Fluorescent quantitative RT-PCR primer pair, probe group and kit for BVDV nucleic acid detection based on reference gene HMBS

Abstract

The invention discloses a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer pair, a probe group and a kit for carrying out BVDV (Bovine Virus Disease Virus) nucleic acid detection on the basis of a reference gene HMBS. The primer pair and the probe group comprise an upstream primer BVDV-F, a downstream primer BVDV-R, a TaqMan probe BVDV-P, an upstream primer HMBS-F, a downstream primer HMBS-R and a TaqMan probe HMBS-P, and the sequences of the primer pair and the probe group are as shown in SEQ ID NO. 1-6. According to the invention, a housekeeping gene with relatively stable expression is introduced as a reference gene to correct and standardize target gene detection, so that the technical defects of false negative and false positive possibly appearing in the existing kit are avoided, and the accuracy, sensitivity and repeatability of detection of the primer pair, the probe group and the kit are improved; and the nucleic acids of BVDV-1, BVDV-2 and BVDV-3 in different samples can be detected at the same time.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a fluorescent quantitative RT-PCR primer pair, a probe group and a kit for detecting BVDV nucleic acid based on an internal reference gene HMBS. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is distributed globally and has two genotypes, namely BVDV-1 and BVDV-2. It belongs to the genus Pestivirus of the Flaviviridae family, along with swine fever virus (CSFV) and sheep border virus. In recent years, new BVDV strains different from BVDV-1 and BVDV-2 have been discovered and classified as BVDV-3 by researchers. Due to the extensive cross-antigen and serological cross-reactions between BVDV and CSFV, it is difficult to differentiate them clinically using serological methods.

[0003] Fluorescence quantitative RT-PCR technology has the advantages of strong specificity, high sensitivity and wide detection range, and is an important detection method. The existing fluorescence quantitative RT-PCR method for detecting BVDV nucleic acid is mainly used to detect BVDV-1 and BVDV-2 nucleic acids. A very small number of fluorescence quantitative RT-PCR primer pairs, probe groups and kits for the simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids are also unable to identify CSFV and are only used for the detection of bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for the detection of porcine samples. In addition, the existing fluorescence quantitative RT-PCR primer pairs, probe groups and kits for the simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids lack internal reference gene design, and cannot monitor the effects of samples in the collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction links, cannot avoid the occurrence of "false negatives", and cannot monitor whether the entire reaction process is proceeding smoothly.

[0004] The internal reference gene undergoes exactly the same processing procedures as the target gene in the sample, which can not only monitor whether a sufficient amount of sample cells are collected, but also monitor the entire process of sampling, transportation, processing, nucleic acid extraction and amplification. The internal reference gene is a gene that is indispensable for maintaining the minimum function of the cell. The expression of the ideal internal reference gene in different types of cells and tissues should not be significantly different, and it should not be affected by experimental and clinical conditions. However, since the expression of the internal reference gene is species and tissue specific, the stability of its expression is relative, so the selection of a suitable internal reference gene is particularly important for nucleic acid quantification. The porcine hydroxymethylcholine synthase (HMBS) gene is involved in the heme synthesis pathway and does not exist in plants and prokaryotes. Its nucleic acid sequence shows high nucleic acid sequence diversity in animals, parasites, and insects, and is suitable as an internal reference gene for correction and standardization of target gene detection.

[0005] Therefore, it is necessary to establish fluorescent quantitative RT-PCR primer pairs, probe sets and kits for BVDV nucleic acid detection based on the internal reference gene HMBS to avoid the occurrence of "false negatives" and "false positives" and detect more BVDV genotypes. This is not only conducive to accurate and efficient BVDV monitoring, but also has important significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products. Summary of the invention

[0006] The purpose of the present invention is to provide a fluorescent quantitative RT-PCR primer pair, a probe group and a kit for BVDV nucleic acid detection based on an internal reference gene HMBS, which introduces a housekeeping gene with relatively stable expression as an internal reference gene to correct and standardize the detection of the target gene, thereby avoiding the technical shortcomings of "false negative" and "false positive" that may occur in existing kits, so as to improve the accuracy, sensitivity and repeatability of the primer pair, the probe group and the kit detection, and can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] A fluorescent quantitative RT-PCR primer pair and probe set for BVDV nucleic acid detection based on an internal reference gene HMBS, comprising:

[0009] 1) The primer pair sequence for amplifying BVDV 5′-UTR is:

[0010] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′ (genomic position: 86-104 nt);

[0011] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′ (genomic position: 228-247 nt).

[0012] 2) The TaqMan probe sequence for detecting the BVDV 5′-UTR amplification product is:

[0013] BVDV-P: 5′-FAM-CCCYGAGTACRGGGDAGTCGTCARTGGT-BHQ1 -3′ (genomic position: 176-203 nt).

[0014] 3) The primer pair sequence for amplifying the porcine internal reference gene HMBS is:

[0015] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′ (genomic position: 655 -669 nt);

[0016] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′ (genomic position: 697-719 nt).

[0017] 4) The TaqMan probe sequence for detecting the amplified product of the porcine internal reference gene HMBS is:

[0018] HMBS-P: 5′-VIC-CCGAGCCAAGGACCAGGACATCC-BHQ1-3′ (genomic position: 672-694 nt).

[0019] A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on an internal reference gene HMBS comprises an upstream primer BVDV-F, a downstream primer BVDV-R, an upstream primer HMBS-F, and a downstream primer HMBS-R.

[0020] The fluorescent quantitative RT-PCR kit is a one-step TaqMan probe method kit, a one-step SYBR Green I method kit, a two-step TaqMan probe method kit, a two-step SYBR Green I method kit, and the like.

[0021] Furthermore, the one-step TaqMan probe method kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, and enzyme-free water.

[0022] Furthermore, the one-step SYBR Green I method kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-PCR Buffer, TaqHS, RTenzyme Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, and enzyme-free water.

[0023] Furthermore, the two-step TaqMan probe method kit comprises at least the following components:

[0024] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control;

[0025] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0026] TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, ROX, enzyme-free water.

[0027] Furthermore, the two-step SYBR Green I method kit comprises at least the following components:

[0028] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control;

[0029] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0030] SYBR fluorescent PCR reaction system: Ex TaqⅡ enzyme, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, ROX, enzyme-free water.

[0031] Further, in the kit,

[0032] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use.

[0033] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)].

[0034] HMBS recombinant plasmid: a recombinant plasmid containing the internal reference gene HMBS target fragment [genomic location (495-879nt)]. After adding HMBS recombinant plasmid to non-porcine samples, nucleic acid extraction is performed; for porcine samples, nucleic acid extraction can be performed directly without adding HMBS recombinant plasmid.

[0035] Negative control: enzyme-free water, cell culture medium known to be BVDV-negative and HMBS-negative, or animal tissue suspension known to be BVDV-negative and HMBS-negative.

[0036] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize under high pressure at 121°C ± 2°C for 30 minutes, cool and refrigerate for later use.

[0037] Further preferably, in the kit,

[0038] BVDV virus liquid positive control: BVDV-1AV69 strain MDBK cell passage product, with a virus titer of 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0039] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)], 10,000 copies / uL to 500,000 copies / uL.

[0040] HMBS recombinant plasmid: a recombinant plasmid containing the internal reference gene HMBS target fragment [genomic location (495-879nt)], 10,000 copies / uL to 500,000 copies / uL. Each non-porcine sample (200-400uL) needs to be added with 5-20uL of HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction; pig-derived samples do not need to add HMBS recombinant plasmid and can be directly extracted for nucleic acid.

[0041] Further preferably, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0042] The present invention has the following beneficial effects:

[0043] 1. The present invention establishes fluorescent quantitative RT-PCR primer pairs, probe sets and kits that can simultaneously detect BVDV-1, BVDV-2 and BVDV-3 nucleic acids in different samples. Existing patents are mainly used to detect BVDV-1 and BVDV-2 nucleic acids. Very few fluorescent quantitative RT-PCR primer pairs, probe sets and kits for simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids are also unable to identify CSFV and are only used for bovine samples such as bovine nasal swabs and fecal samples. There is a technical defect that "false positives" may occur when used for porcine sample detection, see Application Example 5. Therefore, the present invention can detect more BVDV genotypes, see Application Examples 1-4.

[0044] 2. The present invention introduces a relatively stable housekeeping gene HMBS as an internal reference gene to calibrate and standardize the detection of the target gene, and can monitor the entire process of sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction. If there is no amplification curve for the internal reference gene control, it indicates that there are problems in the sample collection, transportation, sample processing, nucleic acid extraction, reverse transcription or amplification reaction. The sample detection result is invalid, avoiding the occurrence of "false negative" samples, see Application Examples 1-5. The existing fluorescent quantitative RT-PCR primer pairs, probe groups and kits for simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids lack internal reference gene design, cannot avoid the occurrence of "false negative" samples, and cannot monitor whether the sample is progressing smoothly throughout the reaction process.

