KASP primer pair for identifying salt tolerance of wheat seedling stage, and identification method and application thereof

By designing KASP primer pairs and KASP reactions, combined with genotyping detection equipment, the problems of long breeding cycles and complicated identification in traditional wheat breeding were solved, and rapid screening of salt-tolerant wheat varieties at the seedling stage was achieved, thereby improving breeding efficiency.

CN119351616BActive Publication Date: 2025-10-10CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411828466.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-10-10
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

The traditional wheat breeding model has a long breeding cycle and a complicated salt resistance identification process, making it difficult to quickly screen salt-tolerant wheat varieties, which affects breeding efficiency.

Method used

KASP primer pairs were used to identify salt tolerance of wheat at the seedling stage. Specific upstream and downstream primers were designed for KASP reaction, and fluorescence signal reading was performed using KASP genotyping detection equipment to screen out wheat varieties with strong salt tolerance at the seedling stage.

Benefits of technology

It has achieved rapid and accurate identification and screening of salt-tolerant wheat varieties at the seedling stage, significantly improved breeding efficiency and simplified the identification process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119351616B_ABST
    Figure CN119351616B_ABST
Patent Text Reader

Abstract

The application discloses a KASP primer pair for identifying salt tolerance of wheat seedlings, and an identification method and application thereof. The primer pair comprises upstream primer 1 and upstream primer 2 with nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2 respectively, and downstream primer with a nucleotide sequence shown in SEQ ID No. 3. The KASP primer pair is used to perform a KASP reaction with extracted wheat genomic DNA as a template, and a product is subjected to fluorescence signal reading. If the signal reading result is HEX allele, the wheat is of BB genotype; if the result is FAM allele, the wheat is of bb genotype, and the salt tolerance of the wheat of the bb genotype is stronger than that of the wheat of the BB genotype. The KASP primer group prepared by using the KASP primer pair is applied to detection of salt tolerance of wheat seedlings, can rapidly screen salt-tolerant wheat varieties, greatly improves breeding efficiency, the identification method provided by the application is simple, reliable and practical, has important application value in wheat breeding, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a KASP primer pair for identifying salt tolerance of wheat at the seedling stage, and an identification method and application thereof. Background Art

[0002] In recent years, global food security has faced enormous challenges, including the reduction of arable land, extreme climate change, and environmental pollution. Soil salinization has become a major factor restricting arable land productivity. The extent and area of ​​salinization are increasing, severely impacting the sustainable development of agriculture. According to statistics, the area of ​​land affected by salinization globally has reached 1 billion hectares, and is increasing at a rate of 10 million hectares annually. Soil salinization is closely linked to agricultural production. Studies have shown that salinity stress can cause yield reductions of major crops exceeding 50%. In my country, saline-alkali land is also a widespread and fragile ecological type, with approximately 36.933 million hectares of salinized soil in the country. Soil salinization has become a major constraint on high and stable grain yields in my country.

[0003] Wheat is one of my country's three major staple crops and a vital global food crop, providing the primary energy source for nearly 30% of the world's population. However, the growing area of ​​saline-alkali land and secondary salinized land has severely impacted wheat cultivation area and average yield. Given limited arable land, breeding salt-tolerant wheat varieties on saline-alkali land is crucial for ensuring national food security and fully developing and utilizing saline-alkali land resources through a strategy of "suiting crops to the land" and "cultivating and integrating crops and land." Traditional breeding methods, however, have long breeding cycles, and the identification of salt tolerance is complex and labor-intensive. Therefore, developing rapid, accurate, and high-throughput methods for identifying or assisting in the identification of wheat salt tolerance would enable rapid screening of salt-tolerant wheat varieties and improve breeding efficiency. Summary of the Invention

[0004] In order to overcome the defects and shortcomings of the prior art, one of the objectives of the present invention is to provide a KASP primer pair for identifying salt tolerance of wheat seedlings.

[0005] Another object of the present invention is to provide an identification method for identifying salt tolerance of wheat at the seedling stage.

[0006] Another object of the present invention is to provide a kit for identifying salt tolerance in the seedling stage and its application.

