Chrysanthemum CVB virus field rapid detection method based on ERA technology

Abstract

The invention belongs to the field of molecular biology, and particularly relates to a probe, a primer, a kit and a detection method for rapid detection of chrysanthemum CVB virus. The primer group is selected from any one of a primer group 1, a primer group 2 and a primer group 3; the probe is provided with at least one fluorophore; the kit comprises the probe and the primer group, and further comprises freeze-dried microspheres and an activating agent, according to the method, whether a chrysanthemum sample contains the CVB virus or not is detected through an enzymatic recombinant isothermal amplification (ERA) technology. According to the invention, the experimental material can be detected at normal temperature without depending on laboratory conditions; the fluorescent probe and the primer have strong specificity and high sensitivity; the method is relatively low in cost and simple to operate, and results can be displayed in an extremely short time.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and particularly relates to a kit and a detection method for rapid detection of chrysanthemum CVB virus. Background Art

[0002] Chrysanthemum (Chrysanthemum morifolium) is a traditional flower in my country. It is not only ornamental but also edible and medicinal. Viral diseases that cause important diseases in the growth process of chrysanthemums can cause chrysanthemums to have a variety of symptoms such as mosaic, yellow leaves, chlorotic spots, dead spots, necrotic spots, as well as plant dwarfing, deformity, infertility, etc., which seriously affect the normal growth of chrysanthemums and cause a decrease in yield and quality.

[0003] Chrysanthemum virus B CVB was discovered in 1952. It is a single-stranded positive-sense RNA virus with a straight rod shape and a size of about 685nm×12nm. The end point of virus dilution is 10 -2 ~10 -4 , the passivation temperature is 70℃~80℃, and it can survive in vitro for 6 days at room temperature. The virus concentration in plants is low in summer. In addition to infecting chrysanthemums, CVB can also infect a variety of plants including petunias, tobacco, apricots, wild chrysanthemums, calendulas, and immortelle, and is considered to be the most serious pathogen in chrysanthemums. The virus is mainly transmitted by aphids in a non-continuous manner, and can also infect plants through sap and cuttings, but it is not transmitted through seeds and soil.

[0004] CVB is one of the dominant viruses that infect chrysanthemums and is widely distributed in chrysanthemum-growing areas around the world. Plants infected with CVB will show symptoms such as mosaic, yellow spots, and interveinal chlorosis. Some varieties will show dwarfing, leaf deformity, abnormal accumulation of anthocyanins, and necrosis. The phenotypes of different varieties vary greatly. Generally speaking, the longer the infection lasts, the more obvious the symptoms are; but in autumn, there will also be a retreat phenomenon, and the mosaic symptoms are not obvious. .

[0005] Currently known methods for detecting chrysanthemum CVB virus include:

[0006] 1. The virus's reverse transcriptase recombinase polymerase isothermal amplification (RPA) detection method is limited to laboratory operations and is not convenient to carry out in the field. 2. Multiplex RT-PCR detection method. This method must rely on experimental detection equipment and test materials, such as centrifuges, PCR instruments, electrophoresis instruments, ultra-micro spectrophotometers, microplate readers, computers, ice, dry ice, ice boxes, etc.; this method has high detection costs and strict experimental conditions, and can only be carried out in professional laboratories. 3. CVB virus double antigen one-step sandwich enzyme-linked immunosorbent assay (ELISA). This method has disadvantages and shortcomings such as being limited to the laboratory, expensive experimental costs, and long detection time. Summary of the invention

[0007] In order to solve the above problems existing in the prior art, the inventor team of the present invention investigated the types and distribution of chrysanthemum virus diseases in multiple areas of Beijing, and after a large number of innovative experiments, established a system and method for rapid field detection of CVB virus using a handheld fluorescent probe gene mirror.

[0008] The present invention provides a chrysanthemum CVB virus rapid detection probe and primer set, wherein the nucleotide sequence of the probe is shown in sequence 7 of a sequence table; the primer set is selected from any one, two or three groups of primer set 1, primer 2 and primer set 3; the upstream primer of the primer set 1 is shown in sequence 1 of the sequence table, and the downstream primer is shown in sequence 2 of the sequence table; the upstream primer of the primer set 2 is shown in sequence 3 of the sequence table, and the downstream primer is shown in sequence 4 of the sequence table; the upstream primer of the primer set 1 is shown in sequence 5 of the sequence table, and the downstream primer is shown in sequence 6 of the sequence table.

[0009] The invention provides a chrysanthemum CVB virus rapid detection kit, which contains the above-mentioned probe and primer set.

[0010] The invention provides a method for rapid detection of chrysanthemum CVB virus, which adopts the above-mentioned probe, primer, and kit.

[0011] The present invention provides a probe, a primer set, a kit and a detection method for rapid detection of chrysanthemum CVB virus and their application in rapid detection of chrysanthemum CVB virus.

[0012] The present invention adopts enzymatic recombination constant temperature amplification technology, which can perform detection under normal temperature conditions and is independent of laboratory conditions; the fluorescent probes and primers used have strong specificity and high sensitivity; the kit and detection method of the present invention can obtain the same detection results as traditional RT-PCR and ELISA methods, and the accuracy is extremely high.

[0013] The present invention conducts experimental analysis on field chrysanthemums in the open air, and can obtain the test results of whether the chrysanthemum plants carry CVB virus within 0.5min-19min. All detection operations only require a portable virus detection kit, and do not require operation in a professional laboratory, so that the CVB virus can be quickly detected anytime and anywhere in the field. The method provided by the present invention has low detection cost and simple operation, can perform detection without environmental conditions in a very short time at room temperature, and has accurate test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a photo of the experimental material of Example 1.

[0015] Figure 2This is the electrophoresis diagram of the specific detection amplification band of Test Example 1.

[0016] Figure 3 This is the electrophoresis diagram of the sensitivity detection amplification band of Test Example 1.

[0017] Figure 4 This is the electrophoresis diagram of the bands amplified by RT-PCR in Test Example 2. DETAILED DESCRIPTION

[0018] To make the technical solution, purpose and advantages of the present invention clearer, the present invention is further described in detail below through specific implementation examples. It should be understood that the specific implementation methods described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0019] In a first aspect, the present invention provides a probe and primer for rapid detection of chrysanthemum CVB virus.

