Multi-antibody connection capture immunoassay method

Abstract

The invention relates to a protein detection method, and particularly relates to a method which comprises the following steps: introducing magnetic beads so as to capture an antibody with a target protein structure, forming a three-antibody sandwich protein-magnetic bead compound, and detecting the compound so as to obtain a detection result of the target protein. The method is good in stability, high in sensitivity, high in efficiency, low in background signal and simple in operation step.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a multi-antibody connection capture immunoassay method. Background Art

[0002] In the field of medical clinical testing, the detection of protein markers has always played a vital role. Traditional immunoassay techniques, including Western Blot, Flow Cytometry, ELISA and Chemiluminescence ImmuNOassay, have become the core pillars of in vitro diagnostic (IVD) immunodiagnostic technology. These technologies not only provide important basis for early diagnosis, treatment monitoring and prognosis evaluation of diseases, but also with the rapid development of medical technology, the demand for protein marker detection is also growing.

[0003] However, existing immunoassay technology still has certain limitations when it comes to detecting low-abundance proteins. Low-abundance proteins are often present in very low levels in biological samples and are difficult to accurately capture using conventional detection methods. This not only limits in-depth research on certain diseases, but also affects the accuracy and timeliness of clinical diagnosis. Therefore, the need for ultra-sensitive detection technology has become particularly urgent.

[0004] The NULISA technology (Nucleic acid Linked ImmuNO-Sandwich Assay) developed by Alamar Biosciences improves the sensitivity of traditional proximity ligation detection through a dual capture and release mechanism, reduces background signals, and meets the requirements of ultrasensitive detection. By using uncoupled antibodies and next-generation sequencing of barcode reporter DNA, highly multiplexed quantification of low-abundance and high-abundance proteins across a wide dynamic range is achieved. This technology also has some limitations. The NULISA technology involves multiple steps, including the formation of immune complexes, capture, washing, release, recapture, and connection of DNA chains, which increases the complexity of the operation. At the same time, experimental tests have shown that the dual magnetic bead system involved in the NULISA technology has a relatively low reaction efficiency, especially the dT magnetic beads in the first step, the adsorption and elution efficiencies are relatively low, and the precision is difficult to control, and the stability of the results is relatively poor.

[0005] Therefore, there is an urgent need in the art for a protein detection method that is simple to operate, low in cost, has low background signals, high in sensitivity, and can be used for multiple detections. Summary of the invention

[0006] The purpose of the present invention is to provide a protein detection method with simple operation, low cost, low background signal, high sensitivity and multiple detection capability.

[0007] In a first aspect, the present invention provides a protein detection method, comprising the steps of:

[0008] (s0) providing a sample to be tested, a micromagnetic particle, a second antibody, a third antibody, a ligase, a first connection element, and a second connection element, wherein the micromagnetic particle is coupled with a first antibody or the micromagnetic particle (not coupled with a first antibody) can form a first antibody-micromagnetic particle conjugate after contacting with the first antibody, the second antibody is coupled with a second nucleic acid element (second antibody-nucleic acid conjugate), and the third antibody is coupled with a third nucleic acid element (third antibody-nucleic acid conjugate);

[0009] (s1) mixing the sample to be tested with the first antibody, the second antibody, the third antibody and the micromagnetic particles, so that the second antibody, the third antibody and the micromagnetic particles bind to the target protein in the sample to be tested to form a three-antibody sandwich protein-micromagnetic particle complex, and separating the three-antibody sandwich protein-micromagnetic particle complex;

[0010] (s2) mixing the three-antibody sandwich protein-micromagnetic particle complex with a ligase and a first connecting element, so that the ends of the second nucleic acid element and the third nucleic acid element are complementary to the bases of the first connecting element to form a double-stranded structure;

[0011] There is a gap of ≤1 nt between the second nucleic acid element and the third nucleic acid element;

[0012] The gaps are connected under the action of a ligase to form an amplification template; and

[0013] (s3) performing a nucleic acid amplification reaction on the amplification template to obtain a protein detection result.

[0014] In another preferred embodiment, the micromagnetic particles that are not coupled to the first antibody are coupled to the first antibody in step (s1) to form a first antibody-micromagnetic particle conjugate.

[0015] In another preferred embodiment, in step (s1), the amount of the micromagnetic particles is 1 to 20 μL, preferably 1 to 10 μL, for example, about 5 μL.

[0016] In another preferred embodiment, the first antibody is coupled to a first nucleic acid element, the first nucleic acid element is labeled with biotin, and the micromagnetic particle is modified with avidin.

[0017] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, preferably 10 to 25 nucleotides, and more preferably 10 to 20 nucleotides.

[0018] In another preferred embodiment, the length of the second nucleic acid element and the third nucleic acid element is independently 40 to 100 nucleotides, preferably 40 to 90 nucleotides, and more preferably 40 to 80 nucleotides.

[0019] In another preferred embodiment, the length of the first linking element is 15 to 40 nucleotides, preferably 20 to 35 nucleotides, and more preferably 23 to 30 nucleotides.

[0020] In another preferred embodiment, the second nucleic acid element has a structure shown in formula (I):

[0021] Z1-Z2(I)

[0022] Wherein, Z1 is 35 to 95 nucleotides;

[0023] Z2 is 5 to 15 nucleotides;

[0024] The third nucleic acid element has a structure shown in formula (II):

[0025] X1-X2(II)

[0026] Wherein, X1 is 5 to 15 nucleotides;

[0027] X2 is 35 to 95 nucleotides;

[0028] The first connecting element has a structure shown in formula (III):

[0029] L1-X1'-Z2'-L2(III)

[0030] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0031] X1' is complementary to X1;

[0032] Z2' is complementary to Z2.

[0033] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0034] In another preferred embodiment, Z1 is 40 to 90 nucleotides, preferably 50 to 80 nucleotides, and more preferably 60 to 75 nucleotides.

[0035] In another preferred embodiment, Z2 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0036] In another preferred embodiment, X1 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0037] In another preferred embodiment, X2 is 35 to 80 nucleotides, preferably 35 to 60 nucleotides, and more preferably 35 to 50 nucleotides.