[0045] The present invention fills the technical gap in fluorescent quantitative RT-PCR primer pairs, probe sets and kits for simultaneous detection of BVDV-1, BVDV-2 and BVDV-3 nucleic acids based on the internal reference gene HMBS, and is of great significance for ensuring the quality of animal vaccines, protecting the healthy development of animal husbandry, and promoting the export of my country's agricultural products.

[0046] 3. The fluorescent quantitative RT-PCR kit for detecting bovine viral diarrhea virus nucleic acid of the present invention has high sensitivity, and the minimum detection limits for BVDV-1AV69 strain, BVDV-1 recombinant plasmid template, BVDV-2 recombinant plasmid template, and BVDV-3 recombinant plasmid template are 10 -1.5 FAID 50 / 0.1mL, 1 copy number / uL, 1 copy number / uL, 10 copies / uL. The minimum detection limit of the fluorescent quantitative RT-PCR kit for detecting bovine viral diarrhea virus nucleic acid of the present invention is lower than that of the existing patent, and the sensitivity is higher than that of the existing patent, see Application Examples 1-4. In addition, the detection of the kit of the present invention has a good linear relationship and a high amplification efficiency, which is conducive to accurate and efficient BVDV monitoring.

[0047] 4. The fluorescent quantitative RT-PCR primer pairs and probe sets for detecting bovine viral diarrhea virus nucleic acid of the present invention can be used in a variety of fluorescent quantitative RT-PCR kits, including but not limited to: a one-step TaqMan probe method kit, a one-step SYBR Green I method kit, a two-step TaqMan probe method kit, and a two-step SYBR Green I method kit. The kit can be selected according to actual detection needs. It has the advantages of low detection cost, high practical value, and broad application prospects, see Application Examples 1-5. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The results of the test kit in Example 1 for detecting the BVDV-1AV69 virus liquid are shown below: 1. Standard sample 1 (103.5 FAID 50 / 0.1mL); 2. Standard sample 2 (10 2.5 FAID 50 / 0.1mL); 3. Standard sample 3 (10 1.5 FAID 50 / 0.1mL); 4. Standard sample 4 (10 0.5 FAID 50 / 0.1mL); 5. Standard sample 5 (10 -0.5 FAID 50 / 0.1mL); 6. Standard sample 6 (10 - 1.5 FAID 50 / 0.1mL); 7. Virus control 1; 8. Virus control 2.

[0049] Figure 2 The sensitivity of the existing patented test kit to detect BVDV-1AV69 virus liquid; 1. Standard sample 1 (10 3.5 FAID 50 / 0.1mL); 2. Standard sample 2 (10 2.5 FAID 50 / 0.1mL); 3. Standard sample 3 (10 1.5 FAID 50 / 0.1mL); 4. Standard sample 4 (10 0.5 FAID 50 / 0.1mL); 5. Standard sample 5 (10 -0.5 FAID 50 / 0.1mL); 6. Standard sample 6 (10 - 1.5 FAID 50 / 0.1mL); 7. Virus control 1; 8. Virus control 2.

[0050] Figure 3 The sensitivity results of the primer pairs and probe sets of the present invention for detecting a series of standard samples (a to f); 1. BVDV-1 recombinant plasmid (100,000 copies / uL); 2. BVDV-1 recombinant plasmid (10,000 copies / uL); 3. BVDV-1 recombinant plasmid (1000 copies / uL); 4. BVDV-1 recombinant plasmid (100 copies / uL); 5. BVDV-1 recombinant plasmid (10 copies / uL); 6. BVDV-1 recombinant plasmid (1 copy / uL).

[0051] Figure 4The sensitivity results of the primer pairs and probe sets of the present invention for detecting a series of standard samples (a to f); 1. HMBS recombinant plasmid (100,000 copies / uL); 2. HMBS recombinant plasmid (10,000 copies / uL); 3. HMBS recombinant plasmid (1,000 copies / uL); 4. HMBS recombinant plasmid (100 copies / uL); 5. HMBS recombinant plasmid (10 copies / uL); 6. HMBS recombinant plasmid (1 copy / uL).

[0052] Figure 5 It is the sensitivity result of the primer pair and probe group of the present invention for detecting a series of standard samples (g to l); 1. BVDV-2 recombinant plasmid (100,000 copies / uL); 2. BVDV-2 recombinant plasmid (10,000 copies / uL); 3. BVDV-2 recombinant plasmid (1000 copies / uL); 4. BVDV-2 recombinant plasmid (100 copies / uL); 5. BVDV-2 recombinant plasmid (10 copies / uL); 6. BVDV-2 recombinant plasmid (1 copy / uL).

[0053] Figure 6 It is the sensitivity result of the primer pair and probe group of the present invention for detecting a series of standard samples (g to l); 1. HMBS recombinant plasmid (100,000 copies / uL); 2. HMBS recombinant plasmid (10,000 copies / uL); 3. HMBS recombinant plasmid (1,000 copies / uL); 4. HMBS recombinant plasmid (100 copies / uL); 5. HMBS recombinant plasmid (10 copies / uL); 6. HMBS recombinant plasmid (1 copy / uL).

[0054] Figure 7 It is the sensitivity result of the primer pair and probe group of the present invention for detecting a series of standard samples (m to r); 1. BVDV-3 recombinant plasmid (100,000 copies / uL); 2. BVDV-3 recombinant plasmid (10,000 copies / uL); 3. BVDV-3 recombinant plasmid (1000 copies / uL); 4. BVDV-3 recombinant plasmid (100 copies / uL); 5. BVDV-3 recombinant plasmid (10 copies / uL); 6. BVDV-3 recombinant plasmid (1 copy / uL).

[0055] Figure 8It is the sensitivity result of the primer pair and probe group of the present invention for detecting a series of standard samples (m to r); 1. HMBS recombinant plasmid (100,000 copies / uL); 2. HMBS recombinant plasmid (10,000 copies / uL); 3. HMBS recombinant plasmid (1,000 copies / uL); 4. HMBS recombinant plasmid (100 copies / uL); 5. HMBS recombinant plasmid (10 copies / uL); 6. HMBS recombinant plasmid (1 copy / uL).

[0056] Fig. 9 Schematic diagram of typical amplification curves / target melting curves for negative and positive BVDV nucleic acid; (a) one-step TaqMan probe method kit; (b) one-step SYBR Green I method kit; (c) two-step TaqMan probe method kit; (d) two-step SYBR Green I method kit.

[0057] Fig.10 Schematic diagram of typical amplification curves / target melting curves for negative and positive HMBS nucleic acid; (a) one-step TaqMan probe method kit; (b) one-step SYBR Green I method kit; (c) two-step TaqMan probe method kit; (d) two-step SYBR Green I method kit. DETAILED DESCRIPTION

[0058] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0059] According to the published genome sequences of BVDV-1 (AF091605, AF220247, AF526381, JN400273, KC695814, KJ541471, M31182, MN188074), BVDV-2 (AF502399, FJ527854, HQ258810, JF714967, KJ000672, MN527354, OP7920 28, NC_039237), BVDV-3 (KY762287, KY767958, MH410814, NC_012812, OP210314, HQ231763, JX469119, JX985409) and CSFV (AF091507, AF531433, AY568569, DQ127910, EU490425) gene sequences were analyzed using DNAStar 7.1 software was used to compare and analyze the sequences, and the conservative segment of the 5′-UTR gene was selected as the target gene for detection. According to the TaqMan probe design principles, BioEdit7.2.6.1 and Primer Express 3.0.1 software were used to design a pair of BVDV 5′-UTR primers and a specific TaqMan probe, which were named upstream primer BVDV-F, downstream primer BVDV-R, and probe BVDV-P, respectively, and their specificity was identified by BLAST. In addition, according to the pig HMBS (DQ845174.1) internal reference gene sequence in GenBank, according to the TaqMan probe design principles, Primer Express3.0.1 software was used to design a pair of internal reference gene HMBS primers and a specific TaqMan probe, which were named upstream primer HMBS-F, downstream primer HMBS-R, and probe HMBS-P, respectively, and their specificity was identified by BLAST. Furthermore, a fluorescent quantitative RT-PCR primer pair, a probe set and a kit for detecting BVDV nucleic acid based on an internal reference gene HMBS are provided.

[0060] A fluorescent quantitative RT-PCR primer pair and probe set for BVDV nucleic acid detection based on an internal reference gene HMBS, comprising:

[0061] 1) The primer pair sequence for amplifying BVDV 5′-UTR is:

[0062] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′ (genomic position: 86-104 nt);

[0063] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′ (genomic position: 228-247 nt).

[0064] 2) The TaqMan probe sequence for detecting the BVDV 5′-UTR amplification product is:

[0065] BVDV-P: 5′-FAM-CCCYGAGTACRGGGDAGTCGTCARTGGT-BHQ1 -3′ (genomic position: 176-203 nt).