[0020] The nucleotide sequence of the probe is as follows:

[0021] 5'-CTTACCCCCTCCTCGCTTCTCCACTCCTGGTCTCCATTCTCTCCC TA-3' (sequence 7);

[0022] The probe carries at least one fluorescent group; preferably, the fluorescent group can be at least one of FAM, THF, BHQ1 and C3-SPACER. Specifically, the 31st T at the 5' end of the probe is connected to the fluorescent group FAM, the 32nd C is connected to the fluorescent group THF, the 33rd T is connected to the fluorescent group BHQ1, and the A at the 3' end is connected to the fluorescent group C3-SPACER.

[0023] The nucleotide sequence of the primers is composed of any one or more of the following:

[0024] Primer Set 1:

[0025] F: 5'-CTGAGGGTGAGTCTGGAGGTTCTCTGTGGA-3' (sequence 1);

[0026] R: 5′-GTTCTGCCCACTAGGTATCTCATCATCCA-3′ (sequence 2);

[0027] Primer set 2:

[0028] F: 5′-TGAAACACAAGCGTAGGTACACTGATGAG-3′ (SEQ ID NO: 3);

[0029] R: 5′-CCAGCCTGAGTTCTGCCCACTAGGTATCT-3′ (SEQ ID NO: 4);

[0030] Primer set 3:

[0031] F: 5'-CACTGTTGACAATGCCCCTCATCTCGCCCA-3' (sequence 5);

[0032] R: 5'-TGCAAGCCCAGCCTGAGTTCTGCCCACTA-3' (sequence 6).

[0033] The target band amplified by the above primer set 1 is 178 bp in size, and its nucleotide sequence is shown in sequence 8 in the sequence list; the target band amplified by the above primer set 2 is 356 bp in size, and its nucleotide sequence is shown in sequence 9 in the sequence list; the target band amplified by the above primer set 3 is 400 bp in size, and its nucleotide sequence is shown in sequence 10 in the sequence list.

[0034] Sequence 8:

[0035] 5'-CTGAGGGTGAGTCTGGAGGTTCTCTGTGGACTCTTAAGAAAGC CAGAAGCAACTGCCAGGCCTGAGGAAGCCCCTGGGAGGGAGCTTTTC TCCAACCTCCTTACCCCCTCCTCGCTTCCCACTCCTGGTCTCCATTCTCTCCCTATACTGGATGATGAGATACCTAGTGGGCAGAAC-3';

[0036] Sequence 9:

[0037] 5'-TGAAACACAAGCGTAGGTACACTGATGAGTGCTCCCATAGCATC TTATGCCTTCCACCGGCAGCCTGGTCTAAGGCCTTGGCAGGAGAGCCTGGGAGTAACAGAGTGGCTGGTCTCTAGGGAGCTTTGAGTGCTCTGCCCCTTTGGGCCCTCTCCACAGCCAGTCAACCCTGAGGGTGAGTCTGGAGGTTCTCTGTGGACTC TTAAGAAAGCCAGAAGCAACTGCCAGGCCTGAGGAAGCCCCTGGGAGGGAGCTTTTCCAACCTCCTTACCCCCTCCTCGCTTCTCCACTCCTGGTCTCCATTCTCTCCCTATACTGGATGATGAGATACCTAGTGGGCAGAACTCAGGCTGG-3';

[0038] Sequence 10:

[0039] 5'-CACTGTTGACAATGCCCCTCATCTCGCCCAGATCTTCTGAAACA CAAGCGTAGGTACACTGATGAGTGCTCCCATAGCATCTTATGCCTTCCACCGGCAGCCTGGTCTAAGGCCTTGGCAGGAGAGCCTGGGAGTAACAGAGTGGCTGGTCTCTAGGGAGCTTTGAGTGCTCTGCCCCTTTGGGCCCTCCCACAGCCAGTCAACCCTGAGGGTGAGTCTGGAG GTTCTCTGTGGACTCTTAAGAAAGCCAGAAGCAACTGCCAGGCCTGAGGAAGCCCCTGGGAGGGAGCTTTCTCCAACCTCCTTACCCCCTCCTCGCTTCTCCACTCCTGGTCTCCATTCTCTCCCTATACTGGATGATGAGATACCTAGTGGGCAGAACTCAGGCTGGGCTTGCA-3'.

[0040] In a second aspect, the present invention provides a kit for rapid detection of chrysanthemum CVB virus, the kit comprising the probe and primers described in the first aspect of the present invention.

[0041] The kit also includes freeze-dried microspheres and an activator.

[0042] The freeze-dried microspheres include: a buffer, an excipient, a reaction enzyme agent, and other agents;

[0043] The buffer comprises at least one of the following: tris(hydroxymethyl)aminomethane, sodium ions, potassium ions, chloride ions, acetate ions, and sulfate ions;

[0044] The excipient comprises at least one of the following: trehalose, raffinose, dextran, dextrin, polyethylene glycol, mannitol, glycerol, alanine, lysine, sodium glutamate, bovine serum albumin, casein, Triton X-100, Tween-80, ethylphenyl polyethylene glycol-40, dimethyl sulfoxide (DMSO), N,N-dimethylformamide (DMF);

[0045] The reaction enzyme agent includes at least one of the following: Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease exonuclease, reverse transcriptase, creatine kinase, 10U of RNAse inhibitor;

[0046] The other agents include: dNTP, and at least one of the following: dithiothreitol, creatine phosphate, imidazole, and adenosine triphosphate.

[0047] The activator is selected from one or more of the following: magnesium ion salt, nickel ion salt, manganese ion salt; preferably magnesium acetate.

