Polypeptide encoding library and screening method thereof

Abstract

The invention provides a polypeptide coding nucleic acid or small molecule compound library. The library comprises a polypeptide bar code tag and a nucleic acid molecule or small molecule compound corresponding to the polypeptide bar code tag. The invention also provides a polypeptide coding nucleic acid or small molecule compound library, the library comprises a plurality of beads, and each bead comprises a polypeptide barcode tag connected to the bead and a nucleic acid molecule or small molecule compound corresponding to the polypeptide barcode tag. The invention also provides a method for screening target nucleic acid or small molecule from the polypeptide coding nucleic acid or small molecule compound library, wherein the screened nucleic acid molecule or small molecule compound is identified by decoding the polypeptide barcode tag associated with the polypeptide coding nucleic acid or small molecule compound library.

Description

Polypeptide encoding library and screening method thereof Technical Field

[0001] The present invention relates to the fields of biology and medical devices. Specifically, the present invention provides a polypeptide encoding library, particularly a polypeptide encoding nucleic acid library and a small molecule compound library, as well as a method for screening the polypeptide encoding library and a microfluidic device. Background Art

[0002] With the development of biotechnology, various small molecule compounds and biomacromolecules are increasingly being used to treat and prevent diseases. This field requires high-throughput screening of a large number of small molecule compounds and biomacromolecule (including nucleic acid molecules such as mRNA molecules) candidates.

[0003] Summary of the Invention

[0004] The present invention provides a polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library, comprising a plurality of nucleic acid molecules or small molecule compounds, each of which has a corresponding polypeptide barcode tag. The nucleic acid library or small molecule compound library provided by the present invention can be used to screen for candidate molecules useful for disease diagnosis or treatment, and is particularly suitable for high-throughput and rapid screening of libraries containing large numbers of nucleic acid molecules or small molecule compounds.

[0005] In one aspect of the invention, the library is a library of small molecule compounds. Small molecules generally refer to molecules having a molecular weight of less than about 1000 Daltons. Small molecules can be organic or inorganic, isolated (e.g., from a compound library or natural source) or obtained by derivatization of known compounds.

[0006] In one aspect of the present invention, the library is a nucleic acid library. Nucleic acids include DNA and RNA. In another aspect of the present invention, the library is an mRNA or RNAi library.

[0007] A tag contains information that uniquely identifies a nucleic acid molecule or small molecule on the same microparticle, thereby serving as a unique identifier for that specific nucleic acid molecule or small molecule. Thus, the tag encodes a specific nucleic acid molecule or small molecule and acts as a molecular "barcode." In the present invention, the tag is a polypeptide, and the information is encoded in the amino acid residue sequence.

[0008] In one aspect of the present invention, the polypeptide barcode tag is formed by sequentially linking n amino acid residue building blocks, wherein n is an integer from 3 to 10, preferably an integer from 4 to 8, for example, n is 4, 5, or 6. The nucleic acid molecule or small molecule compound is formed by sequentially linking m nucleic acid units or small molecule compound building blocks, wherein m is the same as the number n of amino acid residue building blocks in the corresponding polypeptide barcode tag on the bead. In another aspect of the present invention, the nucleic acid units or small molecule compound building blocks and amino acid residue building blocks in each nucleic acid molecule or small molecule compound in the library are sequentially and alternately assembled, thereby making the polypeptide barcode tag composed of the plurality of amino acid residue building blocks unique and corresponding to each nucleic acid molecule or small molecule compound. Based on the sequence information of the polypeptide barcode tag, the composition information of the corresponding nucleic acid molecule, including the nucleic acid sequence, nucleoside types, etc. determined by the plurality of nucleic acid units, or the group composition and structure of the small molecule compound, can be obtained.

[0009] In one aspect of the present invention, a library of polypeptide-encoding nucleic acids or polypeptide-encoding small molecule compounds is provided. The library comprises a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and a nucleic acid molecule or small molecule compound corresponding to the polypeptide barcode tag. In one embodiment of the present invention, the nucleic acid molecule or small molecule compound is releasably attached to the bead.

[0010] In one aspect of the present invention, the polypeptide barcode tag is formed by sequentially connecting n amino acid residue building blocks. Wherein n is an integer of 3-10, preferably an integer of 4-8, for example, n is 4 or 5 or 6. Wherein the nucleic acid molecule or small molecule compound is formed by sequentially connecting m nucleic acid units or small molecule compound building blocks, wherein m is the same as the number n of amino acid residue building blocks in the polypeptide barcode tag on the corresponding bead. Wherein, the multiple amino acid residue building blocks are sequentially connected in series and connected to the bead surface, wherein all the multiple amino acid residue building blocks together constitute the polypeptide barcode tag. And wherein the multiple nucleic acid units or small molecule compound building blocks are sequentially connected in series and connected to the bead surface, wherein all the multiple nucleic acid units together constitute the nucleic acid molecule. In another aspect of the present invention, each nucleic acid unit or small molecule compound building unit and each amino acid residue building unit are assembled sequentially and alternately on the bead. The nucleic acid units or small molecule compound building blocks and the amino acid residue building blocks are assembled sequentially and alternately, so that the polypeptide barcode tag formed on each bead, which is composed of the multiple amino acid residue building blocks, is unique and forms a corresponding relationship with the nucleic acid molecules composed of the multiple nucleic acid units or small molecule compounds composed of the small molecule compound building blocks on the same bead. Based on the sequence information of the polypeptide barcode tag, the composition information of the corresponding nucleic acid molecule can be obtained, including the nucleic acid sequence and nucleoside types determined by the multiple nucleic acid units, or the group composition and structure of the small molecule compound.

[0011] In the present invention, bead synthesis and production typically utilize a "split and merge" approach. Typically, this "split and merge" approach is used to simultaneously synthesize bead-bound nucleic acids or small molecule compounds and bead-bound polypeptide barcodes. For example, this approach involves the following steps: (a) partitioning the beads into distinct containers; and (b) adding a different building block (nucleic acid unit or compound building block) to each container. For example, in the case of three containers, a first nucleic acid unit member or compound building block A is added to the first container and reacted, a first nucleic acid unit member or compound building block B is added to the second container; and a first nucleic acid unit member or compound building block C is added to the third container, wherein the nucleic acid unit is covalently bound to a linking site on any bead in the container; (c) all beads are pooled in one container; (d) the beads are redistributed into the three containers; (e) a different nucleic acid unit or compound building block is added to each container, wherein a second nucleic acid unit member or compound building block A is added to the first container, a second nucleic acid unit member or compound building block B is added to the second container, and a second nucleic acid unit member or compound building block C is added to the third container, wherein the second nucleic acid unit or compound building block member binds to the previously attached first nucleic acid unit or compound building block member. Simultaneously, a step of coupling amino acid residue building blocks of a polypeptide barcode tag is included before or after each nucleic acid unit member or compound building block binding step. One feature of bead-bound libraries prepared by the split-and-pool approach is that each bead will have only one nucleic acid molecule or compound molecule and corresponding unique polypeptide barcode tag attached to it.

[0012] In the present invention, the number of different nucleic acid molecules contained in the library is determined by the number of groups of nucleic acid units and the number of members in each group of nucleic acid units, and the number of nucleic acid molecules increases exponentially with the number of synthesis steps (which determines the number of groups of nucleic acid units) and building blocks (i.e., the number of members in each group of nucleic acid units). This strategy enables the number of nucleic acid molecules in the library to reach the scale of hundreds of millions or even hundreds of billions. For example, when 5 groups of mRNA units are used (e.g., the 5' cap, 5' untranslated region, i.e., 5'UTR, mRNA coding sequence, 3' untranslated region, i.e., 3'UTR, and poly A tail, i.e., polyT, of mRNA in order), and each group includes 10 members for synthesis, a library containing 10 5 For example, when 10 groups of mRNA units (e.g., 10 segments of mRNA coding sequences) are used for synthesis, and each group includes 5 members, a library containing 5 mRNA molecules will be generated. 10The invention relates to a library of mRNA molecules. Each bead in the library carries multiple copies of one of the mRNA molecules in the library and has a unique polypeptide barcode tag corresponding to the mRNA bound to it. Based on the sequence information of the polypeptide barcode tag on each bead, the composition information of the corresponding nucleic acid molecule can be obtained, including the nucleic acid sequence and nucleoside types determined by the multiple nucleic acid units.