[0038] In another preferred example, the nucleotide sequence of the first nucleic acid element is as shown in SEQ ID NO:3.

[0039] In another preferred example, the nucleotide sequence of the second nucleic acid element is as shown in SEQ ID NO:1.

[0040] In another preferred example, the nucleotide sequence of the third nucleic acid element is as shown in SEQ ID NO:2.

[0041] In another preferred example, the nucleotide sequence of the first connecting element is as shown in SEQ ID NO:4.

[0042] In another preferred embodiment, the 5' end of the second nucleic acid element is linked to the second antibody via a covalent bond.

[0043] In another preferred embodiment, the 3' end of the third nucleic acid element is linked to the third antibody via a covalent bond.

[0044] In another preferred embodiment, the step (s1) is carried out at 20-50°C, preferably 25-40°C, more preferably 30-40°C, for example, about 37°C.

[0045] In another preferred embodiment, in step (s1), the mixing time is 0.5 to 3 hours, preferably 1 to 2.5 hours, more preferably 1 to 2 hours, for example, about 1 hour.

[0046] In another preferred embodiment, in step (s1), the amount of the micromagnetic particles is 1 to 20 μL, preferably 1 to 10 μL, for example, about 5 μL.

[0047] In another preferred embodiment, in step (s1), the amount of the sample to be tested is 10-100 μL.

[0048] In another preferred embodiment, in step (s1), the content of the target protein in the test sample is 50fg / mL to 1μg / mL, preferably 50fg / mL to 500pg / mL, more preferably 50fg / mL to 300pg / mL, for example, about 75fg / mL, about 150fg / mL, about 1.5pg / mL, about 15pg / mL or 150pg / mL.

[0049] In another preferred example, the sample to be tested includes a plasma sample.

[0050] In another preferred embodiment, in step (s1), the ratio of the second antibody to the third antibody is 10:1 to 1:10, preferably 5:1 to 1:5, more preferably 3:1 to 1:3, for example, about 1:1.

[0051] In another preferred embodiment, in step (s1), the concentration of the first antibody is 0.1-50 nM, preferably 0.5-10 nM, more preferably 1-5 nM, for example, about 1.5 nM.

[0052] In another preferred embodiment, in step (s1), the concentration of the second antibody-nucleic acid conjugate is 0.01-10 nM, preferably 0.05-5 nM, more preferably 0.1-1 nM, for example, about 0.5 nM.

[0053] In another preferred embodiment, in step (s1), the concentration of the third antibody-nucleic acid conjugate is 0.01-10 nM, preferably 0.05-5 nM, more preferably 0.1-1 nM, 0.2 nM.

[0054] In another preferred embodiment, in step (s2), the concentration of the first connecting element is 0.1-50 μM, preferably 0.5-20 μM, more preferably 0.5-10 μM, for example, about 3 μM.

[0055] In another preferred embodiment, in step (s2), the ligase is a ligase for connecting sticky ends.

[0056] In another preferred example, in step (s2), the ligase is selected from the following group: T4 ligase, T7 ligase, or a combination thereof.

[0057] In another preferred embodiment, in step (s2), the amount of the ligase is 1-10 U / reaction, preferably 2-8 U / reaction, more preferably 3-6 U / reaction, for example, about 5 U / reaction.

[0058] In another preferred embodiment, in step (s3), the nucleic acid amplification reaction is selected from the following group: PCR, qPCR, dye-based PCR, ddPCR, RPA, or LAMP.

[0059] In another preferred example, in step (s3), the nucleic acid amplification reaction includes an upstream primer, a downstream primer and a probe for the amplification template.

[0060] In another preferred example, in step (s3), the nucleic acid amplification reaction includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6, and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0061] In another preferred embodiment, the reaction conditions of the PCR are: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 45 cycles.

[0062] In another preferred embodiment, the detection limit of the method is ≤200 fg / mL, preferably ≤100 fg / mL, and more preferably ≤75 fg / mL.

[0063] In another preferred embodiment, the method is non-diagnostic and non-therapeutic.

[0064] In another preferred embodiment, the target protein is selected from the following group: pTau217, carcinoembryonic antigen, or a combination thereof.

[0065] In another preferred embodiment, the judgment criteria of the method are:

[0066] When CT ≥ 35, it indicates that the target protein is not present in the sample to be tested;

[0067] When CT<35, it indicates that the target protein exists in the sample to be tested.

[0068] In a second aspect, the present invention provides a protein detection system, comprising:

[0069] (a) first antibody-micromagnetic particle conjugate;

[0070] (b) a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate; and

[0071] (c) a first connecting element;

[0072] Optionally (d) a protein to be tested;

[0073] Wherein, the first antibody, the second antibody and the third antibody are antibodies that specifically bind to the target protein;

[0074] The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle coupled with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody coupled with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody coupled with a third nucleic acid element;

[0075] The second nucleic acid element has a structure shown in formula (I):

[0076] Z1-Z2(I)

[0077] Wherein, Z1 is 35 to 95 nucleotides;

[0078] Z2 is 5 to 15 nucleotides;

[0079] The third nucleic acid element has a structure shown in formula (II):

[0080] X1-X2(II)

[0081] Wherein, X1 is 5 to 15 nucleotides;

[0082] X2 is 35 to 95 nucleotides;

[0083] The first connecting element has a structure shown in formula (III):

[0084] L1-X1'-Z2'-L2(III)

[0085] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0086] X1' is complementary to X1;

[0087] Z2' is complementary to Z2.

[0088] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, preferably 10 to 25 nucleotides, and more preferably 10 to 20 nucleotides.

[0089] In another preferred embodiment, the length of the second nucleic acid element and the third nucleic acid element is independently 40 to 100 nucleotides, preferably 40 to 90 nucleotides, and more preferably 40 to 80 nucleotides.

[0090] In another preferred embodiment, the length of the first linking element is 15 to 40 nucleotides, preferably 20 to 35 nucleotides, and more preferably 23 to 30 nucleotides.