[0048] The preparation method of the freeze-dried microspheres comprises the following steps:

[0049] Step 1: Prepare the above-mentioned buffer, excipient, reaction enzyme agent and other agents into a microsphere stock solution;

[0050] As a preferred microsphere stock solution, the final concentration of each raw material is as follows:

[0051] Triscarboxymethyl alkane-acetic acid (pH 8.0) 10-50mM, preferably 30mM; potassium acetate 50-150mM, preferably 100mM; polyethylene glycol (molecular weight 20000) 1-10%, preferably 5%; ATP 1-3mM, preferably 2mM; creatine phosphate 10-30mM, preferably 20mM; imidazole 10-30, preferably 20mM; dNTP 0.1-1.0mM, preferably 0.45mM; trehalose 5-8%, preferably 6.5%; raffinose 1-3%, preferably 2%; glycerol 1-3%, preferably 2%;

[0052] Escherichia coli SSB protein 50-150ng / μL, preferably 100ng / μL; bacteriophage uvsX protein 100-200ng / μL, preferably 150ng / μL; bacteriophage uvsY protein 10-40ng / μL, preferably 25ng / μL; klenow polymerase large fragment (exo-) 50-130ng / μL, preferably 80ng / μL; nuclease III 10-100ng / μL, preferably 50ng / μL; reverse transcriptase 100-300U, preferably 200U; creatine kinase 50-150ng / μL, preferably 100ng / μL; RNase inhibitor 5-15U, preferably 10U.

[0053] The freeze-dried microspheres may also be commercially available products.

[0054] Step 2: dropping the microsphere stock solution into liquid nitrogen to obtain solidified microspheres;

[0055] Step 3: freeze-dry the solidified microspheres to obtain freeze-dried microspheres. The freeze-drying process is as follows: -45°C, 0 Pa, 1 hour; -40°C, 1 Pa, 6 hours; -30°C, 1 Pa, 20 minutes; -20°C, 1 Pa, 20 minutes; -10°C, 1 Pa, 20 minutes; 0°C, 1 Pa, 1.5 hours; 10°C, 1 Pa, 30 minutes; 20°C, 1 Pa, 30 minutes; 25°C, 1 Pa, 1 hour.

[0056] The third aspect of the present invention provides a method for rapid detection of chrysanthemum CVB virus, the detection method comprising operation using the probe and primer provided by the first aspect of the present invention, or the kit provided by the second aspect of the present invention.

[0057] Specifically, the rapid detection method for chrysanthemum CVB virus provided in the third aspect of the present invention comprises the following steps:

[0058] 1. Prepare a reaction premix solution, wherein the final concentration of each component in the premix solution is as follows:

[0059] Forward primer (F): 0.25-0.65 μM, preferably 0.44 μM;

[0060] Reverse primer (R): 0.25-0.65 μM, preferably 0.44 μM;

[0061] Fluorescent probe: 0.1-0.15 μM, preferably 0.125 μM;

[0062] Template RNA: 15-550 μg / mL, preferably 20.83-416.67 μg / mL;

[0063] ddH2O: balance.

[0064] 2. Mix the premix with the freeze-dried microspheres and then with the activator to obtain a reaction mixture, wherein the volume of the freeze-dried microspheres is the same as that of the template RNA; and the final concentration of the activator in the reaction mixture is 10-20 mM, preferably 14 mM.

[0065] 3. The reaction mixture is subjected to constant temperature amplification at a temperature of 40-45°C, preferably 45°C, for 10-30 minutes, preferably 20 minutes; and then the chrysanthemum CVB virus is determined based on the fluorescent signal generated by the amplification reaction. For example, if a fluorescent signal can be generated at the excitation wavelength of the fluorescent group used, it can be determined that the chrysanthemum CVB virus is contained. Specifically, for example, when the FAM fluorescent group is used, if a fluorescent signal is collected at an excitation wavelength of 520nm, it is determined that the chrysanthemum CVB virus is contained; if no fluorescent signal is collected, it is determined that the chrysanthemum CVB virus is not contained.

[0066] 4. After the above isothermal amplification reaction is completed, save the data.

[0067] The various reagents, materials, etc. used in the following examples, unless otherwise specified, are all products that can be obtained from commercial channels; the various tests and detection methods used in the following examples, unless otherwise specified, are all conventional tests and detection methods in the art and can be obtained from textbooks, reference books or academic journals.

[0068] The experimental materials of the following examples are: In June 2024, unknown chrysanthemums suspected of containing chrysanthemum virus disease were collected from three places in Beijing and planted outdoors. Ten samples were collected from each plot (such as Figure 1 Each sample was simultaneously subjected to the handheld fluorescent probe gene microscope open field detection of Example 1, the CVB virus single RT-PCR detection of Test Example 2, and the ELISA detection of Test Example 3.

[0069] Example 1

[0070] This example is used to illustrate the preparation and method for rapid detection of chrysanthemum CVB virus provided by the present invention.

[0071] Main instruments:

[0072] Constant temperature nucleic acid amplification instrument, purchased from Suzhou Xianda Gene Technology Co., Ltd. Handheld solar mobile power supply, 20000mAh, purchased from Shantou Junai Charge Electronics Co., Ltd.

[0073] 1. Design and synthesis of fluorescent probe primers and probes for detecting chrysanthemum CVB virus

[0074] (I) Design and synthesis of fluorescent probe primers

[0075] The gene sequence of chrysanthemum CVB virus was downloaded from the NCBI database (NCBI gene accession number XM_036161358.1), and the fluorescent probe specific primer (i.e., fluorescent probe primer) was designed using the Primer5 online tool. The fluorescent probe specific primer was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequence, product size, and annealing temperature of CVB virus are shown in Table 1.