[0066] In the above 1) and 2), the genomic positions of the primers and probes were referenced to the BVDV-1 Oregon C24V strain (GenBank Accession No.: AF091605).

[0067] 3) The primer pair sequence for amplifying the porcine internal reference gene HMBS is:

[0068] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′ (genomic position: 655 -669 nt);

[0069] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′ (genomic position: 697-719 nt).

[0070] 4) The TaqMan probe sequence for detecting the amplified product of the porcine internal reference gene HMBS is:

[0071] HMBS-P: 5′-VIC-CCGAGCCAAGGACCAGGACATCC-BHQ1-3′ (genomic position: 672-694 nt).

[0072] In the above 3) and 4), the genomic positions of primers and probes refer to the internal reference gene HMBS (GenBank accession number: DQ845174.1).

[0073] A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on an internal reference gene HMBS comprises an upstream primer BVDV-F, a downstream primer BVDV-R, an upstream primer HMBS-F, and a downstream primer HMBS-R.

[0074] The fluorescent quantitative RT-PCR kit is a one-step TaqMan probe method kit, a one-step SYBR Green I method kit, a two-step TaqMan probe method kit, a two-step SYBR Green I method kit, and the like.

[0075] Furthermore, the one-step TaqMan probe method kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, and enzyme-free water.

[0076] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0077] The reaction system was prepared according to Table 1. The optimized reaction conditions were: 52°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), and 45 cycles.

[0078] Table 1 One-step TaqMan probe kit reaction system

[0079] Components Volume (μL) RT-qPCR Mix 10 Upstream primer BVDV-F (10 μM) 0.4 to 1.6 Downstream primer BVDV-R (10 μM) 0.4 to 1.6 TaqMan probe BVDV-P (10 μM) 0.4 to 0.8 Upstream primer HMBS-F (10 μM) 0.4 to 1.6 Downstream primer HMBS-R (10 μM) 0.4 to 1.6 TaqMan probe HMBS-P (10 μM) 0.2 to 0.8 ROX 0.05 to 0.4 DNA / RNA ≤2 Enzyme-free water Fill up to 20

[0080] Result judgment:

[0081] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0082] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0083] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0084] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0085] ③The negative control of the VIC channel (HMBS detection) should have no Ct value and no HMBS amplification curve (see Appendix B).

[0086] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (HMBS detection). The judgment was divided into:

[0087] (3-1) When the VIC channel (HMBS detection) sample has no Ct value and no HMBS amplification curve, or when the VIC channel (HMBS detection) sample Ct value is >35 and a typical HMBS amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0088] (3-2) When the Ct value of the VIC channel (HMBS test) sample is ≤35 and a typical HMBS amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV test):

[0089] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0090] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0091] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0092] Furthermore, the one-step SYBR Green I method kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-PCR Buffer, TaqHS, RTenzyme Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, and enzyme-free water.

[0093] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0094] The reaction system was prepared according to Table 2. The optimized reaction conditions were: 42°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), 40 cycles; melting curve acquisition program (set according to the melting curve acquisition program of different qPCR instruments). The melting temperature of BVDV was 85.9±0.3°C, and the melting temperature of HMBS was 80.1±0.3°C.

[0095] Table 2 Reaction system of one-step SYBR Green I kit

[0096] Components Volume (μL) RT-PCR Buffer 10 TaqHS 0.4 RT enzyme Mix 0.4 Upstream primer BVDV-F (10 μM) 0.4 to 2 Downstream primer BVDV-R (10 μM) 0.4 to 2 Upstream primer HMBS-F (10 μM) 0.4 to 2 Downstream primer HMBS-R (10 μM) 0.4 to 2 ROX 0.05 to 0.4 DNA / RNA ≤2 Enzyme-free water Fill up to 20

[0097] Result judgment:

[0098] (1) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0099] ① The negative control should have no BVDV target melting curve;

[0100] ② The positive control showed a typical BVDV target melting curve (BVDV melting temperature was 85.9±0.3℃) (see Appendix A);

[0101] ③ The negative control should have no HMBS target melting curve.

[0102] (2) The test results are judged based on whether a typical BVDV target melting curve or a typical HMBS target melting curve appears. The judgment is divided into:

[0103] (2-1) If the sample does not have the HMBS target melting curve, it indicates that there are inhibitory components in the reaction system or nucleic acid is lost. It is necessary to resample, extract or further purify the nucleic acid before retesting.

[0104] (2-2) When the sample shows a typical HMBS target melting curve (HMBS melting temperature is 80.1±0.3℃) (see Appendix B), the test results shall be judged based on whether a typical BVDV target melting curve appears:

[0105] ① There is no BVDV target melting curve, indicating that there is no BVDV nucleic acid in the sample, which is judged as negative;

[0106] ② The appearance of a typical BVDV target melting curve indicates the presence of BVDV nucleic acid in the sample, which is judged as positive.

[0107] Furthermore, the two-step TaqMan probe method kit comprises at least the following components:

[0108] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control;

[0109] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0110] TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, ROX, enzyme-free water.

[0111] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0112] The cDNA synthesis reaction system was prepared according to Table 3. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0113] Table 3 Reaction system of cDNA synthesis kit

[0114] Components Volume (μL) RT Master Mix 2 DNA / RNA ≤6 Enzyme-free water Fill up to 10

[0115] The TaqMan fluorescent PCR reaction system was prepared according to Table 4. The optimized reaction conditions were: 95°C for 30 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescent signals), and 45 cycles.

[0116] Table 4 Two-step TaqMan probe kit fluorescent PCR reaction system

[0117] Components Volume (μL) Ex Taq enzyme 10 Upstream primer BVDV-F (10 μM) 0.4 to 2.4 Downstream primer BVDV-R (10 μM) 0.4 to 2.4 TaqMan probe BVDV-P (10 μM) 0.4 to 0.8 Upstream primer HMBS-F (10 μM) 0.4 to 2.4 Downstream primer HMBS-R (10 μM) 0.4 to 2.4 TaqMan probe HMBS-P (10 μM) 0.2 to 0.8 ROX 0.05 to 0.2 cDNA ≤2 Enzyme-free water Fill up to 20

[0118] Result determination: Same one-step TaqMan probe method kit.

[0119] The two-step SYBR Green I method kit comprises at least the following components:

[0120] Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control;

[0121] cDNA synthesis system: RT Master Mix and enzyme-free water;

[0122] SYBR fluorescent PCR reaction system: Ex TaqⅡ enzyme, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, ROX, enzyme-free water.

[0123] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0124] The cDNA synthesis reaction system was prepared according to Table 3. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0125] The SYBR fluorescent PCR reaction system was prepared according to Table 5. The optimized reaction conditions were: 95°C for 30 seconds; 95°C for 5 seconds, 60°C for 34 seconds (collecting fluorescent signals), 40 cycles; melting curve acquisition program (set according to the melting curve acquisition program of different qPCR instruments). The melting temperature of BVDV was 85.9±0.3°C, and the melting temperature of HMBS was 80.1±0.3°C.

[0126] Table 5 Two-step SYBR Green I kit fluorescent PCR reaction system

[0127]

[0128]

[0129] Result determination: same one-step SYBR Green I kit.

[0130] Furthermore, in the above-mentioned kit,

[0131] BVDV virus liquid positive control: BVDV virus liquid, inactivated by formaldehyde at 37°C and then aliquoted for use.

[0132] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)].

[0133] HMBS recombinant plasmid: a recombinant plasmid containing the internal reference gene HMBS target fragment [genomic location (495-879nt)]. After adding HMBS recombinant plasmid to non-porcine samples, nucleic acid extraction is performed; for porcine samples, nucleic acid extraction can be performed directly without adding HMBS recombinant plasmid.

[0134] Negative control: enzyme-free water, cell culture medium known to be BVDV-negative and HMBS-negative, or animal tissue suspension known to be BVDV-negative and HMBS-negative.

[0135] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize under high pressure at 121°C ± 2°C for 30 minutes, cool and refrigerate for later use.

[0136] RT-qPCR Mix, RT-PCR Buffer, TaqHS, RT enzyme Mix, ROX, RT Master Mix, ExTaq enzyme, and Ex TaqⅡ enzyme are all products of Dalian Baobio Biotechnology Co., Ltd.

[0137] Further preferably, in the kit,

[0138] BVDV virus liquid positive control: BVDV-1AV69 strain MDBK cell passage product, with a virus titer of 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0139] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the BVDV 5′-UTR gene [genomic location (1-385nt)], 10,000 copies / uL to 500,000 copies / uL.

[0140] HMBS recombinant plasmid: a recombinant plasmid containing the internal reference gene HMBS target fragment [genomic location (495-879nt)], 10,000 copies / uL to 500,000 copies / uL. Each non-porcine sample (200-400uL) needs to be added with 5-20uL of HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction; pig-derived samples do not need to add HMBS recombinant plasmid and can be directly extracted for nucleic acid.