[0091] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0092] In another preferred embodiment, Z1 is 40 to 90 nucleotides, preferably 50 to 80 nucleotides, and more preferably 60 to 75 nucleotides.

[0093] In another preferred embodiment, Z2 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0094] In another preferred embodiment, X1 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0095] In another preferred embodiment, X2 is 35 to 80 nucleotides, preferably 35 to 60 nucleotides, and more preferably 35 to 50 nucleotides.

[0096] In another preferred example, the nucleotide sequence of the first nucleic acid element is as shown in SEQ ID NO:3.

[0097] In another preferred example, the nucleotide sequence of the second nucleic acid element is as shown in SEQ ID NO:1.

[0098] In another preferred example, the nucleotide sequence of the third nucleic acid element is as shown in SEQ ID NO:2.

[0099] In another preferred example, the nucleotide sequence of the first connecting element is as shown in SEQ ID NO:4.

[0100] In another preferred embodiment, the 5' end of the second nucleic acid element is linked to the second antibody via a covalent bond.

[0101] In another preferred embodiment, the 3' end of the third nucleic acid element is connected to the third antibody via a covalent bond. In another preferred embodiment, in the protein detection system, the amount of the micromagnetic particles is 5-10 μL.

[0102] In another preferred embodiment, in the protein detection system, the concentration of the first antibody is 0.1-50 nM, preferably 0.5-10 nM, more preferably 1-5 nM, for example, about 2 nM.

[0103] In another preferred embodiment, in the protein detection system, the concentration of the second antibody or the second antibody-nucleic acid conjugate is 0.01-10 nM, preferably 0.05-5 nM, more preferably 0.1-1 nM, for example, 0.5 nM.

[0104] In another preferred embodiment, in the protein detection system, the concentration of the third antibody or the third antibody-nucleic acid conjugate is 0.01-10 nM, preferably 0.05-5 nM, more preferably 0.1-1 nM, 0.2 nM.

[0105] In another preferred embodiment, in the protein detection system, the ratio of the second antibody to the third antibody or the second antibody-nucleic acid conjugate to the third antibody-nucleic acid conjugate is 10:1 to 1:10, preferably 5:1 to 1:5, more preferably 3:1 to 1:3, for example, about 1:1.

[0106] In another preferred embodiment, in the protein detection system, the concentration of the first connecting element is 0.1-50 μM, preferably 0.5-20 μM, more preferably 0.5-10 μM, for example, about 3 μM.

[0107] In another preferred embodiment, the protein detection system further comprises a ligase.

[0108] In another preferred embodiment, in the protein detection system, the amount of the ligase is 1-10U, preferably 2-8U, more preferably 3-6U, for example, about 5U.

[0109] In another preferred embodiment, the ligase is a ligase used to connect sticky ends.

[0110] In another preferred embodiment, the ligase is selected from the following group: T4 ligase, T7 ligase, or a combination thereof.

[0111] In another preferred embodiment, the amount of the ligase is 1-10U, preferably 2-8U, more preferably 3-6U, for example, about 5U.

[0112] In another preferred embodiment, the protein detection system further comprises a buffer selected from the following components: 10-50 mM Na 2 HPO 4 , 1~10mM NaH 2 PO 4 , 20-70 mM NaCl, 0.01%-0.5% Tween 20, 0.1%-5% BSA, 50-150 nM IgG, 0.01-1 mg / mL salmon sperm DNA and 1-10 mM EDTA.

[0113] In another preferred embodiment, the protein detection system further comprises a connection system selected from the following components: 10-50 mM Tris-HCl, 1.0-5.0 mM MgCl 2 , 0.1-1 mM NAD, 1.0-3.0 mM ATP, and 1-50 mM DTT.

[0114] In another preferred example, the protein detection system further comprises primers and probes, preferably an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6, and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0115] The third aspect of the present invention provides a protein detection kit, comprising:

[0116] (i) a first container and micromagnetic particles and a first antibody or a first antibody-micromagnetic particle conjugate located in the first container;

[0117] (ii) a second container and a second antibody, a third antibody, a second nucleic acid element, and a third nucleic acid element or a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate located in the second container; and

[0118] (iii) a third container and a first connecting element located in the third container;

[0119] Wherein, the micromagnetic particles are not coupled to the first antibody;

[0120] The first antibody, the second antibody and the third antibody are antibodies that specifically bind to the target protein;

[0121] The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle coupled with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody coupled with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody coupled with a third nucleic acid element;

[0122] The second nucleic acid element has a structure shown in formula (I):

[0123] Z1-Z2(I)

[0124] Wherein, Z1 is 35 to 95 nucleotides;

[0125] Z2 is 5 to 15 nucleotides;

[0126] The third nucleic acid element has a structure shown in formula (II):

[0127] X1-X2(II)

[0128] Wherein, X1 is 5 to 15 nucleotides;

[0129] X2 is 35 to 95 nucleotides;

[0130] The first connecting element has a structure shown in formula (III):

[0131] L1-X1'-Z2'-L2(III)

[0132] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0133] X1' is complementary to X1;

[0134] Z2' is complementary to Z2.

[0135] In another preferred embodiment, the first antibody-micromagnetic particle conjugate is obtained by conjugating the first antibody and micromagnetic particles.

[0136] In another preferred embodiment, the micromagnetic particles and the first antibody in the first container and the second antibody, the third antibody, the second nucleic acid element and the third nucleic acid element or the second antibody conjugate and the third antibody conjugate in the second container are in the same container.

[0137] In another preferred embodiment, the first antibody, the second antibody and the third antibody bind to different sites on the target protein.

[0138] In another preferred embodiment, the micromagnetic particles are coupled with or not coupled with a first antibody.

[0139] In another preferred embodiment, the first antibody is coupled to a first nucleic acid element, the first nucleic acid element is labeled with biotin, and the micromagnetic particle is modified with avidin.

[0140] In another preferred embodiment, the length of the first nucleic acid element is 5 to 30 nucleotides, preferably 10 to 25 nucleotides, and more preferably 10 to 20 nucleotides.