[0013] In one aspect of the present invention, the polypeptide barcode tags of the different nucleic acid molecules or small molecule compounds contained in the library are decoded by sequencing. In one aspect of the present invention, the sequencing is performed by mass spectrometry, and the polypeptide barcode information is read out by mass spectrometry of the sample. In one aspect of the present invention, the units (single amino acids or combinations of a specified number of amino acid residues) used to form the polypeptide barcode tags in the library each have different (and known) characteristics that can be identified by mass spectrometry, including molecular weight, or fragmentation patterns, elution time, and / or isotopic distribution. The corresponding mass spectrometric characteristics can be mapped to the nucleic acid molecules or small molecule compounds on the corresponding beads. The polypeptide barcode tag is formed by multiple units, such as single amino acids or combinations of a specified number of amino acid residues. Each unit has a distinguishable mass spectrometric signature. The mass spectrometric signature thus identifies each unit of the polypeptide barcode tag itself, its position in the barcode sequence, etc. The polypeptide can be sequenced using various known mass spectrometric analysis methods and instruments known in the art. The mass spectrometry method generally involves transferring ionized peptide molecules to the vacuum system of a mass spectrometer for mass spectrometry scanning, which records the mass spectrum of the peptides entering the instrument during the scan. Quantification is performed based on the peaks present in this mass spectrometry (MS) scan.

[0014] In one aspect of the present invention, each amino acid residue unit in the polypeptide barcode tag comprises one or more (e.g., 2-8, preferably 2-3) amino acid residues. In another aspect of the present invention, the amino acid residue unit comprises one or two amino acid residues.

[0015] In the present invention, the amino acid residues in the polypeptide barcode tag can be various natural or synthetic amino acid residues and their modifications or variants. Differently labeled (such as lightly labeled or heavily labeled) amino acid residues can be used to increase the discrimination of the polypeptide barcode based on different masses. In one aspect of the present invention, the amino acid residues include modified amino acid residues, such as lightly labeled or heavily labeled amino acid residues. Preferably, the amino acid residues are amino acid residues containing heavy isotopes. The optional heavy isotopes are selected from deuterium (D), 13 C and 15 N. Amino acid residues containing heavy isotopes are, for example, L-arginine- 13 C6, L-arginine- 13C6 15 N4, L-arginine- 13 C6 15 N4D7, L-arginine- 15 N4D7, L-arginine- 15 N4, L-lysine- 13 C6 15 N2, L-lysine- 15 N2, L-lysine- 13 C6, L-lysine- 13 C6 15 N2D9, L-lysine- 15 N2D9, L-lysine-D4, L-methionine- 13 CD3, L-tyrosine- 13 C9, L-Tyrosine- 15 N and L-Tyrosine- 13 C9 15 N et al.

[0016] In one aspect of the present invention, the beads are made of metal and / or polymer materials, such as polystyrene beads. In the present invention, the beads can also be hydrogel particles, such as polyacrylamide, agarose, alginate, and other gel particles. The beads have functional groups on their surfaces or within their interiors that can form covalent, ionic, or hydrogen bonds, and polypeptides and nucleic acid molecules can be immobilized on the beads directly or via linking groups.

[0017] In one aspect of the present invention, the size of the beads is between 1 μm and 100 μm, preferably between 1 μm and 20 μm.

[0018] As previously mentioned, in one aspect of the present invention, the library is a small molecule compound library. The small molecule compounds in the library are composed of small molecule compound building blocks. The small molecule compound building blocks can be any useful chemical structural unit, including inorganic or organic groups, such as optionally substituted alkyl or cycloalkyl groups (e.g., optionally substituted straight or branched C1-6 alkyl groups or optionally substituted C1-6 aminoalkyl groups), optionally substituted aromatic groups (e.g., optionally substituted phenyl or benzyl), optionally substituted heterocyclic groups (e.g., optionally substituted quinolyl, isoquinolyl, indolyl, pyridyl, piperidyl or pyrrolidinyl), or optionally substituted carbocyclic groups (e.g., optionally substituted cyclopropyl, cyclohexyl or cyclohexenyl).

[0019] As previously mentioned, in one aspect of the present invention, the library is a library of ribonucleic acids, i.e., RNA molecules. In one aspect of the present invention, the RNA molecules are mRNA or RNAi. Each mRNA or RNAi molecule in the library has a variety of different structural or chemically modified designs.

[0020] The modification that mRNA and / or RNAi molecule in the library carries can make it have better structure or chemical characteristics with natural or synthetic mRNA and / or RNAi molecule, obtain better biological activity and effect.For example, it can be used to optimize the therapeutic agent based on nucleic acid while retaining structure and functional integrity, overcome expression threshold, improve expression rate, half-life and / or protein concentration, optimize protein localization, and avoid harmful biological response, such as the feature of immune response and / or degradation pathway.The mRNA and / or RNAi molecule of modification may improve the stability and / or clearance rate in tissue, receptor uptake and / or kinetics, cell entry of composition, engagement with translation machinery, half-life, translation efficiency, immune escape, protein production capacity, secretion efficiency (when applicable), circulation accessibility, protein half-life and / or cell state, function and / or active tuning.In addition, the mRNA and / or RNAi of modification has lower immunogenicity.

[0021] Modifications of mRNA and / or RNAi include any useful modifications, such as to sugars, nucleobases, or internucleoside bonds (e.g., to connecting phosphate / phosphodiester bonds / phosphodiester backbones). For example, the major groove of an mRNA or RNAi or the major groove surface of a nucleobase may comprise one or more modifications. One or more atoms of a pyrimidine nucleobase (e.g., on the major groove surface) may be replaced or substituted by an optionally substituted amino group, an optionally substituted thiol group, an optionally substituted alkyl group (e.g., methyl or ethyl) or a halogen group (e.g., chlorine or fluorine). In certain embodiments, modifications (e.g., one or more modifications) are present in each sugar and internucleoside bond. Modifications according to the present invention may be modifications of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), such as, for example, substitution of 2'OH of a ribofuranosyl ring with 2'H, threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof).

[0022] In another aspect of the present invention, the nucleic acid molecule is RNAi. RNAi includes but is not limited to siRNA, shRNA and miRNA. The term "interfering RNA" or "RNAi" or "interfering RNA sequence" refers to a single-stranded RNA (e.g., mature miRNA) or double-stranded RNA (i.e., duplex RNA, such as siRNA, aiRNA or pre-miRNA) that can reduce or inhibit the expression of a target gene or sequence when the interfering RNA and the target gene or sequence are in the same cell (e.g., by mediating degradation or inhibiting the translation of an mRNA complementary to the interfering RNA sequence). Interfering RNA therefore refers to a single-stranded RNA complementary to the target mRNA sequence or a double-stranded RNA formed by two complementary chains or a single self-complementary chain. Interfering RNA can have substantially or completely the same identity as the target gene or sequence, or can include a mismatch region (i.e., a mismatch motif). The sequence of interfering RNA can correspond to the full-length target gene or its subsequence. Interfering RNA includes "small-interfering RNA" or "siRNA", e.g., an interfering RNA having a length of about 15-60, 15-50 or 5-40 (duplex) nucleotides. The siRNA duplex may comprise a 3' overhang and a 5' phosphate end of about 1 to about 4 nucleotides or about 2 to about 3 nucleotides. Examples of siRNA include, but are not limited to, a double-stranded polynucleotide molecule assembled from two separate chain molecules, wherein one chain is a sense strand and the other is a complementary antisense strand; a double-stranded polynucleotide molecule assembled from a single chain molecule, wherein the sense and antisense regions are connected by a nucleic acid-based or non-nucleic acid-based linker; a double-stranded polynucleotide molecule with a hairpin secondary structure, wherein the hairpin secondary structure has self-complementary sense and antisense regions; and a circular single-stranded polynucleotide molecule having two or more loop structures and a stem with self-complementary sense and antisense regions, wherein the circular polynucleotide can be processed in vivo or in vitro to produce an active double-stranded siRNA molecule. Small hairpin RNA or short hairpin RNA (shRNA) is an RNA sequence that makes a tight hairpin bend, which can be used to silence gene expression via RNA interference. The shRNA hairpin structure is cut into siRNA by the cell machinery, which then binds to the RNA-induced silencing complex (RISC). The complex is combined with mRNA and cut, and the mRNA matches the siRNA that is combined with it. The suitable length of RNAi includes but is not limited to about 5 to about 200 nucleotides, or 10-50 nucleotides or base pairs or 15-30 nucleotides or base pairs. In some embodiments, RNAi is modified, for example, by incorporating non-naturally occurring nucleotides. In some embodiments, RNAi is double-stranded RNAi. The suitable length of RNAi includes but is not limited to about 5 to about 200 nucleotides, or 10-50 nucleotides or base pairs or 15-30 nucleotides or base pairs. In some embodiments, RNAi is modified, for example, by incorporating non-naturally occurring nucleotides.