[0007] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0008] The present invention provides a KASP primer pair for identifying salt tolerance in the seedling stage, which comprises an upstream primer and a downstream primer: the upstream primer comprises an upstream primer 1 and an upstream primer 2:

[0009] The upstream primer 1 is a nucleotide sequence as shown in SEQ ID No. 1, or a DNA molecule having the same function as the nucleotide sequence shown in SEQ ID No. 1 after 1-3 nucleotides are substituted and / or deleted and / or added; the upstream primer 2 is a nucleotide sequence as shown in SEQ ID No. 2, or a DNA molecule having the same function as the nucleotide sequence shown in SEQ ID No. 2 after 1-3 nucleotides are substituted and / or deleted and / or added;

[0010] The downstream primer includes: a nucleotide sequence as shown in SEQ ID No. 3, or a DNA molecule having the same function as the nucleotide sequence shown in SEQ ID No. 3 after substitution and / or deletion and / or addition of 1-3 nucleotides.

[0011] Furthermore, the nucleotide sequence of the product amplified by the primer pair is shown as SEQ ID No. 4.

[0012] The present invention also provides a kit for screening strong salt-tolerant wheat varieties at the seedling stage, which comprises the primer pair.

[0013] Furthermore, the molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:5.

[0014] Furthermore, the molar ratio of the upstream primer 1 having a nucleotide sequence as shown in SEQ ID No. 1 to the upstream primer 2 having a nucleotide sequence as shown in SEQ ID No. 2 in the kit is 1:1.

[0015] The present invention also provides an identification method for identifying salt tolerance of wheat seedlings using the primer pair, comprising the following steps:

[0016] (1) Extracting genomic DNA of wheat to be tested, using it as a template, performing a KASP reaction using the primer pair, and reading the fluorescence signal of the reaction product using a KASP genotyping detection device;

[0017] (2) If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of BB genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of bb genotype.

[0018] Further, in the step (1), the Touchdown PCR reaction program in the KASP reaction is: 94℃ denaturation for 15 min; 94℃ denaturation for 20 s, 64℃-56℃ (drop 0.8℃ per cycle) annealing for 1 min, 10 cycles; 94℃ denaturation for 20 s, 58℃ annealing for 1 min, 32 cycles.

[0019] Further, in the step (1), the PCR reaction system is composed of: mixed primers of upstream primer 1: upstream primer 2: downstream primer = 2: 2: 5, 10 μM 0.25 μL; 2×PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; water 1.25 μL; DNA template 100 ng / μL 1 μL, and the total volume is 5 μL.

[0020] Further, the salt tolerance of the wheat to be detected of the bb genotype in the seedling stage is significantly higher than that of the wheat to be detected of the BB genotype.

[0021] The application further provides application of the primer pair, the kit or the identification method in breeding of wheat varieties with strong salt tolerance in the seedling stage.

[0022] Further, the wheat variety of the bb genotype is a wheat variety with salt tolerance in the seedling stage.

[0023] Compared with the prior art, the application has the advantages and beneficial technical effects that: by using the primer pair provided by the application, KASP analysis is performed on 213 wheat varieties, and the fluorescence reading result shows that the genotypes of 69 wheat varieties are BB, the genotypes of 144 wheat varieties are bb, the salt tolerance of the wheat of the bb genotype in the seedling stage is significantly higher than that of the wheat of the BB genotype, it is proved that the primer provided by the application can identify or assist in identifying different wheat varieties with salt tolerance in the seedling stage, and can quickly screen wheat varieties with high salt tolerance in the seedling stage, greatly improving the breeding efficiency; and the identification method provided by the application is simple, reliable and practical, has important application value in wheat breeding, and has wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 KASP fluorescence detection results of wheat varieties Jing411 (HEX allele, genotype BB) and Lumaiz23 (FAM allele, genotype bb) which have completed PCR product sequencing verification.

[0025] Figure 2 KASP fluorescence detection results of 213 wheat varieties, wherein the HEX allele genotype is BB, and the FAM allele genotype is bb.

[0026] Figure 3 Statistical results of relative salt tolerance index of leaf length of wheat at seedling stage of different genotypes. DETAILED DESCRIPTION

[0027] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention.

[0028] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0030] The 213 wheat varieties used in this study represent a natural population composed of wheat varieties collected from different provinces or wheat-growing regions in my country, as well as imported varieties that have significantly influenced the genetic background of Chinese wheat. These varieties represent the current genetic diversity of my country's wheat germplasm resources. The origins of the 213 wheat varieties are shown in Table 1.

[0031] 2× PAMRS Pro SNP Gentyping PCR Mix was a product of Wuhan Jingpeptide Biotechnology Co., Ltd.