[0141] In another preferred embodiment, the length of the second nucleic acid element and the third nucleic acid element is independently 40 to 100 nucleotides, preferably 40 to 90 nucleotides, and more preferably 40 to 80 nucleotides.

[0142] In another preferred embodiment, the length of the first linking element is 15 to 40 nucleotides, preferably 20 to 35 nucleotides, and more preferably 23 to 30 nucleotides.

[0143] In another preferred embodiment, L1 and L2 are each independently 2-4 nucleotides, for example 3 nucleotides.

[0144] In another preferred embodiment, Z1 is 40 to 90 nucleotides, preferably 50 to 80 nucleotides, and more preferably 60 to 75 nucleotides.

[0145] In another preferred embodiment, Z2 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0146] In another preferred embodiment, X1 is 7 to 13 nucleotides, preferably 8 to 12 nucleotides, for example, about 10 nucleotides.

[0147] In another preferred embodiment, X2 is 35 to 80 nucleotides, preferably 35 to 60 nucleotides, and more preferably 35 to 50 nucleotides.

[0148] In another preferred example, the nucleotide sequence of the first nucleic acid element is as shown in SEQ ID NO:3.

[0149] In another preferred example, the nucleotide sequence of the second nucleic acid element is as shown in SEQ ID NO:1.

[0150] In another preferred example, the nucleotide sequence of the third nucleic acid element is as shown in SEQ ID NO:2.

[0151] In another preferred example, the nucleotide sequence of the first connecting element is as shown in SEQ ID NO:4.

[0152] In another preferred embodiment, the 5' end of the second nucleic acid element is linked to the second antibody via a covalent bond.

[0153] In another preferred embodiment, the 3' end of the third nucleic acid element is linked to the third antibody via a covalent bond.

[0154] In another preferred embodiment, the kit further comprises a fourth container and a ligase located in the fourth container.

[0155] In another preferred embodiment, the ligase is selected from the following group: T4 ligase, T7 ligase, or a combination thereof.

[0156] In another preferred example, the kit further comprises an upstream primer, a downstream primer and a probe, preferably an upstream primer having a nucleotide sequence as shown in SEQ ID NO:5, a downstream primer having a nucleotide sequence as shown in SEQ ID NO:6 and a probe having a nucleotide sequence as shown in SEQ ID NO:7.

[0157] In another preferred embodiment, the kit further comprises a buffer comprising components selected from the group consisting of: 10-50 mM Na 2 HPO 4 , 1~10mM NaH 2 PO 4 , 20-70 mM NaCl, 0.01%-0.5% Tween 20, 0.1%-5% BSA, 50-150 nM IgG, 0.01-1 mg / mL salmon sperm DNA and 1-10 mM EDTA.

[0158] In another preferred embodiment, the kit further comprises a connection system comprising components selected from the group consisting of: 10-50 mM Tris-HCl, 1.0-5.0 mM MgCl 2 , 0.1~1mM NAD, 1.0~3.0mM ATP and 1~50mM DTT.

[0159] In another preferred embodiment, the first container, the second container, the third container and / or the fourth container are the same or different containers.

[0160] In another preferred embodiment, the kit further comprises a nucleic acid amplification reaction solution for nucleic acid amplification reaction.

[0161] In another preferred example, the first antibody, the second antibody and the third antibody specifically bind to the protein.

[0162] In a fourth aspect, the present invention provides a use of the protein detection system as described in the second aspect of the present invention or the protein detection kit as described in the third aspect of the present invention, for detecting proteins in a sample to be tested.

[0163] In another preferred embodiment, the sample to be tested contains protein, preferably pTau217 and / or carcinoembryonic antigen.

[0164] In another preferred embodiment, the use is for the purpose of disease diagnosis.

[0165] In another preferred embodiment, the use is for non-disease diagnosis purposes.

[0166] In a fifth aspect, the present invention provides a protein detection method, comprising the steps of:

[0167] The antigen detection system as described in the second aspect of the present invention or the antigen detection kit as described in the third aspect of the present invention is used to process the sample to be tested, and a nucleic acid amplification reaction is performed to obtain the test result.

[0168] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0169] Figure 1 A schematic diagram of the method of the present invention is shown.

[0170] Figure 2 The results of detecting pTau217 using the method of the present invention are shown.

[0171] Figure 3 A standard curve for detecting pTau217 standards using the method of the present invention is shown.

[0172] Figure 4 Results are shown for detection of Total Tau Antibody 1 as the capture antibody.

[0173] Figure 5 Results are shown for detection of Total Tau Antibody 2 as the capture antibody.

[0174] Figure 6 The results of detecting carcinoembryonic antigen using the method of the present invention are shown.

[0175] Figure 7 The test results of the comparative example are shown. DETAILED DESCRIPTION

[0176] After extensive and in-depth research, a large number of experiments and screening, the inventors unexpectedly discovered a protein detection method for the first time, which introduces magnetic beads to capture antibodies with target protein structures, forms a three-antibody sandwich protein-magnetic bead complex, and detects the complex to obtain the detection result of the target protein. The method of the present invention has good stability, high sensitivity, high efficiency, low background signal, and simple operation steps. The present invention was completed on this basis.

[0177] the term

[0178] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0179] As used herein, the term “comprise” or variations thereof such as “include” or “comprising”, etc., are understood to include the stated elements or components but do not exclude other elements or components.

[0180] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0181] As used herein, unless otherwise indicated, any concentration range, percentage range, ratio range or integer range should be understood to include any integer value within the range and fractional values ​​thereof (e.g., one tenth and one hundredth of an integer) where appropriate.

[0182] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0183] As used herein, the term "BSA" is used interchangeably with "bovine serum albumin."

[0184] As used herein, the term "EDTA" is used interchangeably with "ethylenediaminetetraacetic acid."

[0185] As used herein, the term "NAD" is used interchangeably with "nicotinamide adenine dinucleotide."

[0186] As used herein, the term "DTT" is used interchangeably with "dithiothreitol."

[0187] As used herein, the terms "primary antibody" and "capture antibody" are used interchangeably.