[0023] In one aspect of the present invention, the RNAi molecules in the library are formed by sequentially linking multiple RNAi units. In one aspect of the present invention, the RNAi molecules in the library are synthesized by sequentially linking multiple RNAi units. The number m of RNAi units is an integer between 3 and 10, preferably an integer between 4 and 8, for example, n is 4, 5, or 6, which is the same as the number n of amino acid residue units in the corresponding polypeptide barcode tag on the bead. The RNAi units may be fragments of their sequences. Each RNAi unit may have different sequence differences or nucleoside modifications, thereby forming RNAi molecules with different sequences or chemical modifications.

[0024] In yet another aspect of the present invention, the nucleic acid molecules in the library are mRNA.

[0025] In one aspect of the present invention, the mRNA in the library is formed by sequentially linking multiple mRNA units. In one aspect of the present invention, the mRNA in the mRNA molecule library is obtained by sequentially linking and synthesizing multiple mRNA units. The number m of mRNA units is an integer between 3 and 10, preferably an integer between 4 and 8, for example, n is 4, 5, or 6, which is the same as the number n of amino acid residue units in the corresponding polypeptide barcode tag on the bead. In one aspect of the present invention, the mRNA comprises a 5' cap, a 5' untranslated region (5'UTR), an mRNA coding sequence, a 3' untranslated region (3'UTR), and a polyadenylic acid tail (polyA) linked in sequence. In one aspect of the present invention, the mRNA units can be an mRNA coding sequence or a fragment thereof (a fragment constituting the complete coding sequence), an mRNA flanking region (5'UTR or 3'UTR), and / or a terminal region (such as a 5' cap or a polyA tail). For example, the mRNA can be composed of 5 groups of mRNA units, which are, in order, the 5' cap, the 5' untranslated region, i.e., 5' UTR, the mRNA coding sequence, the 3' untranslated region, i.e., 3' UTR, and the poly A tail, i.e., poly A. In the process of constructing the mRNA library, each unit has a different number of unit members, such as 2-200, or 2-100, or 2-50, or 2-20, or 2-10. For example, when the mRNA unit is an mRNA coding sequence fragment, it can be 2-100 sequence fragments with differently modified nucleosides. For another example, when the mRNA unit is a 5' cap, it can be 2-10 different 5' caps or cap analogs. When 10 groups of mRNA units (e.g., 10 fragments of the mRNA coding sequence, respectively) are used, and each group includes 5 members for synthesis, a library containing 5 will be generated. 10Each bead in the library carries multiple copies of one of the mRNA molecules in the library and has a unique polypeptide barcode tag corresponding to the mRNA bound thereto. In one aspect of the invention, the mRNA unit comprises one or more modifications, for example, wherein the coding region, flanking region and / or terminal region may contain one, two or more (optionally different) nucleoside or nucleotide modifications.

[0026] 5' cap is a modified guanine nucleotide that is connected to the 5' end of the RNA molecule using a 5'-5' triphosphate bond. The term "5' cap" is also intended to encompass other 5' cap analogs, including dinucleotide cap analogs such as 5' diguanosine caps, tetraphosphate cap analogs with methylene-bis(phosphonate) moieties, dinucleotide cap analogs with thiophosphate modifications, cap analogs with sulfur substitutions for non-bridging oxygens, N7-benzylated dinucleoside tetraphosphate analogs, or anti-reverse cap analogs. In one such embodiment, the 5' cap analog is a 5' diguanosine cap. The 5' cap is important for recognizing mRNA and attaching it to the ribosome to begin translation. The 5' cap protects the modified mRNA or RNAi from degradation mediated by 5' exonucleases. It is not an absolute requirement that the modified mRNA or RNAi molecule include a 5' cap, so in yet another aspect of the present invention, the modified mRNA or RNAi molecule lacks a 5' cap. However, due to the longer half-life and increased translation efficiency of the modified mRNA comprising a 5' cap, the modified RNA comprising a 5' cap is preferred in the present invention.

[0027] 5' and / or 3' untranslated region (UTR). The untranslated region is the region of RNA before the start codon (5') and after the stop codon (3'), and is therefore not translated by the translation machinery. Because the untranslated region can interfere with ribonucleases and other proteins involved in RNA degradation, the modification of RNA molecules with one or more untranslated regions can improve the stability of mRNA. In addition, the modification of RNA with 5' and / or 3' untranslated regions can enhance translation efficiency by binding to proteins that change the ribosomes bound to the mRNA. The modification of RNA with 3'UTR can be used to maintain the cytoplasmic localization of RNA, allowing translation to occur in the cytoplasm of the cell. In another aspect of the present invention, the modified mRNA does not include 5' or 3'UTR. In another aspect of the present invention, the modified mRNA includes 5' or 3'UTR. In another aspect of the present invention, the modified mRNA includes both 5' and 3'UTR. In another aspect of the present invention, 5' and / or 3'UTR is selected from mRNAs known to have high stability in cells (e.g., mouse α-globin 3'UTR). In yet another aspect of the invention, the 5'UTR, the 3'UTR, or both comprise one or more modified nucleosides.

[0028] In another aspect of the present invention, the mRNA further comprises a Kozak sequence. The presence of a Kozak sequence near the AUG codon will strengthen the codon as a translation initiation site, allowing correct polypeptide translation to occur. In addition, adding a Kozak sequence to the modified RNA will promote more efficient translation, even if there is no ambiguity about the start codon. Therefore, in another aspect of the present invention, the modified RNA further comprises a Kozak consensus sequence at the desired site for initiating translation to produce a correct length polypeptide. In another aspect of the present invention, the Kozak sequence comprises one or more modified nucleosides.

[0029] In another aspect of the invention, the modified mRNA and / or RNAi molecule further comprises a "poly(A) tail", which refers to a 3' homopolymer tail of adenine nucleotides, the length of which can vary (e.g., at least 5 adenine nucleotides) and can be up to several hundred adenine nucleotides). Including a 3' poly(A) tail can protect the modified RNA from degradation in the cell and also promote extranuclear localization to enhance translation efficiency. In some embodiments, the poly(A) tail comprises between 20 and 300 adenine nucleotides; in other embodiments, the poly(A) tail comprises at least 20, at least 30, at least 50, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 300 adenine nucleotides or more. In another aspect of the invention, the poly(A) tail comprises between 20 and 200 adenine nucleotides. In yet another aspect of the invention, the poly(A) tail comprises one or more modified nucleosides.

[0030] In one aspect of the invention, the mRNA or RNAi units in the library comprise modifications. Examples of mRNA and / or RNAi modifications include, but are not limited to, (a) terminal modifications, such as 5' terminal modifications (phosphorylation, dephosphorylation, conjugation, reverse linkage, etc.), 3' terminal modifications (conjugation, DNA nucleotides, reverse linkage, etc.), (b) base modifications, such as replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded library of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' or 4' position) or replacement of sugars, and (d) internucleoside linkage modifications, including modification or replacement of phosphodiester bonds.