[0141] Further preferably, the BVDV recombinant plasmid positive control is a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-1Oregon C24V strain (GenBank Accession No.: AF091605), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-2SH-28 strain (GenBank Accession No.: HQ258810.1), or a recombinant plasmid containing the 5′-UTR gene target fragment of the BVDV-3Th / 04_KhonKaen strain (GenBank Accession No.: NC_012812.1).

[0142] Furthermore, the HMBS recombinant plasmid is a recombinant plasmid containing the target fragment of the HMBS internal reference gene (GenBank accession number: DQ845174.1).

[0143] Example 1

[0144] One-step TaqMan probe kit for detecting BVDV nucleic acid, including:

[0145] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-3Th / 04_KhonKaen strain, 500,000 copies / uL

[0146] HMBS recombinant plasmid: a recombinant plasmid containing the target fragment of the HMBS internal reference gene, 500,000 copies / uL.

[0147] Negative control: cell culture medium known to be BVDV negative and HMBS negative.

[0148] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0149] RT-qPCR Mix and ROX are both products of Dalian Baobiological Company.

[0150] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′;

[0151] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′;

[0152] TaqMan probe BVDV-P: 5′-FAM-CCCYGAGTACRGGGDAGTCGTCARTGGT-BHQ1-3′.

[0153] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′;

[0154] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′;

[0155] TaqMan probe HMBS-P: 5′-VIC-CCGAGCCAAGGACCAGGACATCC-BHQ1-3′.

[0156] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 5uL of HMBS recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0157] The reaction system was prepared according to Table 6. The optimized reaction conditions were: 52°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), and 45 cycles.

[0158] Table 6 One-step TaqMan probe kit reaction system

[0159]

[0160]

[0161] Result judgment:

[0162] (1) Setting of analysis conditions: The threshold value was adjusted according to the instrument noise, so that the threshold line just exceeded the highest point of the negative control amplification line.

[0163] (2) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0164] ① The negative control of the FAM channel (BVDV detection) should have no Ct value and no BVDV amplification curve (see Appendix A);

[0165] ② The Ct value of the positive control in the FAM channel (BVDV detection) should be ≤35, and a typical BVDV amplification curve should appear (see Appendix A);

[0166] ③The negative control of the VIC channel (HMBS detection) should have no Ct value and no HMBS amplification curve (see Appendix B).

[0167] (3) The test results were judged according to the Ct values ​​of the FAM channel (BVDV detection) and the VIC channel (HMBS detection). The judgment was divided into:

[0168] (3-1) When the VIC channel (HMBS detection) sample has no Ct value and no HMBS amplification curve, or when the VIC channel (HMBS detection) sample Ct value is >35 and a typical HMBS amplification curve appears (see Appendix B), it indicates that there are inhibitory components or nucleic acid loss in the reaction system, and resampling, extraction or further purification of nucleic acid is required before retesting.

[0169] (3-2) When the Ct value of the VIC channel (HMBS test) sample is ≤35 and a typical HMBS amplification curve appears, the test result is determined based on the Ct value of the FAM channel (BVDV test):

[0170] ① The sample in the FAM channel (BVDV detection) has no Ct value and no BVDV amplification curve, indicating that there is no BVDV nucleic acid in the sample and it is judged as negative;

[0171] ② The sample Ct value of the FAM channel (BVDV detection) is ≤42, and a typical BVDV amplification curve appears, indicating that BVDV nucleic acid exists in the sample and is judged as positive;

[0172] ③ Samples with a Ct value of >42 in the FAM channel (BVDV detection) and a typical BVDV amplification curve need to be retested. If the above results are still present after retesting, it is considered positive, otherwise it is considered negative.

[0173] Example 2

[0174] One-step SYBR Green I kit for detecting BVDV nucleic acid, including:

[0175] BVDV virus liquid positive control: BVDV-1AV69 strain MDBK cell passage product, with a virus titer of 10 3.5 FAID 50 / 0.1mL, inactivated with formaldehyde at 37℃ and then divided for use.

[0176] HMBS recombinant plasmid: a recombinant plasmid containing the target fragment of the HMBS internal reference gene, 10,000 copies / uL.

[0177] Negative control: cell culture medium known to be BVDV negative and HMBS negative.

[0178] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0179] RT-PCR Buffer, TaqHS, RT enzyme Mix, and ROX are all products of Dalian Bao Biotechnology Co., Ltd.

[0180] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′.

[0181] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′.

[0182] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′.

[0183] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′.

[0184] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (200uL), 5uL of HMBS recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0185] The reaction system was prepared according to Table 7. The optimized reaction conditions were: 42°C for 5 min; 95°C for 10 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescence signals), 40 cycles; melting curve acquisition program (set according to the melting curve acquisition program of different qPCR instruments). The melting temperature of BVDV was 85.9±0.3°C, and the melting temperature of HMBS was 80.1±0.3°C.

[0186] Table 7 One-step SYBR Green I kit reaction system

[0187] Components Volume (μL) RT-PCR Buffer 10 TaqHS 0.4 RT enzyme Mix 0.4 Upstream primer BVDV-F (10 μM) 2 Downstream primer BVDV-R (10 μM) 2 Upstream primer HMBS-F (10 μM) 0.5 Downstream primer HMBS-R (10 μM) 0.5 ROX 0.4 DNA / RNA 2 Enzyme-free water 1.8

[0188] Result judgment:

[0189] (1) The test is valid if the quality control standard meets the following three conditions at the same time. Otherwise, the test is considered invalid:

[0190] ① The negative control should have no BVDV target melting curve;

[0191] ② The positive control showed a typical BVDV target melting curve (BVDV melting temperature was 85.9±0.3℃) (see Appendix A);

[0192] ③ The negative control should have no HMBS target melting curve.

[0193] (2) The test results are judged based on whether a typical BVDV target melting curve or a typical HMBS target melting curve appears. The judgment is divided into:

[0194] (2-1) If the sample does not have the HMBS target melting curve, it indicates that there are inhibitory components in the reaction system or nucleic acid is lost. It is necessary to resample, extract or further purify the nucleic acid before retesting.

[0195] (2-2) When the sample shows a typical HMBS target melting curve (HMBS melting temperature is 80.1±0.3℃) (see Appendix B), the test results shall be judged based on whether a typical BVDV target melting curve appears:

[0196] ① There is no BVDV target melting curve, indicating that there is no BVDV nucleic acid in the sample, which is judged as negative;

[0197] ② The appearance of a typical BVDV target melting curve indicates the presence of BVDV nucleic acid in the sample, which is judged as positive.

[0198] Example 3

[0199] Two-step TaqMan probe kit for detecting BVDV nucleic acid, including:

[0200] (1) Kit control

[0201] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-1 Oregon C24V strain, 500,000 copies / uL.

[0202] HMBS recombinant plasmid: a recombinant plasmid containing the target fragment of the HMBS internal reference gene, 500,000 copies / uL.

[0203] Negative control: spleen tissue suspension from an animal known to be negative for BVDV and HMBS.

[0204] (2) cDNA synthesis system

[0205] RT Master Mix is ​​a product of Dalian Bao Biotechnology Co., Ltd.

[0206] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0207] (3) TaqMan fluorescent PCR reaction system

[0208] Ex Taq enzyme and ROX are both products of Dalian Bao Biotechnology Co., Ltd.

[0209] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0210] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′;

[0211] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′;

[0212] TaqMan probe BVDV-P: 5′-FAM-CCCYGAGTACRGGGDAGTCGTCARTGGT-BHQ1-3′.

[0213] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′;

[0214] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′;

[0215] TaqMan probe HMBS-P: 5′-VIC-CCGAGCCAAGGACCAGGACATCC-BHQ1-3′.

[0216] Refer to the instructions of the nucleic acid extraction or purification kit for operation. For each non-porcine sample (400uL), 10uL of HMBS recombinant plasmid must be added during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0217] The cDNA synthesis reaction system was prepared according to Table 8. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0218] Table 8 Two-step TaqMan probe kit cDNA synthesis reaction system

[0219] Components Volume (μL) RT Master Mix 2 DNA / RNA 2 Enzyme-free water 6

[0220] The TaqMan fluorescent PCR reaction system was prepared according to Table 9. The optimized reaction conditions were: 95°C for 30 sec; 95°C for 5 s, 60°C for 34 s (collecting fluorescent signals), and 45 cycles.

[0221] Table 9 Two-step TaqMan probe kit fluorescent PCR reaction system

[0222] Components Volume (μL) Ex Taq enzyme 10 Upstream primer BVDV-F (10 μM) 1.6 Downstream primer BVDV-R (10 μM) 1.6 TaqMan probe BVDV-P (10 μM) 0.8 Upstream primer HMBS-F (10 μM) 0.4 Downstream primer HMBS-R (10 μM) 0.4 TaqMan probe HMBS-P (10 μM) 0.2 ROX 0.2 cDNA 2 Enzyme-free water 2.8

[0223] Result determination: Same as Example 1.

