SNP sites related to sesame fusarium wilt resistance and applications thereof

By identifying SNP sites on chromosome 1 of sesame, the problem of insufficient research on sesame wilt resistance was solved, enabling efficient breeding screening and improving the efficiency of sesame breeding.

CN119351598BActive Publication Date: 2025-11-07INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411404617.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-10
Publication Date
2025-11-07
Estimated Expiration
2044-10-10

AI Technical Summary

Technical Problem

There is a lack of research on the molecular mechanisms related to resistance to Fusarium wilt in existing technologies, and there is a lack of effective regulatory genes and molecular markers, which leads to low efficiency in sesame breeding and difficulty in efficiently screening disease-resistant varieties.

Method used

The SNP loci at chromosome 1 of sesame (2933576, 2938347, 2945542, 2947129) and their corresponding primer sets and detection reagents are provided to identify whether sesame is resistant to or susceptible to Fusarium wilt, and to screen target breeding plants through genotyping.

Benefits of technology

It enables efficient genotyping of seeds or seedlings, reduces field workload, improves breeding efficiency, preserves disease-resistant offspring, and enhances sesame breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005076183580000011
    Figure HDA0005076183580000011
  • Figure HDA0005076183580000012
    Figure HDA0005076183580000012
  • Figure HDA0005076183580000013
    Figure HDA0005076183580000013
Patent Text Reader

Abstract

The application belongs to the field of sesame biotechnology, and particularly relates to SNP sites related to sesame fusarium wilt resistance and application thereof. The SNP sites are located at 2933576, 2938347, 2945542 and 2947129 of chromosome 1 of sesame. When the site genotype is TAAA, the sesame can be identified and detected for fusarium wilt resistance, and when the site genotype is CGGG, the sesame can be identified and detected for fusarium wilt susceptibility. Compared with the prior art, the method provided by the application can detect the genotype of seeds or seedlings, screen single plants with breeding targets, reduce the workload of field planting, investigation and other links, and as much as possible retain the disease-resistant offspring, thereby improving the breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of sesame, and particularly relates to SNP sites related to the resistance of sesame to fusarium wilt and application thereof. BACKGROUND

[0002] Sesame oil is the most popular oil in China and even in the world, and its raw material sesame also plays an important role in traditional Chinese culture. For example, the idiom 'Sesame grows higher and higher' is a well-known auspicious saying in China. 'Lost the watermelon and picked up the sesame', 'Sesame small official' and the like not only truly reflect the'smallness' of sesame grains, but also indicate that the breeding of sesame and the improvement of high-yield varieties are very difficult. Sesame is a healthy and characteristic oil crop widely planted in the world, with a high oil content of 55%, and is known as 'the queen of oil plants'. China has a history of more than 2,200 years of sesame planting, and is still an important sesame producing and consuming country in the world, and has made important contributions to the development of the global sesame industry.

[0003] Fusarium wilt is a fungal disease caused by Fusarium oxysporum, which occurs and is seriously occurred in the sesame planting areas in China, with an annual incidence rate of about 15%, and the incidence rate can be more than 30% in severe cases. It is one of the main diseases affecting the yield and quality of sesame and restricting the development of sesame, and improving the disease resistance of sesame and increasing the yield of sesame are important work of sesame breeding.

[0004] SNP (Single nucleotide polymorphism) is the most ideal molecular marker for constructing a high-density genetic map, with the largest number, the most extensive distribution and the best polymorphism in the genome. High-throughput sequencing technology is the main method for developing high-quality SNPs, and with the reduction of sequencing cost, SNP has gradually become a widely used molecular marker of the new generation, and has become a powerful tool for QTL positioning and candidate gene identification. However, at present, there are few studies on the molecular mechanism related to the resistance of sesame to fusarium wilt, and the available regulatory genes and molecular markers need to be further explored. SUMMARY

[0005] To solve the above problems, the application provides SNP sites related to the resistance of sesame to fusarium wilt, which are located at 2933576, 2938347, 2945542 and 2947129 of sesame chromosome 1, and are T / C, A / G, A / G and A / G in turn.

[0006] The application also provides a primer set for amplifying the above SNP marker.

[0007] The application also provides a detection reagent for identifying the above SNP marker, which comprises the above primer set.

[0008] The application further provides a detection kit for identifying the SNP marker, comprising the primer set or the detection reagent.

[0009] The application further provides application of the SNP site in breeding of the sesame.