[0076] 1. Primer design: In the nucleotide region of Chrysanthemum CVB virus (between two primers and avoid overlapping regions with primers), search for base sequences with a maximum permissible single nucleotide repeat length (e.g. "CCCC") of 4. The "PCR Product Size" is generally identified as 100-300, and all primer sequences are selected from high to low according to the synthesis rate;

[0077] 2. Primer selection: From the designed primer table, "Dimer" and "CrossDimer" appear in the corresponding left table, indicating that this primer is not ideal. The best situation is that "Hairpin", "Dimer", "False Priming" and "Cross Dimer" do not appear, that is, the maximum allowable single nucleotide repeat length (such as "CCCC") is 4 base sequences selected at a synthesis rate of 100, avoiding the repetitive sequences in a specific genome to ensure the uniqueness of the target; that is, it is synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0078] Table 1: Fluorescent probe specific primers required for the detection of chrysanthemum CVB virus and viroids

[0079]

[0080] (II) Design and synthesis of probes

[0081] Based on the ideal upstream and downstream primers of the chrysanthemum CVB virus fluorescent probe screened above, the fluorescent probe was designed using the CRISPOR online tool and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0082] The probe sequences are:

[0083] 5'-CTTACCCCCTCCTCGCTTCTCCACTCCTGGTCTCCATTCTCTCCC TA-3' (sequence 7); the 31st T at the 5' end of the probe is connected to the fluorescent group FAM, the 32nd C is connected to the fluorescent group THF, the 33rd T is connected to the fluorescent group BHQ1, and the A at the 3' end is connected to the fluorescent group C3-SPACER; wherein FAM is a fluorescent emission group, BHQ is a fluorescent quenching group, and the other two groups are markers.

[0084] 2. Use the following handheld fluorescent probe gene microscope open field detection method for chrysanthemum CVB virus for detection:

[0085] (I) Preparation of template RNA:

[0086] 1. Collection of experimental materials: In June 2024, leaves of unknown chrysanthemums suspected of containing chrysanthemum virus disease were collected from three places (i.e., three groups) in Beijing, and 10 samples were collected in each field.

[0087] 2. Template RNA preparation:

[0088] (1) Sample pretreatment: At room temperature, take 50-100 mg of fresh chrysanthemum leaves suspected of carrying CVB virus and squeeze them with the thumb and index finger of disposable plastic gloves until the tissue fluid overflows. Alternatively, squeeze 2-3 drops of leaf juice from an appropriate amount of fresh chrysanthemum leaves suspected of carrying CVB virus into a 1.5 ml or 2 ml centrifuge tube for later use.

[0089] (2) Sample lysis: At room temperature, add 500-1000 μL of lysis reagent to the sample centrifuge tube to lyse RNA, pipette repeatedly and let stand for 3-5 minutes to obtain template RNA (concentration of 500-2000 μg / mL). Note: The sample volume should not exceed 10% of the volume of the lysis solution added.

[0090] The above lysis solution includes: Tris-hydrochloric acid 50 mM, sodium chloride 20 mM, Tween-100 2%.

[0091] (II) Preparation of premix:

[0092] Add the following reagents respectively into the probe-type centrifuge tube to form a premix for each sample to be tested.

[0093] Prepare a master mix for each sample in a total volume of 48 μL as follows:

[0094] Forward primer (10 μM): 2.1 μL,

[0095] Reverse primer (10 μM): 2.1 μL,

[0096] Fluorescent probe (10 μM): 0.6 μL,

[0097] Template RNA: 2μL≤x≤10μL (e.g. x=5μL),

[0098] ddH2O: 43.2-x μL.

[0099] Vortex the prepared premix thoroughly and centrifuge briefly.

[0100] 2. Add microspheres: For each sample, transfer the above 48 μL premix to a centrifuge tube dedicated to the constant temperature amplification instrument and add lyophilized microspheres with the same volume as the template RNA, which is 2 to 10 μL (e.g. 5 μL); then use the thumb and the thumb or middle finger to repeatedly tap the bottom of the centrifuge tube for 3 to 5 seconds to mix.

[0101] The preparation method of the freeze-dried microspheres comprises:

[0102] 1) Prepare microsphere stock solution. The final concentration of each raw material in the microsphere stock solution is as follows:

[0103] Tris(carboxymethyl)-acetic acid (pH 8.0) 30 mM, potassium acetate 100 mM, polyethylene glycol (molecular weight 20,000) 5%, ATP 2 mM, creatine phosphate 20 mM, imidazole 20 mM, dNTP 0.45 mM, trehalose 6.5%, raffinose 2%, glycerol 2%;

[0104] Escherichia coli SSB protein 100 ng / μL, bacteriophage uvsX protein 150 ng / μL, bacteriophage uvsY protein 25 ng / μL, klenow polymerase large fragment (exo-) 80 ng / μL, exonuclease III 50 ng / μL, reverse transcriptase 200 U, creatine kinase 100 ng / μL, RNase inhibitor 10 U;

[0105] All the above raw materials are prepared into microsphere stock solution with ddH2O.

[0106] 2) Take the mixed solution according to the amount of a single reaction system, drop it into a thermos cup filled with liquid nitrogen in a volume of 50 μL (or the amount required for a single isothermal amplification reaction), and the droplets will quickly solidify into small balls in the liquid nitrogen;

[0107] 3) Collect the solidified beads and place them in a pre-cooled freeze dryer (Xinzhi PI8070) model: for freeze drying. The freeze drying reaction conditions and procedures are as follows. After the freeze drying reaction is completed, package them under nitrogen environment to obtain freeze-dried microspheres.

[0108] -45℃, 0Pa, 1 hour; -40℃, 1Pa, 6 hours; -30℃, 1Pa, 20 minutes; -20℃, 1Pa, 20 minutes; -10℃, 1Pa, 20 minutes; 0℃, 1Pa, 1.5 hours; 10℃, 1Pa, 30 minutes; 20℃, 1Pa, 30 minutes; 25℃, 1Pa, 1 hour.

[0109] 3. Add activator: For each sample, add 2 μL of activator magnesium acetate to the reaction tube cover (the final concentration of the activator in the reaction system of each centrifuge tube is 14 mM), carefully close the tube cover, and use your thumb and thumb or middle finger to repeatedly tap the bottom of the centrifuge tube for 3 to 5 seconds to mix.

[0110] 4. Constant temperature detection: Place the reaction tube in a constant temperature instrument (40-45°C), preferably 45°C, and start the detection; continue for 20 minutes, and collect the fluorescence value of the FAM channel every 30 seconds. Using a handheld fluorescent probe mirror, at an excitation wavelength of 520nm, a fluorescent signal is collected. If the instrument displays "+" for positive, it is judged to contain chrysanthemum CVB virus; if no fluorescent signal is collected, the instrument displays "-" for negative, and it is judged that it does not contain chrysanthemum CVB virus.