[0224] Example 4

[0225] Two-step SYBR Green I kit for detecting BVDV nucleic acid, including:

[0226] (1) Kit control

[0227] BVDV recombinant plasmid positive control: a recombinant plasmid containing the target fragment of the 5′-UTR gene of the BVDV-2SH-28 strain, 400,000 copies / uL.

[0228] HMBS recombinant plasmid: a recombinant plasmid containing the target fragment of the HMBS internal reference gene, 10,000 copies / uL.

[0229] Negative control: cell culture medium known to be BVDV negative and HMBS negative.

[0230] (2) cDNA synthesis system

[0231] RT Master Mix is ​​a product of Dalian Bao Biotechnology Co., Ltd.

[0232] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0233] (3) SYBR fluorescent PCR reaction system

[0234] Ex TaqⅡ enzyme and ROX are both products of Dalian Bao Biotechnology Co., Ltd.

[0235] Enzyme-free water: Add diethyl pyrocarbonate (DEPC) to deionized water to a final concentration of 0.1% (volume fraction), mix thoroughly and allow to react for 12 hours, divide into portions, sterilize at 121°C under high pressure for 30 minutes, cool and refrigerate for later use.

[0236] Upstream primer BVDV-F: 5′-CGAAGGCCGAAANGAGGYT-3′.

[0237] Downstream primer BVDV-R: 5′-CCTCGTCCACRTGGCATCTC-3′.

[0238] Upstream primer HMBS-F: 5′-GCCCTGGGCGTGGAA-3′.

[0239] Downstream primer HMBS-R: 5′-TCATGTAACACACCCACCAGATC-3′.

[0240] Refer to the instructions of the nucleic acid extraction or purification kit for operation. Each non-porcine sample (200-400uL) needs to be added with 5-20uL HMBS recombinant plasmid during nucleic acid extraction before nucleic acid extraction. For porcine samples, it is not necessary to add HMBS recombinant plasmid and nucleic acid extraction can be performed directly.

[0241] The cDNA synthesis reaction system was prepared according to Table 10. The reaction conditions were: 37°C for 15 min; 85°C for 5 sec.

[0242] Table 10 Two-step SYBR Green I kit cDNA synthesis reaction system

[0243] Components Volume (μL) RT Master Mix 2 DNA / RNA 2 Enzyme-free water 6

[0244] The SYBR fluorescent PCR reaction system was prepared according to Table 11. The optimized reaction conditions were: 95°C for 30 seconds; 95°C for 5 seconds, 60°C for 34 seconds (collecting fluorescent signals), 40 cycles; melting curve acquisition program (set according to the melting curve acquisition program of different qPCR instruments). The melting temperature of BVDV was 85.9±0.3°C, and the melting temperature of HMBS was 80.1±0.3°C.

[0245] Table 11 Two-step SYBR Green I kit fluorescent PCR reaction system

[0246] Components Volume (μL) Ex TaqⅡ enzyme 10 Upstream primer BVDV-F (10 μM) 1 Downstream primer BVDV-R (10 μM) 1 Upstream primer HMBS-F (10 μM) 0.25 Downstream primer HMBS-R (10 μM) 0.25 ROX 0.4 cDNA 2 Enzyme-free water 5.1

[0247] Result determination: Same as Example 2.

[0248] Application Example 1

[0249] A comparative test was conducted between the one-step TaqMan probe method kit prepared in Example 1 and an existing fluorescent quantitative RT-PCR kit (CN102268488B) for detecting BVDV nucleic acid.

[0250] 1. Viral nucleic acid extraction

[0251] BVDV-1AV69 strain virus liquid 10 3.5 FAID 50 / 0.1mL (standard sample 1), diluted to 10 2.5 FAID 50 / 0.1mL(standard sample 2),10 1.5 FAID 50 / 0.1mL(standard sample 3),10 0.5 FAID 50 / 0.1mL(standard sample 4),10 - 0.5 FAID 50 / 0.1mL(standard sample 5),10 -1.5 FAID 50 / 0.1mL (standard sample 6), take 400μL respectively (using the kit of Example 1 to add HMBS recombinant plasmid during nucleic acid extraction);

[0252] Take 400 μL of each of the positive control and negative control in Example 1;

[0253] Take 10% of the CSFV Thiverval strain virus liquid 4.5 FAID 50 / 0.1mL (virus control 1), 10 2.5 FAID 50 / 0.1mL (virus control 2), take 400μL respectively (using the kit of Example 1 to add HMBS recombinant plasmid during nucleic acid extraction);

[0254] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0255] 2RT-PCR amplification

[0256] The obtained nucleic acid was amplified by RT-PCR according to the kit of Example 1 and the existing patented kit.

[0257] 3 Results

[0258] 3.1 Quality control standard test results

[0259] The quality control standard test of the kit in Example 1 of the present invention also meets the conditions described in Example 1, so the test of the kit in Example 1 is effective.

[0260] The quality control standard test results of the existing patented test kit showed that the amplification result of standard sample 1 (BVDV-1AV69 strain virus liquid) was positive, and no amplification curve was observed in the negative control, so the existing patented test kit is valid.

[0261] 3.2 Comparison of sensitivity of BVDV-1AV69 strain virus liquid detection

[0262] The results showed that the BVDV-1AV69 strain virus liquid and the CSFV Thiverval strain virus liquid were serially diluted.

[0263] (1) In the kit of Example 1 of the present invention, the Ct values ​​of standard sample 1, standard sample 2, standard sample 3, standard sample 4, standard sample 5, standard sample 6, virus control 1, and virus control 2 in the VIC channel (HMBS detection) are ≤35, and a typical HMBS amplification curve appears, indicating that the nucleic acid extraction, reverse transcription, and amplification effects of the above samples are good.

[0264] (2) The minimum detection limit of the FAM channel (BVDV detection) of the kit of Example 1 of the present invention for BVDV-1AV69 strain virus liquid is 10 -1.5 FAID 50 / 0.1mL, which is lower than the minimum detection limit of the existing patented kit (10 -0.5 FAID 50 / 0.1mL), see Figure 1 and Figure 2 ; This shows that the sensitivity of the kit in Example 1 is higher than that of the existing patented kit.

[0265] 3.3 Construction and comparison of standard curves for BVDV-1AV69 strain virus fluid detection

[0266] The kit of Example 1 of the present invention and the existing patented kit were used for detection, and the amplification standard curves of the BVDV-1AV69 strain virus liquid were constructed respectively ( Figure 3 and Figure 4 ). The results showed that the kit of Example 1 was -1.5 FAID 50 / 0.1mL~10 3.5 FAID 50 / 0.1mL virus titer showed a good linear relationship, and its correlation coefficient (R 2 ) is 0.995, the amplification efficiency is 104.925, and the standard curve is: y = -3.209x + 36.756; the standard curve of the existing patented kit is 10 -0.5 FAID 50 / 0.1mL~10 3.5 FAID 50 / 0.1mL virus titer showed a good linear relationship, and its correlation coefficient (R 2 ) is 0.998, the amplification efficiency is 99.83, and the standard curve is: y=-3.326x+39.019, which indicates that the standard curve has good linearity and high credibility.

[0267] 3.4 BVDV-3 recombinant plasmid detection results

[0268] The results of the BVDV-3 recombinant plasmid template detection showed that the Ct value of the positive control (BVDV-3 recombinant plasmid) in the FAM channel (BVDV detection) of the kit in Example 1 of the present invention was ≤35, and a typical BVDV amplification curve appeared; while the existing patented kit could not detect the positive control (BVDV-3 recombinant plasmid). This shows that the kit of the present invention can detect BVDV-3, while the existing patented kit cannot detect BVDV-3.

[0269] Application Example 2

[0270] The fluorescent quantitative RT-PCR primer pair for detecting BVDV nucleic acid of the present invention was compared with the existing fluorescent quantitative RT-PCR primer pair for detecting BVDV nucleic acid (CN103397107B).

[0271] 1. Viral nucleic acid extraction

[0272] The BVDV virus liquid positive control (10 3.5 FAID 50 / 0.1mL), diluted to 10 2.5 FAID 50 / 0.1mL(standard sample 2),10 1.5 FAID 50 / 0.1mL(standard sample 3),10 0.5 FAID 50 / 0.1mL(standard sample 4),10 -0.5 FAID 50 / 0.1mL(standard sample 5),10 -1.5 FAID 50 / 0.1mL(standard sample 6),10 -2.5 FAID 50 / 0.1mL (standard sample 7), take 400μL respectively (using the kit of Example 2 to add HMBS recombinant plasmid during nucleic acid extraction);

[0273] Take 400 μL of the negative control in Example 2;

[0274] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL (using the kit of Example 2 to add HMBS recombinant plasmid during nucleic acid extraction) as a virus control;

[0275] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0276] 2RT-PCR amplification

[0277] The primer pairs of the present invention are used according to the one-step SYBR Green I method kit in Example 2, and the obtained nucleic acid is subjected to RT-PCR amplification. The existing patented primer pairs are used according to the Dalian Bao Biotechnology Company One Step TB PrimeScript TM RT-PCR Kit, and perform RT-PCR amplification on the obtained nucleic acid.