[0031] In the mRNA and / or RNAi of the present invention, the modified nucleoside may include N 6 -methyladenosine

[0032] (m 6A), 5-methoxyuridine (5moU), inosine (I), 5-methylcytosine (m 5 C), pseudouridine (Ψ), 5-hydroxymethylcytosine (hm 5 C), and N 1 -methyladenosine (m 1 A), N1-methylpseudouridine (me(1)ψ), 5-methylcytidine (5mC), 3,2′-O-dimethyluridine (m4U), 2-thiouridine (s2U), 2′fluorouridine, 2′-O-methyluridine (Um), 2′deoxyuridine (2′dU), 4-thiouridine (s4U), 5-methyluridine (m5U), 2′-O-methyladenosine (m6A), N6,2′-O-dimethyladenosine (m6Am), 2′-O-methylcytidine (Cm), 7-methylguanosine (m7G), 2′-O-methylguanosine (Gm), N2,7-dimethylguanosine (m2,7G), and inosine (I), etc.

[0033] The RNA for screening in the nucleic acid library of the present invention can have various activities and functions. In one aspect of the present invention, the RNA is an mRNA encoding a protein or a variant thereof. For example, the mRNA encodes an antibody or a fragment thereof.

[0034] In one aspect of the present invention, the RNA can be used as a vaccine. In another aspect of the present invention, when introduced into mRNA, certain modified nucleosides or combinations thereof will activate the innate immune response. When combined with polypeptides and / or other vaccines, such activating molecules can be used as adjuvants. In another aspect of the present invention, the activating molecule contains a translatable region that encodes a polypeptide sequence that can act as a vaccine, thereby providing the ability to become a self-adjuvant. In another aspect of the present invention, the mRNA can encode an immunogen. Delivery of an mRNA encoding an immunogen can activate an immune response. The mRNA of the present invention can encode the polypeptide sequence of a vaccine and can further include an inhibitor. The inhibitor can weaken and / or inhibit antigen presentation.

[0035] In one aspect of the invention, the RNA can be used as a therapeutic agent. In one aspect of the invention, the mRNA encodes a therapeutic protein. In another aspect of the invention, the protein encoded by the mRNA can increase the natural amount of the protein in the cell. In another aspect of the invention, the mRNA expresses a naturally occurring protein or a variant thereof having improved disease-modifying activity (including increased biological activity, improved patient outcomes, or protective function, etc.).

[0036] In one aspect of the invention, the nucleic acid molecules or small molecule compounds in the library have a cleavable linker releasably attached to the bead. Optionally, the cleavable linker is selected from the group consisting of: a photocleavable linker, a temperature-cleavable linker, a pH-sensitive linker, an acid-cleavable linker, a base-cleavable linker, a sound-cleavable linker, a salt-cleavable linker, a redox-sensitive linker, or a physically cleavable linker; and combinations of two or more of the foregoing. In one aspect of the invention, the cleavable linker is a UV-cleavable linker.

[0037] The present invention also provides a method for screening the aforementioned polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library. The method provided by the present invention for screening the polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library is particularly suitable for high-throughput and rapid screening of libraries containing a large number of nucleic acid molecules or small molecule compounds.

[0038] The method provided by the present invention for screening the above polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library comprises identifying the screened nucleic acid molecules or small molecule compounds by decoding the corresponding polypeptide barcode tags.

[0039] The method provided herein for screening the aforementioned polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library comprises contacting the nucleic acid molecule or small molecule compound library with a biological target. The biological target includes cells and bioactive molecules, such as proteins, nucleic acids, and polysaccharides. The nucleic acids or small molecule compounds in the library can act on the cells and bioactive molecules, and by identifying the results of the action, the desired nucleic acids or small molecule compounds can be screened.

[0040] In one aspect of the present invention, the nucleic acid or small molecule compound can bind to a biological target. For example, nucleic acid-protein or nucleic acid-protein binding occurs, or small molecule-protein binding occurs. In one embodiment of the present invention, the method for screening the above-mentioned polypeptide-encoding nucleic acid library or polypeptide-encoding small molecule compound library comprises contacting the library with a biological target under conditions suitable for binding of the nucleic acid molecules or small molecule compounds in the library to the biological target, optionally removing library members that do not bind to the target, and analyzing tags associated with the small molecule nucleic acid molecules or small molecule compounds that bind to the target.

[0041] In one aspect of the present invention, the nucleic acid or small molecule compound can affect cells.

[0042] In one embodiment of the present invention, in the method for screening a polypeptide-encoding nucleic acid library or a polypeptide-encoding small molecule compound library, the library comprises a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and a nucleic acid molecule or small molecule compound corresponding to the polypeptide barcode tag, wherein the nucleic acid molecule or small molecule compound is releasably attached to the bead.

[0043] In one embodiment of the present invention, the method includes the following steps: (a) providing the library comprising a plurality of beads having different polypeptide barcode tags and corresponding nucleic acid molecules or small molecule compounds; (b) releasing the nucleic acid molecules or small molecule compounds on each bead from the beads to produce a plurality of free nucleic acid molecules or small molecule compounds; (c) contacting the nucleic acid molecules or small molecule compounds on each bead with a single or multiple biological targets (e.g., cells) to screen the nucleic acid molecules or small molecule compounds to produce a plurality of different screened nucleic acid molecules or small molecule compounds; and (d) identifying the screened nucleic acid molecules or small molecule compounds by decoding the polypeptide barcode tags associated therewith.

[0044] Cell has the ordinary meaning used in biology, for example, a cell refers to an autonomous self-replicating unit that can exist as a functionally independent unit of life (e.g., a unicellular organism) or as a subunit of a multicellular organism (e.g., in plants and mammals). However, a cell can also refer to a dormant cell that is generally still capable of undergoing cell division when a mitotic stimulus is applied. In one aspect of the present invention, a cell refers to a prokaryotic cell or a eukaryotic cell, preferably a eukaryotic cell. Eukaryotic cells include mammalian cells, plant cells, and fungal cells, and are preferably mammalian cells.

[0045] Mammal refers to any mammal, including humans, domestic and farm animals, and zoo, sport or pet animals, such as dogs, cats, cows, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is a human.

[0046] In one aspect of the present invention, a method for screening a polypeptide-encoding nucleic acid library is provided, wherein the library comprises a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and a nucleic acid molecule corresponding to the polypeptide barcode tag, wherein the nucleic acid molecule is releasably attached to the bead.

[0047] The method comprises the following steps: (a) providing the library comprising a plurality of beads having different polypeptide barcode tags and corresponding nucleic acid molecules; (b) releasing the nucleic acid molecules of each bead from the bead to produce a plurality of free nucleic acid molecules; (c) contacting the nucleic acid molecules of each bead with a single or multiple biological targets (e.g., cells) to screen the nucleic acid molecules to produce a plurality of different screened nucleic acid molecules; and (d) identifying the screened nucleic acid molecules by decoding the polypeptide barcode tags associated therewith.

[0048] In one aspect of the present invention, step (d) comprises a step of decoding the encoded tag by sequencing the polypeptide barcode tag. In one aspect of the present invention, the sequencing is performed by mass spectrometry, and the information of the polypeptide barcode is read out by mass spectrometry on the sample.

[0049] In one aspect of the present invention, step (d) further comprises the step of removing the polypeptide barcode tag from the beads before performing mass spectrometry sequencing on the polypeptide barcode tag.

[0050] In one aspect of the invention, the nucleic acid molecules in the library are releasably linked to the beads via a cleavable linker. Optionally, the cleavable linker is selected from the group consisting of: a photocleavable linker, a temperature-cleavable linker, a pH-sensitive linker, an acid-cleavable linker, a base-cleavable linker, a sound-cleavable linker, a salt-cleavable linker, a redox-sensitive linker, or a physically cleavable linker; and combinations of two or more of the foregoing. In one aspect of the invention, the cleavable linker is a UV-cleavable linker.

[0051] In one aspect of the invention, step (b) comprises releasing each nucleic acid molecule from the bead under conditions whereby the cleavable linker is cleavable to produce a plurality of free nucleic acid molecules.