[0111] 5. After the reaction is completed, save the data and discard the sample tube.

[0112] (III) Test results

[0113] The above three groups of samples of the same species and the same place were tested for chrysanthemum CVB virus by fluorescent probe microsphere constant temperature amplification instrument, and the results are as follows. The results show that when each group of chrysanthemum samples was tested using primer set 1, primer set 2, and primer set 3, the test results of each chrysanthemum sample in each group of 10 chrysanthemum samples using each of the three primers were consistent (for example: the result of one chrysanthemum sample in the first group of chrysanthemum samples using primer set 1 was positive (+), and the results of using primer sets 2 and 3 were also positive (+)), achieving the expected test purpose.

[0114] Table 2: Test results

[0115] Sample name "-” "+” A1 √ A2 √ A3 √ A4 √ A5 √ A6 √ A7 √ A8 √ A9 √ A10 √ B1 √ B2 √ B3 √ B4 √ B5 √ B6 √ B7 √ B8 √ B9 √ B10 √ C1 √ C2 √ C3 √ C4 √ C5 √ C6 √ C7 √ C8 √ C9 √ C10 √

[0116] Test Example 1

[0117] This test example is a specificity test and a sensitivity test of the chrysanthemum CVB virus rapid detection method of Example 1.

[0118] 1. Specificity Detection

[0119] S1. Obtaining cDNA: Obtain chrysanthemum leaf cDNA according to the method of Test Example 2 below.

[0120] S2. Preparation of primers: Centrifuge the newly synthesized centrifuge tube containing the above three primer powders at 4000rpm for 30-60s; slowly open the lid, and according to the primer instructions, add 52.1μL of sterile water to each tube of primer to prepare a 100μM storage solution, shake well to mix, and store at -20℃.

[0121] The amount of primers for S3 and CVB (10 μM): The three primer sets were set to three concentration gradients of 0.2 μL, 0.5 μL, and 0.8 μL, respectively. The amount of template cDNA was 1 μL, and the annealing temperature was 55.3°C.

[0122] The reaction system is 20 μL. Add the following components into a 0.2 mL centrifuge tube:

[0123] Upstream primer F (10 μM): 0.2 μL / 0.5 μL / 0.8 μL; downstream primer R (10 μM): 0.2 μL / 0.5 μL / 0.8 μL; 2×Taq plus master mix: 10 μL; cDNA: 1 μL; sterile deionized water: balance; total volume: 20 μL.

[0124] S4. Gently mix, centrifuge, remove bubbles, and place in PCR instrument. The reaction procedure is as follows:

[0125] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, low-temperature annealing (annealing temperature of primer sets 1 to 3 is 55.3°C) for 30 s, extension at 72°C for 1 min, 35 cycles; further extension at 72°C for 10 min; storage at 12°C.

[0126] S5. After the PCR reaction was completed, 2 μL of PCR product was taken for 2% agarose gel electrophoresis detection and photographed using a UV gel imaging system. It can be seen that the three primer sets can amplify the target bands, and the specificity and sensitivity of the three primer sets are good.

[0127] Figure 2 In the figure, the 1st and 21st columns from the left are markers (the bands from top to bottom are 500bp, 400bp, 300bp, 200bp, and 150bp, and the brightest band is the 200bp band, which is indicated by an arrow), and the 2nd column from the left is a negative control (water). The primer dosage of columns 3-8 from the left is 0.2μL; columns 3-5 are the amplified bands of primer set 1, which are displayed clearly; columns 6-8 are the amplified bands of primer set 2, which are not displayed clearly. The primer dosage of columns 9-14 from the left is 0.5μL; columns 9-11 are the amplified bands of primer set 1, which are displayed clearly; columns 12-14 are the amplified bands of primer set 2, which are displayed relatively clearly. Columns 15-17 from the left are the amplified bands of primer set 1 when the primer dosage is 0.8μL, which are displayed clearly. Columns 18-20 are the amplified bands of primer set 2 when the primer dosage is 0.8 μL, which are clearly displayed. The amplified product of primer 3 can also obtain corresponding bands after electrophoresis. It can be seen that the three primer sets shown in Table 1 all have good specificity.

[0128] The target bands were recovered by gel excision, ligated with pGEM-T Easy vector, transformed into E. coli DH5α competent cells, screened by blue-white spots and identified by bacterial liquid PCR, and the positive clones were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were analyzed by NCBI's Blast, and the results were correct, indicating that primers 1-3 had good specificity.

[0129] 2. Sensitivity test

[0130] S1: RNA from samples with positive test results in Example 1 was diluted 10 0 , 10 1 , 10 2 , 10 3 , 10 4 As template RNA, take 5 μL of each and prepare the premix (48 μL system):

[0131] Forward primer of primer 1 (10 μM): 2.1 μL; Reverse primer of primer 1 (10 μM): 2.1 μL;

[0132] Template RNA: 5μ; ddH2O: balance.

[0133] S2: referring to the method of Example 1, freeze-dried microspheres and activator are added to the reaction system of each reaction tube, and then the reaction tube is placed in a thermostat for constant temperature detection.

[0134] S3: After the test, take 5 μL of the amplified product and use DL500 marker and 2% agarose gel for electrophoresis detection, observe and take pictures with the UV gel imaging system. The results show that 10 0～ 10 3 It can still be detected after being diluted 10 times. 4 The end of the dilution was 10 times (undetectable), indicating that the ERA detection technology used in Example 1 has high sensitivity.

[0135] Figure 3 In the figure, the first and last columns from left to right are 500DL markers (500bp, 400bp, 300bp, 200bp, 150bp, 100bp, 50bp from top to bottom), the second column is the H2O control, and the third to seventh columns are 10 diluted CVB virus RNA. 0 , 10 1 , 10 2 , 10 3 , 10 4 times dilution.

[0136] Test Example 2

[0137] This test example is used to illustrate the method of detecting chrysanthemum CVB virus using a single RT-PCR method in the prior art.