[0278] 3 Results

[0279] 3.1 Quality control standard test results

[0280] The quality control standard tests of the kit of the present invention all meet the three conditions described in Example 2 at the same time, so the test of the present invention is effective.

[0281] The quality control standard test results of the kit using the existing patented primers showed that the positive control test of the BVDV virus liquid was positive, and the negative control test was negative, so the existing patented primers were effective in the kit test.

[0282] 3.2 Sensitivity test results

[0283] The sensitivity of the BVDV-1AV69 strain was tested by serial dilution. The results showed that

[0284] (1) The standard samples 2, 3, 4, 5, 6, 7 and virus control of the kit of the present invention all showed typical HMBS target melting curves (HMBS melting temperature was 80.1±0.3°C), indicating that the nucleic acid extraction, reverse transcription and amplification effects of the above standard samples and virus control were good. The standard samples 2, 3, 4, 5 and 6 of the kit of the present invention all showed typical BVDV target melting curves (BVDV melting temperature was 85.9±0.3°C), while the standard sample 7 and virus control had no BVDV target melting curves, indicating that the minimum detection limit of the kit of Example 2 prepared by the primer pair of the present invention was 10 -1.5 FAID 50 / 0.1mL, and can distinguish between BVDV nucleic acid and CSFV nucleic acid.

[0285] (2) The existing patented primer pair kit standard sample 2 and standard sample 3 were positive, while standard sample 4, standard sample 5, standard sample 6, standard sample 7, and virus control were negative, indicating that the minimum detection limit of the existing patented primer pair is 10 1.5 FAID 50 / 0.1mL, and can distinguish between BVDV nucleic acid and CSFV nucleic acid.

[0286] These indicate that the sensitivity of the kit of Example 2 prepared by the primer pair of the present invention is higher than that of the existing patented primer pair.

[0287] Application Example 3

[0288] The purpose of this experiment is to study the sensitivity, linear relationship and amplification efficiency of the primer pairs and probe sets of the present invention in detecting "BVDV-1 and HMBS gene", "BVDV-2 and HMBS gene" and "BVDV-3 and HMBS gene".

[0289] 1. Viral nucleic acid extraction

[0290] Take 400 μL of the positive control and 400 μL of the negative control in Example 3;

[0291] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as virus control (HMBS recombinant plasmid was added during nucleic acid extraction);

[0292] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0293] 2RT-PCR amplification

[0294] 2.1 Sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention for detecting "BVDV-1 and HMBS gene"

[0295] The BVDV-1Oregon C24V strain recombinant plasmid and the HMBS recombinant plasmid were mixed to prepare a series of standard samples (a to f), as shown in Table 12, and RT-PCR amplification was performed according to the two-step TaqMan probe method kit in Example 3, and positive controls, negative controls and virus controls were set up.

[0296] Table 12 Series of standard samples (BVDV-1 and HMBS genes)

[0297] Standard sample a Mixture of BVDV-1 recombinant plasmid 100 000 copies / uL and HMBS recombinant plasmid 100 000 copies / uL Standard sample b Mixture of BVDV-1 recombinant plasmid 10 000 copies / uL and HMBS recombinant plasmid 10 000 copies / uL Standard sample c Mixture of BVDV-1 recombinant plasmid 1 000 copies / uL and HMBS recombinant plasmid 1 000 copies / uL Standard sample d Mixture of BVDV-1 recombinant plasmid 100 copies / uL and HMBS recombinant plasmid 100 copies / uL Standard sample Mixture of BVDV-1 recombinant plasmid 10 copies / uL and HMBS recombinant plasmid 10 copies / uL Standard sample f Mixture of BVDV-1 recombinant plasmid 1 copy / uL and HMBS recombinant plasmid 1 copy / uL

[0298] 2.2 Sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention for detecting "BVDV-2 and HMBS gene"

[0299] The BVDV-2SH-28 strain recombinant plasmid and the HMBS recombinant plasmid were mixed to prepare a series of standard samples (g to l), as shown in Table 13, and RT-PCR amplification was performed according to the two-step TaqMan probe method kit in Example 3, and positive controls, negative controls and virus controls were set up.

[0300] Table 13 Series of standard samples (BVDV-2 and HMBS genes)

[0301] Standard sample g Mixture of BVDV-2 recombinant plasmid 100 000 copies / uL and HMBS recombinant plasmid 100 000 copies / uL Standard sample h Mixture of BVDV-2 recombinant plasmid 10 000 copies / uL and HMBS recombinant plasmid 10 000 copies / uL Standard sample i Mixture of BVDV-2 recombinant plasmid 1 000 copies / uL and HMBS recombinant plasmid 1 000 copies / uL Standard sample Mixture of BVDV-2 recombinant plasmid 100 copies / uL and HMBS recombinant plasmid 100 copies / uL Standard sample k Mixture of BVDV-2 recombinant plasmid 10 copies / uL and HMBS recombinant plasmid 10 copies / uL Standard sample Mixture of BVDV-2 recombinant plasmid 1 copy / uL and HMBS recombinant plasmid 1 copy / uL

[0302] 2.3 Sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention in detecting “BVDV-3 and HMBS gene”

[0303] The BVDV-3Th / 04_KhonKaen strain recombinant plasmid and the HMBS recombinant plasmid were mixed to prepare a series of standard samples (m to r), as shown in Table 14, and RT-PCR amplification was performed according to the two-step TaqMan probe method kit in Example 3, and positive controls, negative controls and virus controls were set up.

[0304] Table 14 Series of standard samples (BVDV-3 and HMBS genes)

[0305] Standard sample m Mixture of BVDV-3 recombinant plasmid 100 000 copies / uL and HMBS recombinant plasmid 100 000 copies / uL Standard sample n Mixture of BVDV-3 recombinant plasmid 10 000 copies / uL and HMBS recombinant plasmid 10 000 copies / uL Standard sample Mixture of BVDV-3 recombinant plasmid 1 000 copies / uL and HMBS recombinant plasmid 1 000 copies / uL Standard sample p Mixture of BVDV-3 recombinant plasmid 100 copies / uL and HMBS recombinant plasmid 100 copies / uL Standard sample q Mixture of BVDV-3 recombinant plasmid 10 copies / uL and HMBS recombinant plasmid 10 copies / uL Standard sample r Mixture of BVDV-3 recombinant plasmid 1 copy / uL and HMBS recombinant plasmid 1 copy / uL

[0306] 3 Results

[0307] The quality control standard test of the kit in Example 3 of the present invention also meets the conditions described in Example 3, so the test of the kit in Example 3 is effective.

[0308] The virus control test results showed that the Ct value of the virus control in the VIC channel (HMBS detection) was ≤35 and a typical HMBS amplification curve appeared, indicating that the virus control nucleic acid extraction, reverse transcription and amplification effects were good; the FAM channel (BVDV detection) virus control had no Ct value and no BVDV amplification curve, indicating that the kit in Example 3 of the present invention can distinguish between BVDV nucleic acid and CSFV nucleic acid, with strong specificity.

[0309] 3.1 Results of sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention in detecting “BVDV-1 and HMBS gene”

[0310] The detection was performed on serially diluted BVDV-1 and HMBS recombinant plasmid templates (a to f). The sensitivity results showed that the minimum detection limit of the kit of Example 3 prepared by the primer pair and probe set of the present invention for the BVDV-1 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the HMBS recombinant plasmid template was 1 copy number / uL, see Figure 3 and Figure 4 The results of linear relationship and amplification efficiency showed that the kit of Example 3 prepared by the primer pair and probe set of the present invention exhibited a good linear relationship in the range of 1 copy number / uL to 100,000 copies / uL of BVDV-1 template copy number, and its correlation coefficient (R 2 ) was 0.998, the amplification efficiency was 99.735, and the standard curve was: y = -3.328x + 39.802; the HMBS template copy number showed a good linear relationship in the range of 1 copy number / uL to 100 000 copies / uL, and the correlation coefficient (R 2 ) is 0.997, the amplification efficiency is 105.886, and the standard curve is: y=-3.188x+38.889. These indicate that the standard curve of the primer pair and probe set of the present invention for detecting "BVDV-1 and HMBS gene" has good linearity and high credibility.