[0052] The above-mentioned method of screening a polypeptide encoding nucleic acid library or a polypeptide encoding small molecule compound library provided by the present invention is suitable for use in microfluidic methods and in microfluidic devices. Microfluidics generally refers to a channel in which a fluid circulates with a size of less than 1 mm and includes, for example, from 1 μm to 1 mm. Microfluidic methods generally refer to the use of microfluidic channels with a size of less than 1 mm to manipulate a small amount of fluid (10 -4 to 10 -18 The microfluidic device comprises a microfluidic channel, and its structural forms include a microfluidic device and a microfluidic chip.

[0053] In one aspect of the invention, step (a) of the method comprises encapsulating different beads of the library in a plurality of first discrete entities. In one aspect of the invention, a single one of the plurality of first discrete entities statistically contains one bead.

[0054] In one aspect of the invention, step (c) of the method comprises encapsulating the biological target (e.g., cell) in a plurality of second discrete entities. In one aspect of the invention, a single one of the plurality of second discrete entities statistically contains one cell or a desired number of cells. A plurality of cells may be advantageous for observing the signal produced by the effects of the nucleic acid molecules or small molecules to be screened. A plurality of cells generally refers to 2 to about 50, or 2 to about 16, or 2 to 8 or 2 to 4 cells. In one aspect of the invention, a plurality of cells is obtained by culturing a single cell in a discrete entity. In another aspect of the invention, a discrete entity containing a plurality of cells is obtained by fusing a plurality of discrete entities containing a single cell.

[0055] The term "discrete entity" refers to an emulsion, well, compartment and container capable of encapsulating and / or containing beads connected to polypeptide encoding nucleic acids or small molecules as in the library involved in the present invention, or encapsulating and / or containing the one or a specified number of multiple cells. In one aspect of the present invention, the discrete entity is a droplet. The discrete entity may be spherical or any other suitable shape. The discrete entity has a certain size, for example, a diameter of about 1.0 μm to 1000 μm, such as 1.0 μm to 500 μm, 1.0 μm to 100 μm, 1.0 μm to 10 μm or 1.0 μm to 5 μm. The discrete entity can be generated inside, on or by a microfluidic device and / or flow out of a microfluidic device or applied by a microfluidic device.

[0056] In one aspect of the present invention, the discrete entities as described herein are droplets. The terms "droplet" and "droplet" are sometimes used interchangeably herein to refer to small, generally spherical structures that contain at least a first fluid phase, such as an aqueous phase (e.g., water), surrounded by a second fluid phase (e.g., oil) that is immiscible with the first fluid phase. In some embodiments, the second fluid phase will be an immiscible phase carrier liquid. In the present invention, the droplets are preferably water-in-oil emulsions, which are advantageous for encapsulating cells, nucleic acids, enzymes, reagents, and various other components and for conducting cultures or reactions therein.

[0057] A wide range of different emulsification methods are well known to those skilled in the art, any of which can be used to produce the droplets of the present invention. Many emulsification techniques involve mixing two liquids in large quantities, often using turbulence to enhance droplet breakup. Such methods include vortexing, sonication, homogenization, or combinations thereof.

[0058] The size of the droplets follows a probability distribution, such as a Gaussian distribution. It will be further understood that the parameters for preparing the microfluidic droplets can be selected to obtain a plurality of microfluidic droplets having a specific volume. Preferably, the droplets in the present invention are monodisperse, having substantially the same shape and / or size. The volume or size of a droplet refers to the average volume or size of a plurality of droplets. One of ordinary skill in the art will be able to determine the average diameter of a droplet population, for example using laser scattering or other known techniques. The droplets can be spherical or, in some cases, non-spherical. The diameter of a droplet (particularly a non-spherical droplet) can be the diameter of a perfect mathematical sphere having the same volume as the non-spherical droplet.

[0059] In one aspect of the invention, a single bead of the library is encapsulated within a single droplet. In one aspect of the invention, a single or a desired number of biological targets, such as cells, are encapsulated within a single droplet. In one aspect of the invention, a single bead and a single or a desired number of biological targets, such as cells, and other reagents are encapsulated within a single droplet. In one aspect of the invention, a single bead or a single or a desired number of biological targets, such as cells, and other reagents are encapsulated within a single droplet.

[0060] Various known methods can be used to controllably encapsulate particles such as beads or cells into droplets. For example, PCT / EP2016 / 080341 describes techniques for encapsulating cells within microfluidic droplets. Those skilled in the art can readily derive techniques for preparing droplets containing other types of particles and / or containing reagents dissolved in solution from the same disclosure (e.g., PCT / EP2016 / 080341).

[0061] In one aspect of the present invention, particles, such as beads or cells, can be controllably encapsulated into droplets using, for example, inertial sorting. The particles, such as beads or cells, flow through a channel at high speed, causing inertial effects to become significant and inertial sorting of the particles within the channel, resulting in periodic spacing of the particles. The period of the particle-containing liquid flow can then be matched to the droplet generation period of a droplet maker, enabling efficient particle encapsulation within droplets.

[0062] In one aspect of the present invention, the microfluidic device used in the method of screening polypeptide-encoding nucleic acids or small molecule compound libraries of the present invention includes a droplet generation unit for preparing beads containing biological targets such as cells or libraries and / or droplets containing reagents dissolved in solution. The droplet generation unit typically includes an inlet for a droplet carrier oil (carrier fluid) and another inlet for the droplet aqueous phase component. For the carrier oil, typically, a fluorinated oil (e.g., HFE-7500) containing, for example, 0.75% (w / w) surfactant (PFPE-PEG-PFPE triblock copolymer containing two perfluoropolyether blocks (PFPE) and one polyethylene glycol (PEG) block) is commonly used. The surfactant is generally used to prevent droplet coalescence, and its amount can be adjusted, for example, based on the physicochemical properties of the surfactant used. The carrier oil used for emulsification is not limited to fluorinated liquids, and alternative fluids such as hydrocarbon-based fluids (e.g., mineral oil, hexane, etc.), silicone oil, and other types of oils can be successfully used. For fluidics used to prepare beads from single cells / single libraries, one inlet is typically used for droplet carrier oil, and there is typically an additional inlet for delivering a suspension of beads from cells / single libraries. For fluidics used to prepare droplets containing reagents dissolved in solution, one inlet is typically used for droplet carrier oil, and one or more additional inlets are used to deliver different reagents. There may also be an inlet for delivering a suspension of beads from cells / single libraries.

[0063] In one aspect of the present invention, in step (c) of the method for screening a library of polypeptide-encoding nucleic acids or small molecule compounds, the contact of the nucleic acid molecule or small molecule compound on each bead of the library with a single or a desired number of biological targets such as cells is confined to a microcompartment.

[0064] The microcompartment is physically confined to a single or desired number of cells (e.g., the cells are exposed to within 1000 μm of each nucleic acid molecule or small molecule compound) and isolated from other nucleic acid molecules or small molecule compounds or cells. Microcompartments include microfluidic channels, droplets, microparticles, micropores, and microbubbles. In the present invention, the preferred microcompartment is a droplet.

[0065] In one aspect of the invention, the method comprises encapsulating a single bead of the library and a single cell or a desired number of multiple biological targets, such as cells, within a single microcompartment. In one aspect of the invention, the method comprises encapsulating a single bead of the library and a single biological target, such as a cell, or a desired number of multiple biological targets, such as cells, and other reagents (e.g., reagents for detecting a biological response elicited by the nucleic acid molecule or small molecule compound in the cell) within a single microcompartment.

[0066] In one aspect of the invention, the method comprises encapsulating a single bead from the library and a single biological target, such as a cell, within a single discrete entity, such as a droplet. In one aspect of the invention, the method comprises encapsulating a single bead from the library and a desired number of multiple biological targets, such as cells, within a single discrete entity, such as a droplet. In yet another aspect of the invention, the method comprises encapsulating a single bead from the library and a single biological target, such as a cell, or a desired number of multiple biological targets, such as cells, and other reagents (e.g., reagents for detecting a biological response elicited by the nucleic acid molecule or small molecule compound in the cell) within a single droplet.