[0138] Main reagents:

[0139] RNA extraction kit ( Universal Plant Total RNAlsolation Kit, Vazyme); Reverse transcription cDNA kit (Reverse transcription system, Promega); DNA product purification kit ( SV grl and PCR clean-up system, Promega); TwistAmp Basic kit (Twistamp basic kit, Shanghai Murray Biotechnology Co., Ltd.); 2×Taq Plus Master Mix (Novozyme); T4 DNA ligase kit (Promega); DL500DNAMarker (Takara); DL2000 DNAMarker (Takara); Ampicillin (Ampicillin, Amp) was purchased from Solarbio; Escherichia coli competent cells DH5α were purchased from Tiangen Biochemical Technology Co., Ltd.

[0140] The specific operation method is as follows:

[0141] 1. Extraction of Total RNA

[0142] The total RNA was obtained by referring to the instructions of the RNA extraction kit of Vazyme and used for subsequent cDNA synthesis.

[0143] 2. Synthesis of cDNA

[0144] Refer to the instructions of the reverse transcription kit to synthesize the first strand of cDNA. The specific steps are as follows:

[0145] 1. Take 1 μg of total RNA in a centrifuge tube (RNase free), place it in a 70℃ metal bath for 10 min, and quickly cool it in ice.

[0146] 2. Add the following reagents to a new centrifuge tube (RNase free):

[0147] MgCl2: 4.00 μL;

[0148] Reverse Transcription 10×Buffer: 2.00μL;

[0149] dNTP Mixture: 2.00 μL;

[0150] Reconmbinant Ribonudase Inhibitor: 0.50μL;

[0151] Oligo(dT)15Primer: 1.00μL;

[0152] Total RNA: 1.00 μg;

[0153] AMV Reverse Transcription (HC): 0.65μL;

[0154] NuClease-Free Water: to 20.00μL,

[0155] 3. Mix gently, centrifuge slightly, and place in a 42℃ metal bath for more than 15 minutes.

[0156] 4. Place in a 95℃ hot water bath for 5 minutes, and immediately cool on ice for 5 minutes. Keep the centrifuge tube still during this process.

[0157] 5. Add 80 μL NuClease-Free Water to the centrifuge tube and vortex to mix. The final volume of the obtained cDNA solution is 100 μL and it is stored at -20°C for later use.

[0158] 3. RT-PCR detection of chrysanthemum CVB virus

[0159] 1. Primer design and synthesis

[0160] The gene sequence of chrysanthemum CVB virus was downloaded from NCBI database, and Clustal X software was used for sequence alignment. The relatively conservative region of the gene was selected and the specific primers were designed using Primer Premier 5.0 software. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequence, product size and annealing temperature of CVB virus are shown in Table 3 (the letters "Y" and "H" in the primer sequence in Table 3 are mixed bases, the letter "Y" represents "C / T"; the letter "H" represents A / T / C. The term "mixed base" means that there are two or three corresponding bases at the position. For example, a certain position is mixed base "Y", which means that the position where the mixed base "Y" of this sequence is located has both C and T, and the molar ratio is generally 1:1. When synthesizing primers, these two dNTPs are added at the same time, and the probability of incorporation of the two dNTPs is generally 50%.).

[0161] Table 3: Specific primers required for detection of chrysanthemum CVB virus and viroids

[0162]

[0163] 2. RT-PCR amplification

[0164] (1) Primer preparation: Centrifuge the newly synthesized dry powder primer tube at 4000 rpm for 30-60 seconds. Slowly open the lid and add an appropriate amount of sterile ddH2O according to the primer instructions to adjust the concentration to 10 μmol / L. Vortex thoroughly to mix.

[0165] (2) The reaction system is 20 μL. Add the following components into a 0.2 mL centrifuge tube:

[0166] Upstream primer (10 μmol / L): 1 μL; downstream primer (10 μmol / L): 1 μL; 2×Taq plus master mix: 10 μL; cDNA: 1 μL; sterile deionized water: 7 μL; total volume: 20 μL.

[0167] (3) Mix gently, centrifuge slightly, remove bubbles, and place in a PCR instrument. The reaction procedure is as follows:

[0168] Pre-denaturation at 94°C: 4 min; denaturation at 94°C: 30 s; annealing (temperature see Table 3): low-temperature annealing for 30 s; extension at 72°C: 1 min; re-extension at 72°C: 10 min; storage at 12°C.

[0169] The denaturation to extension step was set to 35 cycles.

[0170] (4) After the PCR reaction was completed, 2 μL of the PCR product was taken for 2% agarose gel electrophoresis and photographed using a UV gel imaging system. Figure 4 The results showed that B1, B2, B3, B4, B5, B6, B8, B9, B10, C1, C2, C4, C5, C6, C7, C8, C9, and C10 were positive, indicating that they were suspected of carrying the chrysanthemum CVB virus.

[0171] 3. Recovery, connection and transformation of target fragments

[0172] Refer to the instructions of Promega's DNA product purification kit to recover and purify the PCR fragment. The specific method is as follows:

[0173] 1) In a UV gel imager, cut the gel containing the target fragment from the agarose gel (try to remove excess gel) and place it in a 1.5 mL sterile centrifuge tube.

[0174] 2) Weigh the gel, add binding solution at a ratio of 1 g:1 mL, place in a metal bath at 65°C for 10 min, take out and cool naturally to room temperature.

[0175] 3) Place the adsorption column CA2 into the collection tube, add the above solution into the adsorption column CA2, place at room temperature for 1 min, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.

[0176] 4) Add 700 μL of membrane wash solution to the adsorption column CA2, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0177] 5) Add 500 μL of rinse solution to the adsorption column CA2, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0178] 6) Place the sample in an airtight container at 12,000 rpm for 1 minute and place in a clean bench for 10 minutes to allow the remaining alcohol to evaporate completely.

[0179] 7) Place the adsorption column CA2 into a new 1.5 mL centrifuge tube, add 30 μL of Nuclease-Free Water in the middle of the adsorption column, leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm for 1 minute, collect the solution in the centrifuge tube, and store it at -20°C for later use.

[0180] (2) Ligation of pGEM-T Easy vector

[0181] Take a 0.2mL centrifuge tube and add the following reagents (10μL) in sequence:

[0182] 2×Rapid ligation buffer: 5.0μL; pGEM-T Easy Vector: 0.5μL; PCR recovery product: 3.5μL; T4 DNA ligase: 1.0μL.

