table 1. The test results are shown in Table 7 below. The offline data reads were aligned to the pathogen reference genome using the mem algorithm of the BWA software, and the optimal aligned reads with a score of more than 30 were considered to be the reads detected by this method. From the results, it can be seen that the composition of the present invention can amplify and enrich all targets within one tube, and the detection of pathogens contained in the same sample is consistent with metagenomic sequencing, and the number of reads generated is much higher than the metagenomic sequencing method, and metagenomic sequencing requires more on-machine data (20M).

[0159] Table 7

[0160]

[0161]

[0162]

Claims

1. A composition for detecting bloodstream infection pathogens based on high-throughput sequencing, comprising at least 4 of the following primer sets: A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 1 to 4; A primer set for amplifying Streptococcus pneumoniae as shown in SEQ ID NOs. 5 to 8; A primer set for amplifying human herpes virus type 5 as shown in SEQ ID NOs. 9 to 12; A primer set for amplifying Staphylococcus epidermidis as shown in SEQ ID NOs. 13 to 16; A primer set for amplifying Streptococcus agalactiae as shown in SEQ ID NOs. 17 to 20; A primer set for amplifying Orientia tsutsugamushi as shown in SEQ ID NOs. 21 to 28; A primer set for amplifying Coxiella burnetii as shown in SEQ ID NOs. 29 to 34; A primer set for amplifying Chlamydia psittaci as shown in SEQ ID NOs. 35 to 38; A primer set for amplifying human herpesvirus type 2 as shown in SEQ ID NOs. 39 to 44; A primer set for amplifying human herpesvirus type 4 as shown in SEQ ID NOs. 45 to 50; A primer set for amplifying human herpesvirus type 6 as shown in SEQ ID NOs. 51 to 56; A primer set for amplifying Candida tropicalis as shown in SEQ ID NOs. 57 to 60; A primer set for amplifying Enterococcus avium as shown in SEQ ID NOs. 61 to 64; A primer set for amplifying hemolytic Staphylococcus as shown in SEQ ID NOs. 65 to 70; A primer set for amplifying Streptococcus intermedius as shown in SEQ ID NOs. 71 to 74; A primer set for amplifying Plasmodium malariae as shown in SEQ ID NOs. 75 to 78; A primer set for amplifying human adenovirus type C as shown in SEQ ID NOs. 79 to 84; A primer set for amplifying Escherichia coli as shown in SEQ ID NOs. 85 to 90; A primer set for amplifying parvovirus as shown in SEQ ID NOs. 91 to 96; A primer set for amplifying Corynebacterium striatum as shown in SEQ ID NOs. 97 to 102; A primer set for amplifying Staphylococcus capitis as shown in SEQ ID NOs. 103-104; A primer set for amplifying Staphylococcus lugdunensis as shown in SEQ ID NOs. 105 to 108; A primer set for amplifying Mycoplasma hominis as shown in SEQ ID NOs. 109 to 110; A primer set for amplifying Veillonella parvum as shown in SEQ ID NOs. 111 to 116; A primer set for amplifying Micromonas parvum as shown in SEQ ID NOs. 117 to 120; A primer set for amplifying Nocardia pseudomallei as shown in SEQ ID NOs. 121 to 122; A primer set for amplifying Toxoplasma gondii as shown in SEQ ID NOs. 123 to 126; A primer set for amplifying Streptococcus constellatus as shown in SEQ ID NOs. 127 to 130; A primer set for amplifying Saccharomyces cerevisiae as shown in SEQ ID NOs. 131 to 136; A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 137 to 142; A primer set for amplifying Streptococcus pyogenes as shown in SEQ ID NOs. 143 to 148; or The primer set for amplifying Streptococcus pseudopneumoniae is shown in SEQ ID NOs. 149-154.

2. The composition according to claim 1, characterized in that The composition comprises at least 10 of the primer sets as claimed in claim 1.