[0010] The application further provides application of the SNP site in identifying the resistance of the sesame to the fusarium wilt.

[0011] The application further provides a method for identifying whether the sesame is resistant to the fusarium wilt, detecting the genotype of the gene at 2933576, 2938347, 2945542 and 2947129 of the chromosome 1 of the sesame, and when the genotype is TAAA, the sample is resistant to the fusarium wilt.

[0012] The application further provides a method for identifying whether the sesame is susceptible to the fusarium wilt, detecting the genotype of the gene at 2933576, 2938347, 2945542 and 2947129 of the chromosome 1 of the sesame, and when the genotype is CGGG, the sample is susceptible to the fusarium wilt.

[0013] The application has the following beneficial effects:

[0014] Compared with the prior art, the method provided by the application can detect the genotype of the seed or the seedling, screen single plants with breeding targets, reduce the workload of field planting, investigation and other links, retain as many disease-resistant offspring as possible, and improve the breeding efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0016] Figure 1 QTL positioning result diagram;

[0017] Figure 2 F2 population grouping result diagram in Example 1;

[0018] Figure 3 F2 population grouping result diagram in Example 2;

[0019] Figure 4 SNP site schematic diagram. DETAILED DESCRIPTION

[0020] The following detailed description of various example embodiments of the application will be better understood when read in conjunction with the appended drawings. While the application is not restricted to any particular method of implementation, the examples illustrate the methods and procedures by which the application can be practiced. The examples are intended to be illustrative, but not restrictive.

[0021] It should be understood that the terms used herein are for the purpose of describing particular embodiments and are not intended to limit the application. Additionally, for numerical ranges that are expressed in a range format, it is intended that any numerical value, which is within the range, is also specifically contemplated. For example, a range of 1.0 to 10.0 should be read to include the value of 6.1. The upper and lower limits of these smaller ranges can independently be included or excluded in the larger ranges. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not construed as an admission that it is prior art with respect to the present application.

[0022] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not construed as an admission that it is prior art with respect to the present application.

[0023] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Other implementations of this application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples and embodiments described herein are exemplary only and are not intended to be limiting.

[0024] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0025] Example 1: SNP discovery

[0026] 1. The hybrid combination was constructed with 201029-0-9-3-0-9-1 (resistant to Fusarium wilt) as the female parent and ZZM00254 (sensitive to Fusarium wilt) as the male parent. The parent materials were provided by Hebei Agricultural Biological Resource Preservation Center. The hybridization was completed in Shijiazhuang, Hebei in the summer of 2020. The F1 was planted in Sanya, Hainan for generation and selfing in the winter of the same year. The F2 was harvested and planted in Shijiazhuang, Hebei in the summer of 2021. There were a total of 169 single plants, and the conventional field management was carried out. The incidence of Fusarium wilt in the single plants of the parent and F2 population was investigated.

[0027] 2, DNA of parents and F2 single plants were extracted by CTAB method, and the integrity of DNA was detected by agarose gel electrophoresis, and the concentration of DNA was determined by NanoDrop 2000.

[0028] 3, SNP of the population was developed by resequencing technology, and the experimental process was performed according to the standard protocol provided by Illumina company, including sample quality detection, library construction, library quality detection and library sequencing.

[0029] 4, The data was filtered according to the data analysis method of LI et al., and the high-quality sequence was aligned to the sesame reference genome by BWA (0.7.17) software. SNP markers were identified by GATK (4.0.11.0) software.

[0030] 5, First, filter the following low-quality reads: remove the adapter sequence; remove the proportion of uncertain base type greater than 10%; remove the reads containing more than 50% low-quality bases. After filtering the high-quality reads, first use GATK software to detect SNP, and then use MSTMap software to construct genetic map, and the LOD value is 4.0-20.0.

[0031] 6, Combined with the genetic map and fiber quality data, QTL was located by ICIM program of QTL IciMapping 4.0 software, and the parameters were Step = 1 cM, PIN = 0.001, and the LOD value was determined by 1000 iterations. A major QTL with a contribution rate of 23.84% was located on chromosome 1, with a LOD value of 7.56, named qWilt-chr1( Figure 1 )。

[0032] 7, According to the genomic position, qWilt-chr1 is located at 35-45 Mb on chromosome 1, and the sequence at the peak of LOD value is chr12933576-2947129, there are 4 base differences between the maternal and paternal materials, located at 2933576, 2938347, 2945542, 2947129 (seq1, seq2, seq3, seq4 respectively, purple is maternal base TAAA, red is paternal base CGGG).