[0067] In one aspect of the present invention, a solution (such as an aqueous solution) containing the beads of the library or the biological target such as cells is introduced through two intersecting microfluidic channels, and an emulsion droplet containing the beads of the library or the biological target such as cells is formed at the interface with the introduced carrier liquid (such as oil). In another aspect of the present invention, other reagents (such as reagents for detecting biological responses caused by the nucleic acid molecules or small molecule compounds in cells) can be added to the above-mentioned solution (such as an aqueous solution) containing the beads of the library or the cells. In another aspect of the present invention, a solution containing other reagents (such as reagents for detecting biological responses caused by the nucleic acid molecules or small molecule compounds in cells) is introduced through a microfluidic channel other than the solution (such as an aqueous solution) containing the beads of the library or the biological target such as cells that is introduced through two intersecting microfluidic channels.

[0068] In one aspect of the present invention, the method comprises encapsulating a single bead of the library and a single biological target, such as a cell, in a single discrete entity, such as a droplet. In one aspect of the present invention, a single bead of the library is encapsulated in a single first droplet, and a single or desired number of biological targets, such as cells, are encapsulated in a single second droplet, and then the first droplet containing the bead and the second droplet containing the cell are combined to form a single droplet. In another aspect of the present invention, in the above method, the single bead and / or the single or desired number of biological targets, such as cells, are encapsulated in a single droplet with other reaction reagents (such as reagents for detecting biological responses induced by the nucleic acid molecule or small molecule compound in the cell).

[0069] In one aspect of the present invention, the method includes the step of forming a one-to-one paired combination of a first droplet and a second droplet. In another aspect of the present invention, the method includes the step of merging the one-to-one paired combination of the first droplet and the second droplet. In one aspect of the present invention, the merged single droplet is obtained by applying an electric field to the paired combination of the first droplet and the second droplet.

[0070] Various methods known in the art can be used to form a one-to-one paired combination of the first droplet and the second droplet. For example, the first droplet and the second droplet can be added separately through two intersecting microchannels, and by controlling the microchannel size and flow rate, an orderly periodic spacing of the droplets can be caused. Then, the period of the liquid flow entering the first droplet can be matched with the period of the liquid flow entering the second droplet, so that the first droplet and the second droplet form a one-to-one paired combination in the form of "ABAB" at the channel interface. In another aspect of the present invention, the step of contacting the first droplet and the second droplet that form a one-to-one pairing to apply an electric field thereto is also included. One embodiment is to make the first droplet and the second droplet have different volumes, so that the smaller droplet "catch up" with the larger droplet in the flow channel to form a contacting droplet group. Then, the adjacent droplets can be merged by applying an electric field to them as known in the art.

[0071] Fluid droplets can be merged using any suitable technique. For example, in a microfluidic system, the surface tension of the droplets, which is related to the size of the droplets, can prevent the merging or coalescence of the droplets from occurring. In one embodiment, two droplets can be given opposite charges (i.e., positive and negative charges, not necessarily of the same magnitude), which can enhance the electrical interaction of the two droplets, allowing the merging and coalescence of the droplets to occur. The charge (positive or negative) can be imparted to the droplets using a Taylor cone or any other suitable technique. For example, an electric field can be applied to a reactor containing the droplets, the droplets can pass through a container, a chemical reaction can occur that causes the droplets to become charged, the droplets can be caused to flow through an area with opposite wetting properties, and the like.

[0072] In one aspect of the present invention, a microfluidic device for preparing droplets of beads containing cells or libraries and / or reagents dissolved in a solution includes a droplet merging unit for merging two or more droplets. In one aspect of the present invention, the droplet merging unit comprises: intersecting flow channels for respectively inputting a first droplet and a second droplet; a flow channel for forming a one-to-one pairing of the first droplet and the second droplet; and a droplet merging electric field for applying an electric field to the paired first and second droplets to cause the first and second droplets to merge into a single droplet.

[0073] In one aspect of the present invention, the method further comprises the step of sorting the first discrete entity containing the beads or the second discrete entity containing cells from the discrete entities, such as droplets. The sorting can be performed by methods known in the art, such as fluorescence-activated droplet sorting (FADS) or deterministic lateral displacement (DLD).

[0074] The method of the present invention aims to encapsulate a single bead or a single biological target, such as a cell (or a specified number of cells), in each droplet. However, because discrete targets, such as molecules, beads, and cells, are typically randomly encapsulated, the encapsulation statics follow a Poisson distribution, resulting in many empty and unusable droplets. When attempting to co-encapsulate two discrete targets, such as a cell and a bead, the vast majority of droplets produced will be empty or contain a single cell or bead, with a very small fraction containing both cells and beads. One approach to overcome this inefficiency is to perform sorting.

[0075] Fluorescence activated droplet sorting (FADS) is an adaptation of the established fluorescence activated cell sorting (FACS) equipment and protocols to sort the generated droplets. For example, it is described in Baret et al. (2009) Lap Chip 9:1850-1858. Any change that can be detected using a fluorescent moiety can be screened. Target cells can be fluorescently labeled to enable FADS. A variety of fluorescent proteins can be used as labels for this purpose. In addition, a very wide range of dyes that fluoresce at specific levels and conditions within the cell can be used. Examples include those purchased from Molecular Probes (Thermo Scientific). In one aspect of the invention, cellular components can be detected with antibodies, which can be stained with any number of fluorophores using commercially available kits.

[0076] DLD is achieved by providing a columnar matrix in the microfluidic device, where the fluid streamlines between two adjacent columns are divided into several parts. For large particles, because the particle diameter is larger than the critical screening size, their movement trajectory will produce a lateral offset along the offset direction of the column array; for small particles, they will move along the fluid streamlines close to the columns, and the direction of movement is basically unchanged, that is, moving forward in a straight line. Large and small particles enter the flow channel together and move forward in different directions. After passing a certain screening distance, the large and small particles in the downstream flow channel (for example, droplets containing target particles and droplets without "blank bag" particles) are located on both sides of the flow channel respectively.

[0077] In the polypeptide encoding nucleic acid or small molecule compound library provided by the present invention or the library analyzed by the aforementioned method of the present invention, there are a large number of beads with different polypeptide encoding nucleic acids or small molecule compounds. The number is, for example, >10 4 ; or >10 5 ; or >10 6 ; or >10 7 ; or >10 8 ; or >10 9 ; or >10 10 ; or >10 11The present invention also provides a discrete entity library obtained by encapsulating the beads of the library into a single discrete entity such as a droplet (with or without sorting), wherein the discrete entity library comprises a large number of discrete entities such as droplets containing different beads (with different polypeptide encoding nucleic acids or small molecule compounds thereon), for example, a number of >10 4 ; or >10 5 ; or >10 6 ; or >10 7 ; or >10 8 ; or >10 9 ; or >10 10 ; or >10 11 .

[0078] In the discrete entity libraries provided herein, or in the screening methods provided herein, because the nucleic acid molecules or small molecules and cells are confined within the discrete entities or microcompartments, they can be present at sufficiently high concentrations for action, such as less than 1 nM; 1 to 100 nM; greater than 100 nM; less than 1 μM; 1 to 100 μM; greater than 100 μM; 5 to 50 μM; or 10 to 20 μM.

[0079] In one aspect of the present invention, in step (b) of the screening method, the free nucleic acid molecules or small molecule compounds are released into the first discrete entity. In the present invention, each nucleic acid molecule is released from the bead under conditions where the cleavable linker is cleavable to produce a plurality of free nucleic acid molecules. In one aspect of the present invention, the polypeptide barcode tag is retained on the bead.

[0080] In one aspect of the present invention, in step (c) of the screening method, the free nucleic acid molecule or small molecule compound (e.g., by diffusion) contacts the biological target, for example, enters the cell. In the method of the present invention, various methods known in the art for promoting cell permeability to extracellular nucleic acids or small molecules can be used to promote the entry of free nucleic acid molecules or small molecules into the cell (e.g., by diffusion). For example, electroporation or spatial squeezing can be used to create transient pores in the cell membrane, thereby promoting the entry of free nucleic acid molecules or small molecules into the cell.

[0081] The methods of the present invention are used to screen libraries of polypeptide-encoding nucleic acids or small molecule compounds to obtain drugs, reagents, sensors, or materials with desired properties and functions, such as enhanced properties and functions. In one aspect of the present invention, the screening method is used to obtain nucleic acids with enhanced biological functions, particularly RNA, such as mRNA and RNAi, for use in therapeutic or prophylactic drugs or vaccines.