3. The composition according to claim 2, characterized in that The composition includes a primer set as shown below: A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 1 to 4; A primer set for amplifying Streptococcus pneumoniae as shown in SEQ ID NOs. 5 to 8; A primer set for amplifying human herpes virus type 5 as shown in SEQ ID NOs. 9 to 12; A primer set for amplifying Staphylococcus epidermidis as shown in SEQ ID NOs. 13 to 16; A primer set for amplifying Streptococcus agalactiae as shown in SEQ ID NOs. 17 to 20; A primer set for amplifying Orientia tsutsugamushi as shown in SEQ ID NOs. 21 to 28; A primer set for amplifying Coxiella burnetii as shown in SEQ ID NOs. 29 to 34; A primer set for amplifying Chlamydia psittaci as shown in SEQ ID NOs. 35 to 38; A primer set for amplifying human herpesvirus type 2 as shown in SEQ ID NOs. 39 to 44; A primer set for amplifying human herpesvirus type 4 as shown in SEQ ID NOs. 45 to 50; A primer set for amplifying human herpesvirus type 6 as shown in SEQ ID NOs. 51 to 56; A primer set for amplifying Candida tropicalis as shown in SEQ ID NOs. 57 to 60; A primer set for amplifying Enterococcus avium as shown in SEQ ID NOs. 61 to 64; A primer set for amplifying hemolytic Staphylococcus as shown in SEQ ID NOs. 65 to 70; A primer set for amplifying Streptococcus intermedius as shown in SEQ ID NOs. 71 to 74; A primer set for amplifying Plasmodium malariae as shown in SEQ ID NOs. 75 to 78; A primer set for amplifying human adenovirus type C as shown in SEQ ID NOs. 79 to 84; A primer set for amplifying Escherichia coli as shown in SEQ ID NOs. 85 to 90; A primer set for amplifying parvovirus as shown in SEQ ID NOs. 91 to 96; A primer set for amplifying Corynebacterium striatum as shown in SEQ ID NOs. 97 to 102; A primer set for amplifying Staphylococcus capitis as shown in SEQ ID NOs. 103-104; A primer set for amplifying Staphylococcus lugdunensis as shown in SEQ ID NOs. 105 to 108; A primer set for amplifying Mycoplasma hominis as shown in SEQ ID NOs. 109 to 110; A primer set for amplifying Veillonella parvum as shown in SEQ ID NOs. 111 to 116; A primer set for amplifying Micromonas parvum as shown in SEQ ID NOs. 117 to 120; A primer set for amplifying Nocardia pseudomallei as shown in SEQ ID NOs. 121 to 122; A primer set for amplifying Toxoplasma gondii as shown in SEQ ID NOs. 123 to 126; A primer set for amplifying Streptococcus constellatus as shown in SEQ ID NOs. 127 to 130; A primer set for amplifying Saccharomyces cerevisiae as shown in SEQ ID NOs. 131 to 136; A primer set for amplifying Staphylococcus aureus as shown in SEQ ID NOs. 137 to 142; A primer set for amplifying Streptococcus pyogenes as shown in SEQ ID NOs. 143 to 148; and The primer set for amplifying Streptococcus pseudopneumoniae is shown in SEQ ID NOs. 149-154.

4. The composition according to any one of claims 1 to 3, characterized in that The primer sets all have linker sequences.

5. The composition according to claim 4, characterized in that The upstream primer linker sequence is shown in SEQ ID NO.275: ACACGACGCTCTTCCGATCT, and the downstream primer linker sequence is shown in SEQ ID NO.276: CTTGGCACCCGAGAATTCCA.

6. The composition according to claim 5, characterized in that The components of the composition are present in admixture.

7. Use of the composition according to any one of claims 1 to 6 for preparing a kit for high-throughput sequencing detection of bloodstream infection pathogens.

8. A kit for detecting bloodstream infection pathogens by high-throughput sequencing, comprising the composition according to any one of claims 1 to 6.

9. The kit according to claim 8, characterized in that The kit further comprises at least one of the following: a nucleic acid extraction reagent, a nucleic acid amplification reagent, and a library construction reagent.

10. A use of a composition for preparing a high-throughput sequencing detection of bloodstream infection pathogens, wherein: The detection includes: 1) Extracting or releasing nucleic acid from the sample to be tested; 2) amplifying using the composition according to any one of claims 1 to 6 to obtain an amplified product; 3) Processing the amplified products and building a library; and 5) Sequencing and analyzing the results.

Images