[0033] 8, According to the genotype of the parents, the F2 population was divided into groups, and the results showed that the incidence of Fusarium wilt in F2 single plants with genotype TAAA (A) (83) was 16.81%, and the incidence of Fusarium wilt in F2 single plants with genotype CGGG (B) (36) was 39.65%, which was significantly higher than that of single plants with genotype TAAA (A), and the incidence of Fusarium wilt in F2 single plants with heterozygous type (H) (50) was 16.86% Figure 2). Thus, it is proved that TAAA can identify single plants resistant to Fusarium wilt, and CGGG can identify single plants susceptible to Fusarium wilt.

[0034] Example 2: Verification of SNP

[0035] 1. A hybrid combination was constructed using 201029-0-9-3-0-9-1 (resistant to Fusarium wilt) as the female parent and ZZM00254 (susceptible to Fusarium wilt) as the male parent. The hybridization was completed in Shijiazhuang, Hebei in the summer of 2022. The F1 was planted in Sanya, Hainan in the winter of the same year, selfed and F2 was harvested. In the summer of 2023, 127 single plants were planted in Shijiazhuang, Hebei, and managed in a conventional field. The incidence of Fusarium wilt in the parent and F2 population was investigated.

[0036] 2. The DNA of the parent and F2 single plants was extracted using the CTAB method, and the integrity of the DNA was detected by agarose gel electrophoresis. The DNA concentration was determined using NanoDrop 2000.

[0037] 3. The SNP of the population was developed using resequencing technology. The experimental process was performed according to the standard protocol provided by Illumina, including sample quality detection, library construction, library quality detection, and library sequencing.

[0038] 4. The data was filtered according to the data analysis method of LI et al., and the high-quality sequences were aligned to the sesame reference genome using BWA (0.7.17) software. The SNP markers were identified using GATK (4.0.11.0) software.

[0039] 5. The bases at positions 2933576, 2938347, 2945542, and 2947129 on chromosome 1 of the F2 single plants were detected, and the F2 population was genotyped. The results showed that the incidence of Fusarium wilt in F2 single plants with genotype TAAA (A) (61 plants) was 15.77%, and the incidence of Fusarium wilt in F2 single plants with genotype CGGG (B) (29 plants) was 38.36%, which was significantly higher than that of single plants with genotype TAAA (A) (37 plants), and the incidence of Fusarium wilt in heterozygous (H) single plants was 16.43% ( Figure 3 ). Thus, it is proved that TAAA has the effect of identifying sesame resistant to Fusarium wilt, and CGGG has the effect of identifying sesame susceptible to Fusarium wilt.