[0082] In one aspect of the present invention, step (c) of the screening method comprises incubating cells to allow them to produce a biological response induced by the nucleic acid molecule or small molecule compound. In the present invention, the biological response can be the expression or non-expression of the target protein, or an increase or decrease in expression, or the stability of the target protein. The target protein can be a protein encoded by the mRNA of the bead or a protein in the cell that is affected by the protein encoded by the mRNA of the bead. In the present invention, the biological response can also be the survival or death of the cell, or the binding or neutralization of a virus contained in the cell.

[0083] In one aspect of the invention, the assay can detect morphological responses of cells, such as migration, as well as genetic and biochemical responses. The methods of the invention are used to detect biological responses that generate a signal.

[0084] In one aspect of the present invention, step (c) in the method is carried out in a microcompartment (e.g., droplet), comprising a reagent for detecting a biological response caused by the nucleic acid molecules or small molecule compounds in the microcompartment. The signal entity may include, but is not limited to, fluorescent dyes, chemiluminescent entities, radioactive labels, isotopes such as non-radioactive isotopes or isotopes (e.g., charged group mass labeling EML) that can be detected by mass spectrometry, part of the specific binding partner of a labeled antibody, enzyme, antibody, antigen, group with specific reactivity, and / or electrochemically detectable portion. Non-limiting examples of fluorescent signal entities include fluorescein, rhodamine, or hexachlorofluorescein.

[0085] In one aspect of the present invention, the reagent may be a fluorescent signal generated by detecting the biological response. For example, the reagent may comprise an antibody that can recognize a specific protein. For example, the reagent may label a fluorescent signal entity, and a quencher or enhancer. Non-limiting examples of applicable fluorescent entities include 6-carboxyfluorescein and tetrachlorofluorescein. The quencher or enhancer can be any entity that can affect the signal entity in a certain way, for example by inhibiting or facilitating the determination of the signal entity, respectively. For example, the proximity of the fluorescent signal entity and the quencher can enable the quencher to partially or completely inhibit the fluorescence of the signal entity, while when the enhancer is in the vicinity of the signal entity, the enhancer can be able to enhance the fluorescence of the fluorescent signal entity.

[0086] In the present invention, the method for determining the marker component and / or signal entity will depend on the components present in the fluid droplet. As described above, techniques such as radioactivity, fluorescence, phosphorescence, light scattering, light absorption, and fluorescence polarization can be used for determination. Many detectors operating using these principles are commercially available. The detectors can be used to determine at least one signal entity and / or marker component that may be present in the fluid droplet. In some cases, more than one detector can be used.

[0087] In some embodiments, the droplets are deformed so that the signal entities and / or identification components contained in the droplets pass through the detector in a single line. In some embodiments, detection can be performed in parallel, that is, many signal entities and / or identification components can be measured simultaneously in one channel and / or multiple channels. For example, a timing device can be used to synchronize the detection of parallel pathways. Another non-limiting example of parallel detection is the use of a camera or other imaging device that is arranged to be able to capture more than one channel, for example, simultaneously. The camera can be, for example, a line scan camera, a 2D CCD camera, etc.

[0088] In the present invention, the response to a candidate nucleic acid molecule or small molecule compound can be assessed by one or more biomarkers. Biomarkers include diagnostic biomarkers, biomarkers that predict whether a particular patient will respond (get better) to a particular drug, and biomarkers that predict whether a particular patient will produce unacceptable toxicity to a particular drug. Biological responses also include cytokine expression. Responses can be assessed by measuring expressed cytokines such as IL-2, IL-4, IL-6, IL-10, IFN-γ, and TNF-α.

[0089] In the methods of the present invention, after particles from cells with a desired signal are observed, the particles are sorted. Similarly, fluorescence-activated droplet sorting (FADS) can be used to sort the desired droplets. In one aspect of the present invention, step (d) of the method includes the step of collecting the selected droplets. In one aspect of the present invention, step (d) of the method includes the step of disrupting the collected droplets and collecting the beads.

[0090] The present invention also provides a microfluidic device for screening a polypeptide encoding nucleic acid or a small molecule compound library. In one aspect of the present invention, the microfluidic device is suitable for screening the polypeptide encoding nucleic acid library or polypeptide encoding small molecule compound library of the present invention.

[0091] The microfluidic device provided by the present invention generally includes one or more of the following units:

[0092] a droplet generation unit for preparing beads containing biological targets (e.g., cells) or a library of polypeptide-encoding nucleic acids or a library of polypeptide-encoding small molecule compounds and / or droplets containing reagents dissolved in a solution;

[0093] a droplet merging unit for merging two or more droplets;

[0094] A biological target response unit, used to allow a nucleic acid library or a polypeptide-encoded small molecule compound library to contact a biological target to generate a biological response caused by the nucleic acid molecules or small molecule compounds; or

[0095] Optionally, a droplet sorting device.

[0096] In one aspect of the present invention, the biological target response unit is a cell culture unit, which is used to culture cells to allow them to produce biological responses induced by the nucleic acid molecules or small molecule compounds.

[0097] In one aspect of the present invention, the droplet generation unit includes: an inlet for droplet carrier oil (carrier fluid), and another inlet for droplet aqueous phase components, and optionally, an inlet for adding other reagents (such as reagents for detecting biological responses caused by the nucleic acid molecules or small molecule compounds in cells).

[0098] In one aspect of the present invention, the droplet merging unit includes: intersecting flow channels for respectively inputting a first droplet and a second droplet; a flow channel for forming a one-to-one pairing of the first droplet and the second droplet; and a droplet merging electric field for applying an electric field to the paired first droplet and the second droplet so that the first droplet and the second droplet merge into a single droplet.

[0099] In one aspect of the present invention, the cell culture unit comprises a temperature control device.

[0100] In one aspect of the present invention, the sorting device is a fluorescence activated droplet sorting device or a deterministic lateral deviation device.

[0101] In one aspect of the present invention, the microfluidic device includes a cell processing unit for treating cells to increase their permeability to extracellular nucleic acids or small molecules. For example, the cell processing unit includes a structure for implementing electroporation or spatial squeezing to transiently perforate the cell membrane.

[0102] In one aspect of the present invention, the microfluidic device has an ultraviolet light emitting device.

[0103] In one aspect of the present invention, the microfluidic device includes a mass spectrometry device. BRIEF DESCRIPTION OF THE DRAWINGS

[0104] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0105] FIG1 is a schematic diagram of beads in the RNA library provided by the present invention.

[0106] FIG2 is an exemplary flow chart of the present invention for screening a polypeptide encoding RNA library using a microfluidic device.

[0107] FIG3 is a schematic diagram of an exemplary method and apparatus for forming droplets containing single cells.

[0108] FIG4A and FIG4B are respectively a schematic diagram and a result diagram of an exemplary screening of droplets containing a single mRNA library bead using the DLD method.

[0109] FIG5 is a schematic diagram illustrating an exemplary process of reinjecting a first droplet containing a single bead and a second droplet containing a single cell.

[0110] FIG6 is a schematic diagram of applying an electric field to a droplet through electroporation to cause transient perforation of the cell membrane, thereby promoting the entry of free mRNA nucleic acid molecules into the cell.

[0111] FIG. 7 is a graph showing exemplary results of an incubation zone of droplets containing mRNA library beads and cells.

[0112] FIG8 is a diagram showing the mRNA sequence encoding G-CSF. DETAILED DESCRIPTION

[0113] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0114] Example 1 Construction of polypeptide encoding mRNA library

[0115] This experiment provides a method for preparing a polypeptide encoding mRNA library, wherein the library comprises a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and an RNA molecule corresponding to the polypeptide barcode tag, wherein the RNA molecule is releasably attached to the bead.

[0116] Figure 1 is a schematic diagram of an exemplary bead in an RNA library provided by the present invention. As shown, the bead surface has RNA molecules and molecular barcodes, wherein the molecular barcodes are polypeptides. The RNA can be mRNA. In the case of a small molecule compound library, the bead surface contains small molecule compounds.