[0188] As used herein, the term "secondary / tertiary antibody" is used interchangeably with "detection antibody."

[0189] As used herein, the terms "first nucleic acid element" and "probe 3" are used interchangeably.

[0190] As used herein, the terms "second / third nucleic acid" and "probe 1 / 2" are used interchangeably.

[0191] pTau217

[0192] pTau217 is a biomarker that plays an important role in the clinical diagnosis of Alzheimer's Disease (AD). The level of pTau217 in the blood is closely related to the pathological changes of Tau protein in the brain of AD patients. Studies have shown that the level of pTau217 is significantly increased in AD patients, and this increase is associated with a decline in cognitive function and atrophy of brain structure. pTau217 has excellent diagnostic performance in distinguishing AD from other neurodegenerative diseases, and is comparable to the accuracy of tau PET scans and CSF biomarkers.

[0193] Method of the present invention

[0194] The method of the present invention comprises the steps of:

[0195] (s0) providing a sample to be tested, micromagnetic particles, a first antibody, a second antibody, a third antibody, a ligase and a first connecting element, wherein the micromagnetic particles are coupled with the first antibody or the micromagnetic particles (not coupled with the first antibody) can form a first antibody-micromagnetic particle conjugate after contacting with the first antibody, the second antibody is coupled with a second nucleic acid element (second antibody-nucleic acid conjugate), and the third antibody is coupled with a third nucleic acid element (third antibody-nucleic acid conjugate);

[0196] (s1) mixing the sample to be tested with the first antibody, the second antibody, the third antibody and the micromagnetic particles, so that the second antibody, the third antibody and the micromagnetic particles bind to the target protein in the sample to be tested to form a three-antibody sandwich protein-micromagnetic particle complex, and separating the three-antibody sandwich protein-micromagnetic particle complex;

[0197] (s2) mixing the three-antibody sandwich protein-micromagnetic particle complex with a ligase and a first connecting element, so that the ends of the second nucleic acid element and the third nucleic acid element are complementary to the bases of the first connecting element to form a double-stranded structure;

[0198] There is a gap of ≤1 nt between the second nucleic acid element and the third nucleic acid element;

[0199] The gaps are connected under the action of a ligase to form an amplification template; and

[0200] (s3) performing a nucleic acid amplification reaction on the amplification template to obtain a protein detection result.

[0201] In a preferred embodiment, the second nucleic acid element has a structure shown in formula (I):

[0202] Z1-Z2(I)

[0203] Wherein, Z1 is 35 to 95 nucleotides;

[0204] Z2 is 5 to 15 nucleotides;

[0205] The third nucleic acid element has a structure shown in formula (II):

[0206] X1-X2(II)

[0207] Wherein, X1 is 5 to 15 nucleotides;

[0208] X2 is 35 to 95 nucleotides;

[0209] The first connecting element has a structure shown in formula (III):

[0210] L1-X1'-Z2'-L2(III)

[0211] In the formula, L1 and L2 are each independently 1 to 5 nucleotides;

[0212] X1' is complementary to X1;

[0213] Z2' is complementary to Z2.

[0214] In a preferred embodiment, the nucleotide sequence of the first nucleic acid element is as shown in SEQ ID NO:3.

[0215] In a preferred embodiment, the nucleotide sequence of the second nucleic acid element is as shown in SEQ ID NO:1.

[0216] In a preferred embodiment, the nucleotide sequence of the third nucleic acid element is as shown in SEQ ID NO:2.

[0217] In a preferred embodiment, the nucleotide sequence of the first connecting element is as shown in SEQ ID NO:4.

[0218] In a preferred embodiment, the micromagnetic particles that are not coupled to the first antibody are coupled to the first antibody in step (s1) to form a first antibody-micromagnetic particle conjugate.

[0219] In a preferred embodiment, in step (s1), the mixing is mixed in a buffer comprising components selected from the group consisting of: 10-50 mM Na 2 HPO 4 , 1~10mM NaH 2 PO4 , 20-70 mM NaCl, 0.01%-0.5% Tween 20, 0.1%-5% BSA, 50-150 nM IgG, 0.01-1 mg / mL salmon sperm DNA and 1-10 mM EDTA.

[0220] In a preferred embodiment, in step (s2), the ligation is carried out in a ligation system comprising components selected from the group consisting of: 10-50 mM Tris-HCl, 1.0-5.0 mM MgCl 2 , 0.1-1 mM NAD, 1.0-3.0 mM ATP, and 1-50 mM DTT.

[0221] In a preferred embodiment, in step (s2), the connection time is 10 to 60 min, preferably 10 to 40 min, more preferably 10 to 30 min, for example, about 20 min.

[0222] In a preferred embodiment, in step (s2), the connection is carried out at 20-40°C, more preferably 20-35°C, more preferably 20-30°C, for example, about 25°C.

[0223] like Figure 1 As shown, the principle of the method of the present invention is that the first antibody, the second antibody and the third antibody specifically recognize the target protein and bind, and the first antibody is also coupled with micromagnetic particles to form a three-antibody sandwich protein-micromagnetic particle complex. The target protein is captured by the micromagnetic particles coupled with the first antibody. The second antibody and the third antibody are bound to the target protein, thereby shortening the distance between the second antibody and the third antibody. In the presence of the first connecting element, the second nucleic acid element and the third nucleic acid element, which are respectively coupled to the second antibody and the third antibody, are paired with the first connecting element for base complementation to form a double-stranded structure. Under the action of a ligase, the first nucleic acid element and the second nucleic acid element are connected to form an amplification template. The amplification template is separated and a nucleic acid amplification reaction is performed to obtain a test result.

[0224] The main advantages of the present invention include:

[0225] 1. The method of the present invention has simple operation steps, low cost, and easy development of supporting instruments.

[0226] 2. The method of the present invention has good specificity, high sensitivity, low background signal, and can be used for multiple detection.

[0227] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0228] General Methods

[0229] 1. Prepare affinity probes: Monoclonal or polyclonal antibodies are conjugated to amine-modified oligonucleotides via aromatic hydrazide chemistry to form affinity probes with phosphorylated or biotin-modified 5' or 3' ends.