[0032] Example 1: Determination of leaf length of wheat varieties under salt treatment and control conditions at the seedling stage and calculation of leaf length relative salt tolerance index

[0033] 1. Obtaining leaf length of wheat varieties under salt treatment and control conditions

[0034] For each wheat variety tested, 18-20 healthy, undamaged, plump seeds were selected. After soaking for 24 hours, the seeds were placed in a culture medium lined with moistened filter paper. The culture medium was then placed in a refrigerator at 4°C for 48 hours to break dormancy. Sixteen seeds with consistent bud lengths were then divided into groups of eight. Each group was treated with a 150 mmol / L NaCl solution to simulate salt stress. A control group was also established. One week after treatment, the longest leaf length of each wheat plant in both the experimental and control groups was measured.

[0035] 2. Calculation of leaf length salt tolerance index and leaf length relative salt tolerance index

[0036] In order to minimize the random errors generated during the experiment, Jimai 60 was used as the control variety when conducting salt stress and control treatments for different batches. It was used to homogenize the leaf length salt tolerance index of the tested varieties, facilitating the comparison and analysis of data between different batches of treatments.

[0037] Leaf length salt tolerance index = longest leaf length in salt stress treatment / longest leaf length in control group;

[0038] Relative salt tolerance index of leaf length = leaf length salt tolerance index of the tested variety / leaf length salt tolerance index of Jimai 60;

[0039] The calculation results of leaf length relative to salt tolerance index of different wheat varieties are shown in Table 1.

[0040] Table 1 Leaf length relative salt tolerance index of different wheat varieties and their corresponding genotypes

[0041] ,

[0042] ,

[0043] ,

[0044] ,

[0045] ,

[0046] .

[0047] Example 2: Correlation analysis between KASP fluorescence detection results and salt tolerance of wheat seedlings

[0048] 1. Preparation of primer pairs

[0049] Primers were designed for detecting salt tolerance in wheat, and the primer pairs were synthesized by Sangon Biotech (Shanghai) Co., Ltd.:

[0050] Upstream primer 1:

[0051] 5′-GAAGGTGACCAAGTTCATGCTTCGGGAGATAAGGATACAGGTGT-3′ (SEQ ID No. 1, wherein GAAGGTGACCAAGTTCATGCT is a universal tag sequence);

[0052] Upstream primer 2:

[0053] 5′-GAAGGTCGGAGTCAACGGATTTCGGGAGATAAGGATACAGGTGG-3′ (SEQ ID No. 2, wherein GAAGGTCGGAGTCAACGGATT is a universal tag sequence);

[0054] The 3' ends of the upstream primer 1 and the upstream primer 2 are alleles of the same SNP.

[0055] Downstream primer: 5'-CATGTGGTCCTTCAGACTAGTGAA-3' (SEQ ID No. 3, the reverse complementary sequence of positions 43-66 of SEQ ID No. 4).

[0056] The primer pairs were purified by PAGE.

[0057] When used, the molar ratio of upstream primer 1, upstream primer 2 and downstream primer is 2:2:5. The nucleotide sequence of the product amplified using the above primer pair is shown in SEQ ID No.4.

[0058] 2. Genotyping Methods

[0059] 1. Extraction of genomic DNA

[0060] Extracting genomic DNA from wheat leaves to be tested. In this embodiment, the wheat to be tested is the 213 wheat varieties listed in Table 1.

[0061] 2. Prepare PCR reaction system

[0062] Table 2 PCR reaction system

[0063]

[0064] The PCR reaction system (5 μL) is shown in Table 2.

[0065] 3. KASP and fluorescence detection and analysis

[0066] (1) Take the PCR reaction system in step 2 and place it on a 9600 PCR Thermo Cycler instrument to perform PCR amplification reaction. The PCR program is as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

[0067] (2) After completing step (1), use the KASP genotyping detection device to read the fluorescence signal.

[0068] Some experimental results can be found in Figure 1 (HEX allele was Jing 411, FAM allele was Lumai 23, and each sample was replicated three times). The results showed that the fluorescence detection results of the two haplotype wheat varieties after KASP were divided into FAM allele and HEX allele.

[0069] Based on the fluorescence detection results of KASP, the following conclusions were drawn: KASP was performed using genomic DNA of wheat varieties Jing 411 and Lumai 23 with known target sequences as templates using the above-mentioned primer pairs and 2× PAMRS Pro SNP Gentyping PCR Mix. The fluorescence signal was read by the KASP genotyping detection equipment, and then the following judgment was made: if the fluorescence detection result showed a HEX allele, the genotype of the wheat was BB; if the fluorescence detection result showed a FAM allele, the genotype of the wheat was bb.

[0070] The genotypes of 213 wheat varieties were determined using the above method. The genotyping results are shown in Table 1 (HEX allele represents wheat with a BB genotype, and FAM allele represents wheat with a bb genotype). The results showed that 69 wheat varieties had a BB genotype, and 144 wheat varieties had a bb genotype.