[0311] 3.2 Results of sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention in detecting "BVDV-2 and HMBS gene"

[0312] The detection was performed on serially diluted BVDV-2 and HMBS recombinant plasmid templates (g to l). The sensitivity results showed that the minimum detection limit of the kit of Example 3 prepared by the primer pair and probe set of the present invention for the BVDV-2 recombinant plasmid template was 1 copy number / uL, and the minimum detection limit for the HMBS recombinant plasmid template was 1 copy number / uL, see Figure 5and Figure 6 The results of linear relationship and amplification efficiency showed that the kit of Example 3 prepared by the primer pair and probe set of the present invention exhibited a good linear relationship in the range of 1 copy number / uL to 100,000 copies / uL of BVDV-2 template copy number, and its correlation coefficient (R 2 ) was 0.998, the amplification efficiency was 93.812, and the standard curve was: y = -3.48x + 40.075; the HMBS template copy number showed a good linear relationship in the range of 1 copy number / uL to 100 000 copies / uL, and the correlation coefficient (R 2 ) is 0.999, the amplification efficiency is 95.641, and the standard curve is: y=-3.431x+38.42. These indicate that the standard curve of the primer pair and probe set of the present invention for detecting "BVDV-2 and HMBS gene" has good linearity and high credibility.

[0313] 3.3 Results of sensitivity, linear relationship and amplification efficiency of the primer pair and probe set of the present invention in detecting “BVDV-3 and HMBS gene”

[0314] The detection was performed on serially diluted BVDV-3 and HMBS recombinant plasmid templates (m to r). The sensitivity results showed that the minimum detection limit of the kit of Example 3 prepared by the primer pair and probe set of the present invention for the BVDV-3 recombinant plasmid template was 10 copies / uL, and the minimum detection limit for the HMBS recombinant plasmid template was 1 copy / uL, see Figure 7 and Figure 8 The results of linear relationship and amplification efficiency showed that the kit of Example 3 prepared by the primer pair and probe set of the present invention exhibited a good linear relationship in the range of 10 copies / uL to 100,000 copies / uL BVDV-3 template copies, and the correlation coefficient (R 2 ) was 0.998, the amplification efficiency was 99.223, and the standard curve was: y = -3.341x + 46.552; the HMBS template copy number showed a good linear relationship in the range of 1 copy number / uL to 100 000 copies / uL, and the correlation coefficient (R 2 ) is 0.996, the amplification efficiency is 105.403, and the standard curve is: y=-3.199x+39.953. These indicate that the standard curve of the primer pair and probe set of the present invention for detecting "BVDV-3 and HMBS gene" has good linearity and high credibility.

[0315] Application Example 4

[0316] A comparison test was conducted between the two-step SYBR Green I method kit for detecting BVDV nucleic acid of the present invention and an existing patented kit (CN103725796B) for detecting BVDV nucleic acid.

[0317] 1. Viral nucleic acid extraction

[0318] Take 400 μL of the BVDV recombinant plasmid positive control and negative control in Example 4 respectively;

[0319] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL (using the kit of Example 4 to add HMBS recombinant plasmid during nucleic acid extraction) as a virus control;

[0320] The recombinant plasmid (100,000 copies) containing the target fragment of the 5′-UTR gene (genomic position: 1-385 nt) of the BVDV-3Th / 04_KhonKaen strain (GenBank accession number: NC_012812.1) was cloned into

[0321] / uL), respectively diluted to 10 000 copies / uL (standard sample b), 1 000 copies / uL (standard sample c), 100 copies / uL (standard sample d), 10 copies / uL (standard sample e), 1 copy / uL (standard sample f), and 400 μL was taken from each (the HMBS recombinant plasmid was added during nucleic acid extraction using the kit of Example 4);

[0322] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0323] 2RT-PCR amplification

[0324] RT-PCR amplification was performed according to the two-step SYBR Green I method kit of the present invention and the existing patented kit method, respectively, as follows:

[0325] (1) Positive control and negative control were set up according to the method described in the kit of Example 4, and standard sample b, standard sample c, standard sample d, standard sample e, standard sample f, and virus control were tested at the same time.

[0326] (2) According to the method described in the existing patented kit, BVDVI positive plasmid, BVDVII positive plasmid, GAPDH positive plasmid and negative control were established, and standard sample b, standard sample c, standard sample d, standard sample e, standard sample f and virus control were tested at the same time.

[0327] 3 Results

[0328] 3.1 Quality control standard test results

[0329] The quality control standard detection of the two-step SYBR Green I method kit of the present invention all meets the three conditions described in Example 4 at the same time, so the test of the present invention is effective.

[0330] The quality control standard test results of the kit using the existing patented primers showed that the BVDVI-positive plasmid, the BVDV II-positive plasmid and the GAPDH-positive plasmid could obtain the target melting curve, and the negative control had no amplified melting curve, so the existing patented kit test was effective.

[0331] 3.2 Sensitivity test results

[0332] The sensitivity of the BVDV-3 recombinant plasmid template was tested by serial dilution. The results showed that

[0333] (1) The standard samples b, c, d, e, f and virus control of the two-step SYBR Green I method kit of the present invention all showed typical HMBS target melting curves (HMBS melting temperature was 80.1±0.3°C), indicating that the nucleic acid extraction, reverse transcription and amplification effects of the above standard samples and virus control were good. The standard samples b, c, d and e of the two-step SYBR Green I method kit of the present invention all showed typical BVDV target melting curves (BVDV melting temperature was 85.9±0.3°C), while the standard sample f and virus control had no BVDV target melting curves, indicating that the minimum detection limit of the two-step SYBR Green I method kit of the present invention for the BVDV-3 recombinant plasmid template was 10 copies / uL, and BVDV nucleic acid and CSFV nucleic acid could be distinguished.

[0334] (2) The existing patented primer pair kit detected that standard samples b, standard sample c, standard sample d, and standard sample e were positive for BVDVI, while standard sample f and virus control had no BVDV target melting curve, indicating that the existing patented primer pair kit can distinguish between BVDV nucleic acid and CSFV nucleic acid, but will misdetect BVDV-3 and appear a "false positive" for BVDV-1.

[0335] Application Example 5

[0336] A comparison test was conducted between the one-step TaqMan probe method kit for detecting BVDV nucleic acid prepared in Example 1 and an existing fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid (CN112430686B).

[0337] 1 Sample

[0338] 1.1 Porcine samples

[0339] 300 mg each of kidney (a1), spleen (b1), mesenteric lymph node (C1), inguinal lymph node (d1), and lung (e1) of suckling piglets were taken, and 300 mg each of kidney (a2), spleen (b2), mesenteric lymph node (C2), inguinal lymph node (d2), and lung (e2) of nursery pigs were taken, and 10% tissue homogenate was made respectively. After repeated freezing and thawing for 3 times, the supernatant was centrifuged and used for later use.

[0340] 1.2 Non-porcine samples

[0341] 300 mg of the feces sample (f1) of the growing cattle was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of peripheral blood leukocytes (g1) of the growing cattle were collected, and 2.0 mL of PBS was added to the nasal swab (h1) of the growing cattle, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0342] 300 mg of adult bovine feces sample (f2) was prepared into 10% homogenate, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use. 2.0 mL of adult bovine blood was collected to separate bovine peripheral blood leukocytes (g2), and 2.0 mL of adult bovine nasal swab (h2) was placed in 2.0 mL of PBS, and the mixture was frozen and thawed three times before centrifugation to obtain the supernatant for later use.

[0343] 300 mg of the fecal sample (I1) of the growing sheep was prepared into a 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J1) was collected from the blood of the growing sheep, and 2.0 mL of PBS was added to the nasal swab (K1) of the growing sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0344] 300 mg of adult sheep feces sample (I2) was prepared into 10% homogenate, and the supernatant was centrifuged after repeated freezing and thawing for 3 times. 2.0 mL of bovine peripheral blood leukocytes (J2) was collected from adult sheep blood, and 2.0 mL of PBS was added to the nasal swab (K2) of adult sheep, and the supernatant was centrifuged after repeated freezing and thawing for 3 times.

[0345] 2. Viral nucleic acid extraction

[0346] 400 μL of the positive control and 400 μL of the negative control in Example 1 were taken respectively;

[0347] Another virus titer of 10 2.5 FAID 50 / 0.1mL of CSFV Thiverval strain 400μL, as a virus control (using the kit of Example 1 to add HMBS recombinant plasmid during nucleic acid extraction);

[0348] Porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2;

[0349] Non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2 (non-porcine samples need to be added with HMBS recombinant plasmid when nucleic acid is extracted using the kit of Example 1);

[0350] Nucleic acid was extracted using an animal virus DNA / RNA rapid extraction kit (Xi'an Tianlong Technology Co., Ltd.) and an NP968-S fully automatic nucleic acid extractor (Xi'an Tianlong Technology Co., Ltd.).

[0351] 2RT-PCR amplification

[0352] The obtained nucleic acid was amplified by RT-PCR according to the kit of Example 1 and the existing patented kit.

[0353] 3 Results

[0354] 3.1 Quality control standard test results

[0355] The one-step TaqMan probe method kit for detecting BVDV nucleic acid prepared in Example 1 has a quality control standard that simultaneously meets the three conditions described in Example 1, so the kit test in Example 1 is effective.

[0356] The quality control standard test results of the existing patented test kit show that the positive control amplification results of mixed plasmids of the same concentration of BVDV-1, BVDV-2, and BVDV-3 are all positive, and no amplification curve is observed in the negative control, so the existing patented test kit is valid.