[0230] Probe 1: A long oligonucleotide chain with amino modification at the 5' end, with a length of 40 to 100 bp, which is related to the spatial distance of the antibody used to ensure sufficient length for splicing.

[0231] Probe 2: A long oligonucleotide chain with amino modification at the 3' end, with a length of 40 to 100 bp, which is related to the spatial distance of the antibody used to ensure sufficient length for splicing.

[0232] The lengths of the probes 1 and 2 can be one long and one short, or they can be the same length.

[0233] Probe 3: The 5' end is amino-modified, and the 3' end is biotin-modified. The modification direction can be reversed. The oligonucleotide length can be 5 to 30 bp. Biotin can also directly label antibodies.

[0234] 2. Sample incubation and capture: Add the sample to the mixture of affinity probe and magnetic beads and incubate at 37°C for 0.5 to 2 hours to allow the target analyte to bind to the antibody in the affinity probe and be captured by the magnetic beads.

[0235] The present invention combines the immune reaction and the purification of the combined product into one step, and the reaction solution is suitable for the reactions of the two steps at the same time, thereby enhancing the purification effect of the immune complex. The incubation time and temperature are determined by the properties of the antigen and antibody.

[0236] 3. Connection step: After magnetic absorption, the supernatant is discarded, and the connection mixture containing connection oligonucleotides, ligase, NAD, DTT, etc. is added to the incubated magnetic beads, and the connection reaction is carried out by incubating at 25°C for 10 to 30 minutes.

[0237] The ligase may be common T4 or T7 ligase, or other ligases suitable for sticky end ligation.

[0238] 4. qPCR quantification: Add the PCR reaction solution containing the primer probe to the ligation product and use real-time qPCR for quantitative analysis. The qPCR conditions include 95°C pre-denaturation for 10 minutes, then 95°C denaturation for 15 seconds, 60°C extension for 60 seconds, for a total of 40 cycles.

[0239] Depending on the designed oligonucleotide sequence, the detection method can use variable temperature and constant temperature amplification technologies such as qPCR, ddPCR, RPA, and LAMP.

[0240] 5. Data analysis: Convert the Ct value of qPCR to the estimated number of linked molecules and calculate the detection limit. Calibrate by setting standards and drawing a standard curve, and calculate the actual concentration of the sample based on the Ct value.

[0241] Incubation buffer formula: Na 2 HPO 4 、NaH 2 PO 4 , NaCl, Tween 20, BSA, IgG, salmon sperm DNA, EDTA

[0242] Connection system formula: Tris-HCl, MgCl 2 , ATP, NAD, DTT, T4 ligase.

[0243] Amplification method: 95°C for 5 min, 95°C for 30 s, 60°C for 30 s, 45 cycles.

[0244] Example 1

[0245] 1.1 Methods

[0246] In this example, a triple antibody ligation reaction was used to detect pTau217, and the specific steps are as follows.

[0247] 1. Detection probe and sequence: The detection probe consists of a pTau217-specific antibody and two total Tau antibodies (the same label indicates sequence complementarity).

[0248] Probe 1: 5'-NH 2 -C6-TTATCGACTGCCTCTACGGTGATCTCGTATGACCATT AATGTTAATTTGCTCGGCACAACAAACAAGATT TTCCTGCTCG -3' (SEQ ID NO: 1)

[0249] Probe 2: 5'-P- TCAGCCGTGC CGCTCCACTGAGAAATCTGGCTGGATCCAT ATCAC-NH2 -C6-3' (SEQ ID NO: 2)

[0250] Probe 3: 5'-NH 2 -C6-AAGGAGACTACGAAT-Biotin-3'(SEQ ID NO:3)

[0251] Among them, probe 1 has a 5' NH 2 Connected to total Tau antibody 1; probe 2 is connected to the ... 2 Connected to total Tau antibody 2; probe 3 is connected to the ... 2 Connected with pTau217 antibody. Use coupling kit (purchased from abcam) for connection. Among them, the pTau217 antibody connected to probe 3 is the capture antibody.

[0252] Connection fragment: TTT GCACGGCTGACGAGCAGGAA TTT (SEQ ID NO:4)

[0253] F1:GACCATTAATGTTAATTTGCTCG(SEQ ID NO:5)

[0254] R1:TGGATCCAGCCAGATTTCT(SEQ ID NO:6)

[0255] P1:CAACAAACAAGATTTTCCTGCTCGTCAGC(SEQ ID NO:7)

[0256] 2. Sample incubation and capture: Add the prepared standard to a mixture (200 μl) of affinity probe and magnetic beads (5 μl) and incubate at 37°C for 1.5 hours to allow the target analyte to bind to the antibody in the affinity probe and be captured by the magnetic beads. The concentration of pTau217 antibody is 1.5 nM, the concentration of total Tau antibody 1 is 0.5 nM, and the concentration of total Tau antibody 2 is 0.2 nM.

[0257] Incubation buffer formula: 20mM Na 2 HPO 4 , 5mM NaH 2 PO 4 , 50mM NaCl, 0.1% Tween20, 1% BSA, 100nM IgG, 0.1mg / mL salmon sperm DNA, 4mM EDTA.

[0258] Preparation of standards: Commercial antigens and plasma were purchased, and the antigens were diluted into plasma to a concentration of 1 ng / mL. The SIMAO platform of Quanterix was used for determination of the value. After the value was obtained, it was diluted with 1×PBS to 150 pg / mL, 15 pg / mL, 1.5 pg / mL, 150 fg / mL, and 75 fg / mL as standards for determination of system sensitivity.

[0259] 3. Ligation step: After magnetic absorption, the supernatant was discarded, and the ligation mixture was added to the incubated magnetic beads, and the ligation reaction was carried out at 25° C. in a ligation system containing a ligation oligonucleotide (SEQ ID NO: 4) for 20 minutes. The concentration of the ligation oligonucleotide was 3 μM.