[0071] 3. Correlation analysis between genotype and salt tolerance of wheat

[0072] The relative salt tolerance index of the leaf length of two types of wheat at the seedling stage, genotype BB and genotype bb, was statistically analyzed. The results are shown in Figure 3 The results showed that the salt tolerance of wheat varieties with bb genotype at the seedling stage was significantly higher than that of wheat varieties with BB genotype (P<0.001).

[0073] Example 3: Application of the primers in breeding salt-tolerant wheat varieties

[0074] The application of the present invention in breeding salt-tolerant wheat varieties comprises the following steps:

[0075] 1. Extract the genomic DNA of the wheat to be tested, use it as a template, use the primer pair to perform KASP reaction, and read the fluorescence signal of the reaction product.

[0076] The primer pair includes an upstream primer and a downstream primer; the upstream primer includes upstream primer 1 and upstream primer 2: the upstream primer 1 is the nucleotide sequence shown in SEQ ID No.1, the upstream primer 2 is the nucleotide sequence shown in SEQ ID No.2, and the downstream primer is the nucleotide sequence shown in SEQ ID No.3.

[0077] The touchdown PCR reaction program in the KASP reaction was as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C (drop 0.8°C per cycle) for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

[0078] The PCR reaction system was as follows: 0.25 μL of a 10 μM primer mixture consisting of upstream primer 1: upstream primer 2: downstream primer = 2:2:5; 2× PAMRS Pro SNP Gentyping PCR Mix 2.5 μL; water 1.25 μL; and 1 μL of a 100 ng / μL DNA template in a total volume of 5 μL.

[0079] 2. If the fluorescence signal reading result of the wheat to be tested shows the HEX allele, the wheat to be tested has the BB genotype; if the fluorescence signal reading result of the wheat to be tested shows the FAM allele, the wheat to be tested has the bb genotype. The relative salt tolerance index of leaf length of the wheat to be tested with the bb genotype is significantly higher than that of the wheat to be tested with the BB genotype. The wheat variety with the bb genotype is selected as the wheat variety with salt tolerance at the seedling stage.

[0080] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A method for identifying salt tolerance of wheat seedlings using KASP primer pairs, characterized in that: The following steps are involved: (1) Extracting genomic DNA of wheat to be tested, using it as a template, performing a KASP reaction using the KASP primer pair, and reading the fluorescence signal of the reaction product; The KASP primer pair includes an upstream primer and a downstream primer: the upstream primer includes upstream primer 1 and upstream primer 2: the upstream primer 1 has a nucleotide sequence as shown in SEQ ID No. 1, the upstream primer 2 has a nucleotide sequence as shown in SEQ ID No. 2, and the downstream primer has a nucleotide sequence as shown in SEQ ID No. 3; (2) If the fluorescence signal reading result of the wheat to be tested shows HEX allele, the wheat to be tested is of BB genotype; if the fluorescence signal reading result of the wheat to be tested shows FAM allele, the wheat to be tested is of bb genotype, Jing 411 is of the BB genotype, and Lumai 23 is of the bb genotype. The salt tolerance of the wheat to be tested with the bb genotype is significantly higher than that of the wheat to be tested with the BB genotype.

2. The identification method according to claim 1, wherein The nucleotide sequence of the product amplified by the primer pair is shown in SEQ ID No.

4.

3. The identification method according to claim 1, wherein The molar ratio of the upstream primer 1, the upstream primer 2 and the downstream primer is 2:2:

5.

4. The identification method according to claim 1, wherein The PCR reaction program in the KASP reaction in step (1) is as follows: denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 64°C-56°C for 1 min, 10 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 1 min, 32 cycles.

5. The identification method according to claim 1, wherein The PCR reaction system in step (1) is as follows: 0.25 μL of a 10 μM primer mixture consisting of upstream primer 1: upstream primer 2: downstream primer = 2:2:5; 2.5 μL of 2× PAMRSPro SNP Gentyping PCR Mix; 1.25 μL of water; and 1 μL of a 100 ng / μL DNA template, with a total volume of 5 μL.

6. Use of the identification method according to claim 1 in breeding salt-tolerant wheat varieties.

7. The use according to claim 6, characterized in that The wheat varieties with bb genotype were selected as salt-tolerant wheat varieties.

Citation Information

Patent Citations

  • Molecular marker of wheat and application of molecular marker of wheat in identification on salt tolerance of wheat

    CN111690767A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to salt tolerance of wheat and application

    CN118834991A