[0183] After the solution is mixed, centrifuge briefly and place in a 4°C refrigerator for 8 to 12 hours.

[0184] (3) Transformation of E. coli competent cells DH5α

[0185] Cloning using blue-white screening:

[0186] 1) In a clean bench, add Amp to a final concentration of 50 mg / L into the melted LB solid medium, pour into a culture dish, open the lid and blow for 40 minutes to evaporate excess water, make an LB plate containing Amp, and store at 4°C for later use.

[0187] 2) Take out the DH5α E. coli competent cells from the -80℃ refrigerator and place them on ice until the bacterial solution melts. Take 5 μL of the above ligation product and add it to a 1.5mL sterile centrifuge tube containing 50 μL of E. coli competent cells, flick to mix, and place on ice for 30 minutes.

[0188] 3) Heat shock in a 42°C water bath for 90 seconds, and quickly place on ice for 3-5 minutes. Do not allow the liquid surface in the centrifuge tube to shake during this process.

[0189] 4) Add 400 μL of LB liquid culture medium (without antibiotics) preheated at 37°C to the above solution, and place it in a full-temperature shaker at 37°C and 180 rpm for activation culture for 40 to 60 minutes.

[0190] 5) Take 200 μL LB liquid medium (without antibiotics), add 4 μL 50 mg / mL IPTG solution and 40 μL 20 mg / mL X-gal solution, mix well, and use a spreader to evenly apply on LB solid medium (containing 50 mg / L Amp).

[0191] 6) Take 400 μL of the transformed bacterial solution and spread it evenly on the above-mentioned LB solid medium, invert it in a 37°C full-temperature shaker, and culture it in the dark for 14 to 16 hours.

[0192] 7) In a clean bench, pick a single white colony and place it in 5 mL of LB liquid culture medium (50 mg / L Amp), and culture it in a full-temperature oscillator at 37°C and 180 rpm in the dark for 14 to 16 hours.

[0193] (4) Bacterial liquid PCR

[0194] 1) Perform the experiment in a clean bench. Take a 0.2 mL centrifuge tube and add the following reagents. Use water instead of bacterial solution as a negative control. The reaction system is 20 μL:

[0195] Upstream primer (10 μmol / L): 1 μL; downstream primer (10 μmol / L): 1 μL; 2×Taq plus master mix: 10 μL; bacterial solution: 1 μL; sterile deionized water: 7 μL; total volume: 20 μL.

[0196] 2) Centrifuge, shake, centrifuge again, remove bubbles, place in PCR instrument, and the reaction procedure is as follows:

[0197] Pre-denaturation at 94°C: 4 min; denaturation at 94°C: 30 s; annealing (temperature see Table 3): low-temperature annealing for 30 s; extension at 72°C: 1 min; re-extension at 72°C: 10 min; storage at 12°C.

[0198] The denaturation to extension step was set to 35 cycles.

[0199] 3) After the PCR reaction is completed, 2 μL of the amplified product is taken for 1% agarose gel electrophoresis detection and photographed using a UV gel imaging system.

[0200] 5) Sequencing and analysis

[0201] The above bacterial solution detected by PCR was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were analyzed for homology using NCBI Blast software. The analysis showed that the results of whether the sample contained CVB virus were the same as those in Example 1.

[0202] Test Example 3

[0203] This test example is used to illustrate the method of detecting chrysanthemum CVB virus using double antigen one-step sandwich enzyme-linked immunosorbent assay (ELISA) in the prior art.

[0204] 1. Main reagents:

[0205] Ruiqing Biological Tomato Sterility Virus (CVB) ELISA (slightly modified)

[0206] 2. Main instruments:

[0207] Grinder (or grinding mortar), ELISA reader, 4℃ refrigerator, -20℃ refrigerator, -80℃ ultra-low temperature refrigerator, microcentrifuge, 37℃ constant temperature box.

[0208] Principle: Double antibody one-step sandwich enzyme-linked immunosorbent assay (ELISA). Add specimens, standards, and HRP-labeled detection antigens to the coated microwells pre-coated with chrysanthemum virus B (CVB) antibodies, in turn, incubate and thoroughly wash. Use substrate TMB for color development. TMB is converted into blue under the catalysis of peroxidase bacteria and into the final yellow under the action of acid. Use an enzyme marker to measure the absorbance (OD value) at a wavelength of 450nm and compare it with the CUTOFF value to determine whether chrysanthemum virus B (CVB) is present in the specimen.

[0209] 3. Sample collection, processing and storage methods:

[0210] 1) The sample cannot contain sodium azide (NaN3) because sodium azide (NaN3) is an inhibitor of horseradish peroxidase (HRP). 2) Extract the sample as soon as possible after collection, and perform the extraction according to relevant literature. 3) Plant liquid or other related samples: Centrifuge at 1000×g for 20 minutes, and take the supernatant for testing. 4) Storage: If the sample is not tested in time after collection, please divide it into a single-use amount and freeze it at -20℃ to avoid repeated freezing and thawing. Thaw it at room temperature and ensure that the sample is evenly and fully thawed.

[0211] 4. Preparation of reagents:

[0212] Dilution of 20× Wash Buffer: Dilute with distilled water at a ratio of 1:20, i.e., 1 part 20× Wash Buffer plus 19 parts distilled water.

[0213] 5. ELISA test steps:

[0214] (1) After equilibration at room temperature for 20 min, take out the required strips from the molybdenum foil bag and seal the remaining strips in a ziplock bag and place them back at 4°C.

[0215] (2) Set up standard wells and sample wells; add 50 μL of standard of different concentrations to each standard well;

[0216] (3) First add 10 μL of the sample to be tested to the sample well, and then add 40 μL of the sample diluent; do not add anything to the blank well.

[0217] (4) Add 100 μL of horseradish peroxide (HRP)-labeled detection antibody to each well except the blank well, seal the wells with a sealing film, and incubate at 37°C in a water bath or incubator for 60 min.