[0040] The above-described embodiments are only descriptions of the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. Application of a detection reagent of a SNP marker in identifying resistance of sesame to fusarium wilt, the SNP marker being as follows: Seq1: TGGATGGCAACAGTTTGGCCCAAGCCCATGACCCACTAGCCCACAACCCA [T / C] GACCCGACCCTACCCACCGATTTGTCTACTTATTCTCCACCTAACCCTAA, the position of the SNP marker 1 is at the 51st position of Seq1, and the SNP marker 1 is T / C; Seq2: AATTCTCTCTTTGAAGTTTCTCGAGTTCAAGAATCTTCAAAACCCC CCAAG[A / G]CAGAGATCGAGTCATTCGTTGAAGGTGTGCAATAAATTATAGA GTTTACT, the position of the SNP marker 2 is at the 51st position of Seq2, and the SNP marker 2 is A / G; Seq3: GATGATGCTAAGTCTCAGTCTGATTACATGTTAAACCTGAATGGTGAT AA[A / G]GTTGTTTAGAAGAGTTCCAAGAGCAGGATACTGATTCCACCACAGG GACT, the position of the SNP marker 3 is at the 51st position of Seq3, and the SNP marker 3 is A / G; and Seq4: TTCTAGAGATTTAATGATGTGATCATTTAAATAGGAGAACCCATTAA TGG[A / G]AAGTCAAGATTTAATGAATGAGATTAATTAAATTTGGATTAAGTT CAATT, the position of the SNP marker 4 is at the 51st position of Seq4, and the SNP marker 4 is A / G. The detection reagent of the SNP marker comprises a primer set for amplifying the SNP marker. A hybrid combination is constructed by taking 201029-0-9-3-0-9-1 as a female parent and ZZM00254 as a male parent, and F1 is obtained, and F2 is obtained by selfing, and full genome sequencing is performed on F2, and the sesame SNP marker is detected, and when the genotype is TAAA, the sample is resistant to fusarium wilt; The SNP marker is as follows: Seq1: TGGATGGCAACAGTTTGGCCCAAGCCCATGACCCACTAGCCCACAACCCA [T / C] GACCCGACCCTACCCACCGATTTGTCTACTTATTCTCCACCTAACCCTAA, the position of the SNP marker 1 is at the 51st position of Seq1, and the SNP marker 1 is T / C; 2. Use according to claim 1, characterized in that, ​ 3. A method for identifying whether sesame is resistant to fusarium wilt, characterized by, ​ ​ ​ Seq2: AATTCTCTCTTTGAAGTTTCTCGAGTTCAAGAATCTTCAAAACCCC CCAAG[A / G]CAGAGATCGAGTCATTCGTTGAAGGTGTGCAATAAATTATAGA GTTTACT, the position of SNP marker 2 is at the 51st position of Seq2, and the SNP marker 2 is A / G; Seq3: GATGATGCTAAGTCTCAGTCTGATTACATGTTAAACCTGAATGGT GATAA[A / G]GTTGTTTAGAAGAGTTCCAAGAGCAGGATACTGATTCCACCA CAGGGACT, the position of SNP marker 3 is at the 51st position of Seq3, and the SNP marker 3 is A / G; Seq4: TTCTAGAGATTTAATGATGTGATCATTTAAATAGGAGAACCCAT TAATGG[A / G]AAGTCAAGATTTAATGAATGAGATTAATTAAATTTGGATTA AGTTCAATT, the position of SNP marker 4 is at the 51st position of Seq4, and the SNP marker 4 is A / G.

4. A method for identifying whether sesame is susceptible to fusarium wilt, characterized by, A hybrid combination is constructed by taking 201029-0-9-3-0-9-1 as the female parent and ZZM00254 as the male parent, and F1 is obtained. F2 is obtained by selfing, whole genome sequencing of F2 is performed, and SNP markers of sesame are detected. When the genotype is CGGG, the sample is susceptible to fusarium wilt; The SNP markers are as follows: Seq1: TGGATGGCAACAGTTTGGCCCAAGCCCATGACCCACTAGCCCACAACCCA[T / C]GACCCGACCCTACCCACCGATTTGTCTACTTATTCTCCACCTAACCCTAA, the position of SNP marker 1 is at the 51st position of Seq1, and the SNP marker 1 is T / C; Seq2: AATTCTCTCTTTGAAGTTTCTCGAGTTCAAGAATCTTCAAAACCCC CCAAG[A / G]CAGAGATCGAGTCATTCGTTGAAGGTGTGCAATAAATTATAGA GTTTACT, the position of SNP marker 2 is at the 51st position of Seq2, and the SNP marker 2 is A / G; Seq3: GATGATGCTAAGTCTCAGTCTGATTACATGTTAAACCTGAATGGT GATAA[A / G]GTTGTTTAGAAGAGTTCCAAGAGCAGGATACTGATTCCACCA CAGGGACT, the position of SNP marker 3 is at the 51st position of Seq3, and the SNP marker 3 is A / G; Seq4: TTCTAGAGATTTAATGATGTGATCATTTAAATAGGAGAACCCAT TAATGG[A / G]AAGTCAAGATTTAATGAATGAGATTAATTAAATTTGGATTA AGTTCAATT, the position of SNP marker 4 is at the 51st position of Seq4, and the SNP marker 4 is A / G. Seq4: TTCTAGAGATTTAATGATGTGATCATTTAAATAGGAGAACCCAT TAATGG[A / G]AAGTCAAGATTTAATGAATGAGATTAATTAAATTTGGATTA AGTTCAATT, the position of SNP marker 4 is at the 51st position of Seq4, SNP marker 4 is A / G. Seq4: TTCTAGAGATTTAATGATGTGATCATTTAAATAGGAGAACCCAT TAATGG[A / G]AAGTCAAGATTTAATGAATGAGATTAATTAAATTTGGATTA AGTTCAATT, the position of SNP marker 4 is at the 51st position of Seq4, SNP marker 4 is A

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) site related to sesame seed coat color and application thereof

    CN118006830A

  • Cucumber fusarium wilt resistance gene foc-4 as well as molecular marker and application thereof

    WO2015143867A1