[0260] Ligation system formula: 20mM Tris-HCl, 1.5mM MgCl 2 , 0.25mM NAD, 1.5mM ATP, 10mM DTT, 5U / reaction T 4 Ligase.

[0261] 4. qPCR quantification: Add the PCR reaction solution containing primers and probes (SEQ ID NO: 5, 6 and 7) to the ligation product, and use real-time qPCR for quantitative analysis. The qPCR conditions include 95℃ pre-denaturation for 10 minutes, then 95℃ denaturation for 15 seconds, 60℃ extension for 60 seconds, and a total of 45 cycles. 1μL of 10μM primer, 0.5μL of 10μM probe, 10μL of 2×PCR mix, and add water to a total volume of 20μL.

[0262] 5. Draw a standard curve based on the test results of the standard sample, which can be used for subsequent detection of unknown samples.

[0263] 1.2 Structure

[0264] Table 1 Results of detecting pTau217 using the method of the present invention

[0265] CK 150pg / mL 15pg / mL 1.5 pg / mL 150fg / mL 75fg / mL Ct1 35.77 25.2 28.47 30.67 33.05 34.06 Ct2 35.95 25.34 28.12 30.65 33.25 34.56 AVE 35.86 25.27 28.295 30.66 33.15 34.31

[0266] Note: AVE stands for average value.

[0267] like Figure 2 As shown in Table 1, the method of the present invention can detect 75 fg / mL of pTau217 samples, meeting the sensitivity requirements for clinical detection of the target. Figure 3 A standard curve prepared from pTau217 standards is shown.

[0268] After purification by probe 3 and capture antibody, the original experimental background of PLA technology can be effectively reduced, and the detection sensitivity of low-abundance samples can be effectively improved.

[0269] Example 2 Screening of capture antibodies

[0270] 2.1 Methods

[0271] The experimental steps in this example are as described in Example 1.

[0272] Solution 1: As described in Example 1, the pTau217 antibody is a capture antibody.

[0273] Scheme 2: Probe 1 is NH 2 Connected to pTau217 antibody; Probe 2 is connected to pTau217 antibody via 3' NH 2 Connected to total Tau antibody 2; probe 3 is connected to the ... 2 Connected with total Tau antibody 1. Among them, total Tau antibody 1 is used as the capture antibody.

[0274] Scheme 3: Probe 1 through 5' end NH 2 Connected to pTau217 antibody; Probe 2 is connected to pTau217 antibody via 3' NH 2 Connected to total Tau antibody 1; probe 3 is connected to the ... 2 Connected with total Tau antibody 2. Wherein, total Tau antibody 2 is a capture antibody.

[0275] 2.2 Results

[0276] Table 2 Test results of scheme 2

[0277] CK 150pg / mL 15pg / mL 1.5 pg / mL 150fg / mL 75fg / mL Ct1 35.27 24.93 28.22 31.47 33.84 34.88 Ct2 35.41 24.56 27.98 31.59 33.42 34.93 AVE 35.34 24.745 28.1 31.53 33.63 34.905

[0278] Note: AVE stands for average value.

[0279] Table 3 Test results of scheme 3

[0280] CK 150pg / mL 15pg / mL 1.5 pg / mL 150fg / mL 75fg / mL Ct1 35.84 24.37 28.42 31.53 33.7 34.65 Ct2 35.21 24.98 28.69 31.2 33.52 34.23 AVE 35.525 24.675 28.555 31.365 33.61 34.44

[0281] Note: AVE stands for average value.

[0282] The results of Scheme 1 are as described in Example 1, and the results of Scheme 2 are as described in Example 2. Figure 4 As shown in Table 2, the results of Scheme 3 are as follows Figure 5 And as shown in Table 3.

[0283] The above results show that when using three antibodies to detect pTau217, the capture antibody can be any one of the three antibodies without affecting the experimental results.

[0284] Example 3 Detection of carcinoembryonic antigen using the method of the present invention

[0285] With carcinoembryonic antigen (CEA) as the target, the method of this embodiment is as described in Example 1, using anti-CEA antibody instead of anti-tau antibody. Among them, probe 1 is connected to anti-CEA antibody 1; probe 2 is connected to anti-CEA antibody 2; probe 3 is connected to anti-CEA antibody 3.

[0286] Preparation of standards: Commercial antigens and plasma were purchased, and the antigens were diluted into plasma to a concentration of 10 ng / mL. The concentration was determined using the simao platform of quanterix. After the concentration was determined, it was diluted to 1 ng / mL, 100 pg / mL, 10 pg / mL, and 1 pg / mL using 1×PBS as standards for determination of system sensitivity.

[0287] Table 4 Results of detecting carcinoembryonic antigen using the method of the present invention

[0288] CK 1ng / mL 100pg / mL 10pg / mL 1pg / mL Ct1 3719 2595 292 3219 3495 Ct2 3756 2583 2936 3255 347 AVE 37375 2589 2928 3237 34825

[0289] Note: AVE stands for average value.

[0290] The results are as follows Figure 6 and as shown in Table 4. The method of the present invention has good sensitivity and can detect target protein as low as 1 pg / mL.

[0291] Comparative Example

[0292] Magnetic beads preparation: Wash the magnetic beads by washing 5 μL of magnetic beads four times with 1x PBS.

[0293] Immunoreaction: Incubate with 200 nM capture antibody for 1 hour.

[0294] Blocking and washing: Wash three times with 1xPBS. Incubate twice with Thermo Fisher's casein blocking solution for 15 minutes each. Wash three times with 1xTBST (containing 25 mM Tris, 0.15 M NaCl, 0.05% Tween-20, pH 7.5).

[0295] Antibody immobilization: Biotinylated oligonucleotides are immobilized on streptavidin-coated magnetic beads.

[0296] Capture and release: The capture antibody is released by strand displacement using a release oligonucleotide.

[0297] Detection: PLA technology is used to identify when both detection antibodies bind to the same analyte. TaqMan probes are used for qPCR quantification.