[0218] (5) Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let it stand for 1 min, shake off the washing solution, pat dry on absorbent paper, and repeat this process 5 times (you can also use a plate washer to wash the plate).

[0219] (6) Add 50 μL of substrate A and B to each well and incubate at 37°C in the dark for 15 min.

[0220] (7) Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0221] 6. Calculation and result judgment:

[0222] (1) Test validity: The average OD value of the positive control wells is ≥1.00, and the average OD value of the negative control wells is <0.15. (2) Calculation of the cutoff value: cutoff value = average value of the negative control wells + 0.15. (3) Negative judgment: If the sample OD value is < the cutoff value, the sample is negative. (4) Positive judgment: If the sample OD value is > the cutoff value, the sample is positive.

[0223] 7. Kit performance:

[0224] Accuracy: The average OD value of the positive control wells is >1.00; the average OD value of the negative control wells is ≤0.15, indicating that the test results are valid. In this test example, the results of ELISA CVB virus detection of 30 chrysanthemum samples are as follows:

[0225] Table 4: First test:

[0226]

[0227] Table 5: Second test:

[0228]

[0229] Table 6: The third test:

[0230]

[0231]

[0232] The results showed that the results of the three tests were consistent and consistent with the test results of each chrysanthemum sample in Example 1, indicating that the method of the present invention can accurately detect positive CVB results.

[0233] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A probe and primer set for rapid detection of chrysanthemum CVB virus, characterized in that: The nucleotide sequence of the probe is shown in Sequence 7 of the sequence listing; The primer set is selected from any one, two or three of primer set 1, primer 2 and primer set 3; The upstream primer of the primer set 1 is shown as Sequence 1 in the sequence listing, and the downstream primer is shown as Sequence 2 in the sequence listing; the upstream primer of the primer set 2 is shown as Sequence 3 in the sequence listing, and the downstream primer is shown as Sequence 4 in the sequence listing; the upstream primer of the primer set 1 is shown as Sequence 5 in the sequence listing, and the downstream primer is shown as Sequence 6 in the sequence listing.

2. The probe and primer set for rapid detection of chrysanthemum CVB virus according to claim 1, characterized in that: The probe carries at least one fluorescent group; Preferably, the fluorescent group is at least one of FAM, THF, BHQ1 and C3-SPACER; More preferably, the 31st T at the 5' end of the probe is connected to the fluorescent group FAM, the 32nd C is connected to the fluorescent group THF, the 33rd T is connected to the fluorescent group BHQ1, and the A at the 3' end is connected to the fluorescent group C3-SPACER.

3. A chrysanthemum CVB virus rapid detection kit, characterized in that: The kit comprises the probe and primer set according to claim 1 or 2.

4. The chrysanthemum CVB virus rapid detection kit according to claim 3, characterized in that: The kit also includes freeze-dried microspheres and an activator.

5. The chrysanthemum CVB virus rapid detection kit according to claim 4, characterized in that: The freeze-dried microspheres include: a buffer, an excipient, a reaction enzyme agent, and other agents; The activator is selected from one or more of the following: magnesium ion salt, nickel ion salt, manganese ion salt; Preferably, the activator is magnesium acetate.

6. The chrysanthemum CVB virus rapid detection kit according to claim 5, characterized in that: The buffer comprises at least one of the following: tris(hydroxymethyl)aminomethane, sodium ions, potassium ions, chloride ions, acetate ions, and sulfate ions; The excipients include at least one of the following: trehalose, raffinose, dextran, dextrin, polyethylene glycol, mannitol, glycerol, alanine, lysine, sodium glutamate, bovine serum albumin, casein, Triton X-100, Tween-80, ethylphenyl polyethylene glycol-40, dimethyl sulfoxide, N,N-dimethylformamide; The reaction enzyme agent includes at least one of the following: Escherichia coli SSB protein, bacteriophage uvsX protein, bacteriophage uvsY protein, klenow polymerase large fragment, nuclease exonuclease, reverse transcriptase, creatine kinase, 10U of RNAse inhibitor; The other agents include: dNTP, and at least one of the following: dithiothreitol, creatine phosphate, imidazole, and adenosine triphosphate.

7. The chrysanthemum CVB virus rapid detection kit according to claim 5, characterized in that: The preparation method of the freeze-dried microspheres comprises the following steps: S1: preparing the buffer, excipient, reaction enzyme agent and other agents into a microsphere stock solution; S2: dropping the microsphere stock solution into liquid nitrogen to obtain solidified microspheres; S3: freeze-drying the solidified beads to obtain freeze-dried microspheres.

8. A method for rapid detection of chrysanthemum CVB virus, characterized in that: The method uses the probe and primer according to claim 1 or 2, and the kit according to any one of claims 3 to 7; Preferably, the detection method comprises the following steps: S1: prepare reaction premix; S2: mixing the premixed solution with the freeze-dried microspheres, and then mixing with the activator to obtain a reaction mixture; S3: subjecting the reaction mixture to a constant temperature amplification reaction; S4: judging whether chrysanthemum CVB virus is contained according to the fluorescent signal generated by the isothermal amplification reaction.

9. The method for rapid detection of chrysanthemum CVB virus according to claim 8, characterized in that: The reaction premix comprises: Forward primer: the final concentration in the reaction premix is ​​0.25-0.65 μM, preferably 0.44 μM; Reverse primer: the final concentration in the reaction premix is ​​0.25-0.65 μM, preferably 0.44 μM; Fluorescent probe: the final concentration in the reaction premix is ​​0.1-0.15 μM, preferably 0.125 μM; Template RNA: the final concentration in the reaction premix is ​​15-550 μg / mL, preferably 20.83-416.67 μg / mL; The amount of the freeze-dried microspheres is: the volume is the same as that of the template RNA; The final concentration of the activator in the reaction mixture is 10-20 mM, preferably 14 mM; In the isothermal amplification reaction, the temperature is 40-45°C, preferably 45°C, and the time is 10-30 minutes, preferably 20 minutes.

10. Use of the probe and primer set according to claim 1 or 2, the kit according to any one of claims 3 to 7, and the detection method according to claim 8 or 9 in rapid detection of chrysanthemum CVB virus.

Images