[0357] 3.2 Sample test results

[0358] The results of the sample detection by the kit in Example 1 showed that (1) the Ct values ​​of the porcine samples a1, b1, C1, d1, and e1 in the VIC channel (HMBS detection) were ≤35, and a typical HMBS amplification curve appeared, indicating that the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription, and amplification of the porcine samples a1, b1, C1, d1, and e1 were good; the Ct values ​​of the non-porcine samples (f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, and K2) in the VIC channel (HMBS detection) were ≤35, and a typical HMBS amplification curve appeared. A typical HMBS amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of non-porcine samples were good; in the FAM channel (BVDV detection), samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, and K2 had no Ct value and no BVDV amplification curve, indicating that samples a1, b1, C1, d1, e1, f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, and K2 did not contain BVDV nucleic acid and were judged to be negative. (2) In the VIC channel (HMBS detection), there were no Ct values ​​and no HMBS amplification curves for the porcine samples a2, b2, C2, d2, and e2, indicating that there were inhibitory components or nucleic acid loss in the reaction system for the porcine samples a2, b2, C2, d2, and e2, and there was a risk of "false negative". In the FAM channel (BVDV detection), there were no Ct values ​​and no BVDV amplification curves for the porcine samples a2, b2, C2, d2, and e2, but because there were no Ct values ​​and no HMBS amplification curves for the VIC channel (HMBS detection), the porcine samples a2, b2, C2, d2, and e2 needed to be resampled, extracted, or the nucleic acid further purified before retesting. (3) The Ct value of the virus control in the VIC channel (HMBS detection) was ≤35 and a typical HMBS amplification curve appeared, indicating that the nucleic acid extraction, reverse transcription and amplification of the virus control were good; the virus control in the FAM channel (BVDV detection) had no Ct value and no BVDV amplification curve, indicating that there was no BVDV nucleic acid in the virus control, and it was judged to be BVDV nucleic acid negative.

[0359] The results of the samples tested by the existing patented kit showed that (1) no amplification curves were observed for porcine samples a1, b1, C1, d1, e1, a2, b2, C2, d2, e2 and non-porcine samples f1, g1, h1, f2, g2, h2, I1, J1, K1, I2, J2, K2, and they were judged as negative. (2) The virus control in the ROX channel (BVDV-3 test) produced an amplification curve, and the amplification result was positive, indicating that the existing patented kit would misdetect CSFV and may produce "false positives" when testing porcine samples.

[0360] 4 Discussion

[0361] Because there is a possibility of "false negative" in the process of sample collection, transportation, processing, nucleic acid extraction, reverse transcription, amplification reaction, etc., in order to avoid the occurrence of "false negative", the kit of Example 1 of the present invention has a primer pair for amplifying the internal reference gene HMBS, a TaqMan probe sequence for detecting the HMBS amplification product, and an HMBS recombinant plasmid. Therefore, (1) when detecting porcine samples, Example 1 of the present invention can monitor the sampling, transportation, sample processing, nucleic acid extraction, reverse transcription and amplification effects, such as: monitoring whether epithelial cells are collected, monitoring whether a sufficient amount of sample cells are collected, and monitoring the accuracy of the entire experimental operation process such as sampling, extraction, amplification detection. In this experiment, the VIC channel (HMBS detection) porcine samples a2, b2, C2, d2, and e2 have no Ct value and no HMBS amplification curve, indicating that the porcine samples a2, b2, C2, d2, and e2 have the risk of causing "false negative" and need to be re-sampled, extracted, or further purified nucleic acid before re-testing, while the existing patented kit cannot monitor the sampling, transportation, and sample processing process. (2) When testing non-porcine samples, the nucleic acid extraction, reverse transcription and amplification effects of each sample can be monitored, which cannot be monitored using existing patented kits.

[0362] In addition, the samples to be tested by the existing patented kit are bovine nasal swabs and fecal samples. If the samples of pig origin are tested, the CSFV that may exist in the pig origin samples may cause the existing patented kit to misdetect, and a "false positive" may occur. The one-step TaqMan probe method kit for detecting BVDV nucleic acid prepared in Example 1 of the present invention detects the virus control CSFV nucleic acid as negative, and has better specificity.

[0363] Appendix ABVDV nucleic acid negative and positive typical amplification curves / target melting curve diagram

[0364] BVDV nucleic acid fluorescence quantitative RT-PCR detection, negative control and positive control typical BVDV amplification curve / target melting curve diagram is shown in Fig. 9 .

[0365] Appendix B HMBS nucleic acid negative and positive typical amplification curve / target melting curve diagram

[0366] HMBS nucleic acid fluorescence quantitative RT-PCR detection, HMBS nucleic acid negative and positive typical amplification curve / target melting curve diagram is shown in Fig.10 .

Claims

1. A fluorescent quantitative RT-PCR primer pair and probe set for BVDV nucleic acid detection based on the internal reference gene HMBS, characterized in that: It includes: 1) Primer pair for amplifying BVDV 5´-UTR, the sequence is as follows: Upstream primer BVDV-F: 5´- CGAAGGCCGAAANGAGGYT -3´; Downstream primer BVDV-R: 5´- CCTCGTCCACRTGGCATCTC -3´; 2) TaqMan probe for detecting the amplified product of BVDV 5´-UTR, the sequence is as follows: BVDV-P: 5´- FAM-CCCYGAGTACRGGGDAGTCGTCARTGGT-BHQ1 -3´; 3) The primer pair for amplifying the porcine internal reference gene HMBS has the following sequence: Upstream primer HMBS-F: 5´- GCCCTGGGCGTGGAA -3´; Downstream primer HMBS-R: 5´- TCATGTAACACACCCACCAGATC -3´; 4) TaqMan probe for detecting the amplified product of the porcine internal reference gene HMBS, the sequence is as follows: HMBS-P: 5´-VIC-CCGAGCCAAGGACCAGGACATCC-BHQ1-3´.

2. A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS, characterized in that: The method comprises the upstream primer BVDV-F, the downstream primer BVDV-R, the upstream primer HMBS-F and the downstream primer HMBS-R according to claim 1.

3. A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 2, characterized in that: The fluorescent quantitative RT-PCR kit is a one-step TaqMan probe method kit, a one-step SYBR Green I method kit, a two-step TaqMan probe method kit or a two-step SYBR Green I method kit.

4. A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 3, characterized in that: The one-step TaqMan probe method kit includes at least the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-qPCR Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, and enzyme-free water.

5. The fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 3, characterized in that: The one-step SYBR Green I method kit at least includes the following components: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control, RT-PCR Buffer, TaqHS, RT enzyme Mix, ROX, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, and enzyme-free water.

6. A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 3, characterized in that: The two-step TaqMan probe method kit comprises at least the following components: Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control; cDNA synthesis system: RT Master Mix and enzyme-free water; TaqMan fluorescent PCR reaction system: Ex Taq enzyme, upstream primer BVDV-F, downstream primer BVDV-R, TaqMan probe BVDV-P, upstream primer HMBS-F, downstream primer HMBS-R, TaqMan probe HMBS-P, ROX, enzyme-free water.

7. The fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 3, characterized in that: The two-step SYBR Green I method kit comprises at least the following components: Kit controls: BVDV virus liquid positive control or BVDV recombinant plasmid positive control, HMBS recombinant plasmid, negative control; cDNA synthesis system: RT Master Mix and enzyme-free water; SYBR fluorescent PCR reaction system: Ex Taq Ⅱ enzyme, upstream primer BVDV-F, downstream primer BVDV-R, upstream primer HMBS-F, downstream primer HMBS-R, ROX, enzyme-free water.

8. A fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 3, characterized in that: The BVDV virus liquid positive control is BVDV virus liquid; The BVDV recombinant plasmid positive control is a recombinant plasmid containing the BVDV 5´-UTR gene target fragment; The HMBS recombinant plasmid is a recombinant plasmid containing the internal reference gene HMBS target fragment; The negative control is enzyme-free water, a cell culture fluid known to be BVDV negative and HMBS negative, or an animal tissue suspension known to be BVDV negative and HMBS negative.

9. The fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 8, characterized in that: The BVDV virus liquid positive control is a BVDV-1 AV69 strain MDBK cell passage product, and its virus titer is 10 2.5 FAID 50 / 0.1mL to 10 6.5 FAID 50 / 0.1mL; The concentration of the BVDV recombinant plasmid positive control is 10,000 copies / uL to 500,000 copies / uL; The concentration of the HMBS recombinant plasmid is 10,000 copies / uL to 500,000 copies / uL.

10. The fluorescent quantitative RT-PCR kit for detecting BVDV nucleic acid based on the internal reference gene HMBS according to claim 8, characterized in that: The BVDV recombinant plasmid positive control is a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-1 Oregon C24V strain, a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-2 SH-28 strain, or a recombinant plasmid containing the target gene fragment of the 5'-UTR of the BVDV-3 Th / 04_KhonKaen strain.

Images