[0298] Table 5 Results of carcinoembryonic antigen detection in this example

[0299] CK 1ng / mL 100pg / mL 10pg / mL Ct1 NoC 2614 3093 3384 Ct2 NoC 2607 3082 3376 AVE NoC 26105 30875 338

[0300] The results are as follows Figure 7 And as shown in Table 5.

[0301] The results of the comparative example show that the Ct value of the sample with the same concentration is more delayed. This method causes a certain degree of signal loss after two steps of purification (especially the dT magnetic bead purification step), resulting in sensitivity that cannot reach the optimal level. Although this method can achieve the effect of reducing the background, it has been verified that there will be a certain degree of loss in sensitivity. At the same time, the magnetic bead purification process is relatively complicated, the system stability is relatively poor, and instrument development is also more difficult.

[0302] In comparison, the method of the present invention is simpler, more convenient in both manual operation and instrument development, and has better result stability and better sensitivity.

[0303] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A protein detection method, characterized in that: Includes steps: (s0) providing a sample to be tested, micromagnetic particles, a first antibody, a second antibody, a third antibody, a ligase and a first connecting element, wherein the micromagnetic particles are coupled with the first antibody or the micromagnetic particles (not coupled with the first antibody) can form a first antibody-micromagnetic particle conjugate after contacting with the first antibody, the second antibody is coupled with a second nucleic acid element, and the third antibody is coupled with a third nucleic acid element; (s1) mixing the sample to be tested with the first antibody, the second antibody, the third antibody and the micromagnetic particles, so that the second antibody, the third antibody and the micromagnetic particles bind to the target protein in the sample to be tested to form a three-antibody sandwich protein-micromagnetic particle complex, and separating the three-antibody sandwich protein-micromagnetic particle complex; (s2) mixing the three-antibody sandwich protein-micromagnetic particle complex with a ligase and a first connecting element, so that the ends of the second nucleic acid element and the third nucleic acid element are complementary to the bases of the first connecting element to form a double-stranded structure; There is a gap of ≤1 nt between the second nucleic acid element and the third nucleic acid element; The gaps are connected under the action of a ligase to form an amplification template; and (s3) performing a nucleic acid amplification reaction on the amplification template to obtain a protein detection result.

2. The method according to claim 1, characterized in that In step (s1), the amount of the micromagnetic particles is 1 to 20 μL.

3. The method according to claim 1, characterized in that The length of the first nucleic acid element is 5 to 30 nucleotides, preferably 10 to 25 nucleotides, and more preferably 10 to 20 nucleotides.

4. The method according to claim 1, characterized in that The length of the second nucleic acid element and the third nucleic acid element is independently 40 to 100 nucleotides, preferably 40 to 90 nucleotides, and more preferably 40 to 80 nucleotides.

5. The method according to claim 1, characterized in that The length of the first linking element is 15 to 40 nucleotides, preferably 20 to 35 nucleotides, and more preferably 23 to 30 nucleotides.

6. The method according to claim 1, characterized in that The second nucleic acid element has a structure shown in formula (I): Z1-Z2(I) Wherein, Z1 is 35 to 95 nucleotides; Z2 is 5 to 15 nucleotides; The third nucleic acid element has a structure shown in formula (II): X1-X2(II) Wherein, X1 is 5 to 15 nucleotides; X2 is 35 to 95 nucleotides; The first connecting element has a structure shown in formula (III): L1-X1'-Z2'-L2(III) In the formula, L1 and L2 are each independently 1 to 5 nucleotides; X1' is complementary to X1; Z2' is complementary to Z2.

7. The method according to claim 1, characterized in that In step (s1), the ratio of the second antibody to the third antibody is 1:1 to 1:

10.

8. A protein detection system, characterized in that: Include: (a) first antibody-micromagnetic particle conjugate; (b) a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate; and (c) a first linking element; optionally (d) a protein to be detected; Wherein, the first antibody, the second antibody and the third antibody are antibodies that specifically bind to the target protein; The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle coupled with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody coupled with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody coupled with a third nucleic acid element; The second nucleic acid element has a structure shown in formula (I): Z1-Z2(I) Wherein, Z1 is 35 to 95 nucleotides; Z2 is 5 to 15 nucleotides; The third nucleic acid element has a structure shown in formula (II): X1-X2(II) Wherein, X1 is 5 to 15 nucleotides; X2 is 35 to 95 nucleotides; The first connecting element has a structure shown in formula (III): L1-X1'-Z2'-L2(III) In the formula, L1 and L2 are each independently 1 to 5 nucleotides; X1' is complementary to X1; Z2' is complementary to Z2.

9. A protein detection kit, characterized in that: Include: (i) a first container and micromagnetic particles and a first antibody or a first antibody-micromagnetic particle conjugate located in the first container; (ii) a second container and a second antibody, a third antibody, a second nucleic acid element and a third nucleic acid element or a second antibody-nucleic acid conjugate and a third antibody-nucleic acid conjugate located in the second container; and (iii) a third container and a first connecting element located in the third container; Wherein, the micromagnetic particles are not coupled to the first antibody; The first antibody, the second antibody and the third antibody are antibodies that specifically bind to the target protein; The first antibody-micromagnetic particle conjugate refers to a micromagnetic particle coupled with a first antibody, the second antibody-nucleic acid conjugate refers to a second antibody coupled with a second nucleic acid element, and the third antibody-nucleic acid conjugate refers to a third antibody coupled with a third nucleic acid element; The second nucleic acid element has a structure shown in formula (I): Z1-Z2(I) Wherein, Z1 is 35 to 95 nucleotides; Z2 is 5 to 15 nucleotides; The third nucleic acid element has a structure shown in formula (II): X1-X2(II) Wherein, X1 is 5 to 15 nucleotides; X2 is 35 to 95 nucleotides; The first connecting element has a structure shown in formula (III): L1-X1'-Z2'-L2(III) In the formula, L1 and L2 are each independently 1 to 5 nucleotides; X1' is complementary to X1; Z2' is complementary to Z2.

10. A use of the protein detection system according to claim 8 or the protein detection kit according to claim 9, characterized in that: Used to detect Alzheimer's disease biomarkers in test samples.

Images