[0117] In the present invention, the polypeptide barcode tag is formed by sequentially linking n amino acid residue building blocks. n is an integer between 3 and 10, preferably an integer between 4 and 8, for example, 4, 5, or 6. Each amino acid residue building block may be composed of one or more amino acid residues, for example, each amino acid residue building block includes one, two, or four amino acid residues. In the present invention, the RNA molecule is formed by sequentially linking m nucleic acid units, where m is the same as the number n of amino acid residue building blocks in the polypeptide barcode tag. Each nucleic acid unit and each amino acid residue building block are assembled sequentially and alternately onto the bead. The sequential and alternating assembly of nucleic acid units and amino acid residue building blocks ensures that the polypeptide barcode tag formed on each bead, composed of the multiple amino acid residue building blocks, is unique and corresponds to the nucleic acid molecule composed of the multiple nucleic acid units on the same bead. Based on the sequence information of the polypeptide barcode tag, the composition information of the corresponding nucleic acid molecule, including the nucleic acid sequence and nucleoside species determined by the multiple nucleic acid units, can be obtained.

[0118] In the present invention, the number of different nucleic acid molecules contained in the library is determined by the number of groups of nucleic acid units and the number of members in each group of nucleic acid units, and the number of nucleic acid molecules increases exponentially with the number of synthesis steps (which determines the number of groups of nucleic acid units) and building blocks (i.e., the number of members in each group of nucleic acid units). This strategy enables the number of nucleic acid molecules in the library to reach the scale of hundreds of millions or even hundreds of billions. For example, when four groups of mRNA units are used (e.g., the 5' untranslated region, i.e., 5'UTR, mRNA coding sequence, 3' untranslated region, i.e., 3'UTR, and poly A tail, i.e., polyA, of mRNA in order), and each group includes 10 members for synthesis, a library containing 10 4 For example, when 10 groups of mRNA units (e.g., 10 segments of mRNA coding sequences) are used for synthesis, and each group includes 5 members, a library containing 5 mRNA molecules will be generated. 10 Each bead in the library has multiple copies of one of the mRNA molecules in the library and has a unique polypeptide barcode tag corresponding to the mRNA bound to it. Based on the sequence information of the polypeptide barcode tag of each bead, the composition information of the corresponding nucleic acid molecule can be obtained, including the nucleic acid sequence determined by the multiple nucleic acid units, the type of nucleotides, etc.

[0119] In this example, the polypeptide encoding granulocyte colony stimulating factor was prepared by the following method:

[0120] The full-length mRNA library of (G-CSF) has mRNA units connected in the following order: 5' cap and 5' untranslated region (5'UTR), mRNA coding sequence or a fragment thereof, 3' untranslated region (3'UTR), poly A tail (polyA).

[0121] Materials and Reagents: Fmoc-L-Asp(OAll)-Wang Resin (0.8 mmol / g, 100-200 mesh, 1% DVB) and labeled amino acids 1-20 (20 Fmoc-protected carboxylic acids) were purchased from Jier Biochemical (Shanghai) Co., Ltd. Piperidine, DCC, HOBt, HATU, HOAt, All-hydroxyethyl photocoupler crosslinker, and trifluoroacetic acid were all purchased from SIGMA. Other chemical reagents were purchased from Inokai Chemical Reagent Co., Ltd.

[0122] Step 1. Functionalization of the resin

[0123] Silanization treatment of peptide reaction tubes: Pour 10% trimethylsilyl chloride-toluene solution into the reaction tube and let it sit overnight. Filter (the filtrate can be reused). After treatment, the reaction tube walls will not stick to the resin. Add 803 mg of Fmoc-L-Asp(OAll)-Wang Resin (0.8 mmol / g, 100-200 mesh, 1% DVB) to the peptide synthesis tube. Add 10 mL of dichloromethane, stir under nitrogen, and swell the resin for 5 minutes. Filter the DCM and wash once with 10 mL of DMF. After fully swelling with acetonitrile, add 10 mM PhSiH3, Pd(PPh3)4, and 10 mL of DCM. After 30 minutes, filter the solution and wash with acetonitrile. Add 10 mL of dichloromethane, stir under nitrogen, and swell the resin for 5 minutes. Filter the DCM and wash once with 10 mL of DMF. Repeat this washing process three times. Add 0.3 g of THP-hydroxyethyl photocoupler crosslinker (1.0 mmol), anhydrous acetonitrile, DCC, and HOBt, and shake at room temperature for 24 hours. Remove the solution by filtration, wash with acetonitrile, and obtain a photosensitive functionalized resin.

[0124] Step 2. Immobilization of amino acid tag 1

[0125] Add 10 mL of 20% piperidine-DMF solution to the tube, stir under nitrogen for 5 minutes, and filter. Add another 10 mL of 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, and filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Divide the resin into five equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 1-5 (D, S, E, G, H) (3 times the amount of resin). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube, sequentially. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube, shake well, activate the carboxyl groups for 5 minutes, then pour into reaction tubes 1 to 5 and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Then add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol) and heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when Fmoc proline is attached) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0126] Step 3. Immobilization of 5'-cap-5'-UTR fragment

[0127] The 5'-UTR of human α-globin was adopted and the optimization of the Kozak sequence was integrated to introduce five 5'-UTR sequence members:

[0128] 1)GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACCATG

[0129] 2)GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCGCCATG

[0130] 3)GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGTTACCATG

[0131] 4)GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCATTATG

[0132] 5)GAGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCACCATG

[0133] All sequences were customized by Shanghai Jierui Bioengineering Co., Ltd. The synthesized DNA template was used to complete the in vitro transcription and capping reaction (ARCA cap) of the 5'-UTR sequence RNA by in vitro transcription to obtain a 5'-UTR sequence with a 3'-0-Me-m7G(5')ppp(5') cap at 5'.

[0134] Dissolve the capped 5-UTR in RNase-free water and add it to the five reaction vessels containing polypeptide tags corresponding to step 2.

[0135] After the resin prepared in step 2 is fully swollen with acetonitrile, 10mM PhSiH3, Pd(PPh3)4, and 10ml DCM are added. After 30 minutes, the solution is removed by suction filtration. After washing with acetonitrile, 10mL of dichloromethane is added respectively, and nitrogen is blown and stirred. After swelling the resin for 5 minutes, the DCM is filtered and washed once with 10mL of DMF. This washing is repeated three times. The functionalized resin with Allyl protection removed is added to the above five 5' cap-5'-UTRs respectively, and anhydrous acetonitrile, DCC, and HOBt are added in sequence. After covering, the reaction is stirred under nitrogen bubbling at room temperature for 24 hours.

[0136] Step 3: Ligation of G-CSF mRNA

[0137] The resins from 5 reactors were combined into 1 reactor.

[0138] The full-length mRNA of G-CSF was prepared by Shanghai Jierui Bioengineering Co., Ltd., and the coding sequence was referenced to NCBI Reference Sequence: NM_172220.3 (see Figure 8 for the sequence).

[0139] The G-CSF mRNA ligation was performed using standard T4 RNA Ligase 1 protocols. The prepared G-CSF mRNA was denatured at 65°C, then added to the reaction vessel and washed three times with RNase-free water. A mixture of 10× Reaction Buffer, T4 RNA Ligase 1, RNase Inhibitor, ATP (10mM), and PEG8000 was added to the reaction system at a ratio of 4:2:1:4:8. The mixture was then added to the reaction system at once and incubated at 37°C with nitrogen bubbling for 30 minutes. The reaction was stopped and the cells were thoroughly washed three times with RNase-free water. This completed the G-CSF mRNA ligation.

[0140] Step 4. Immobilization of amino acid tag 2

[0141] Combine the resins obtained in step 3, add 10 mL of a 20% piperidine-DMF solution to the tube, stir under nitrogen for 5 minutes, and filter. Then, add another 10 mL of a 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, and filter. Stir under nitrogen for 1 minute, and filter. Then, add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Divide the resin into five equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 6-10 (R, T, A, P, C) (3 times the amount of resin). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube, sequentially. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube, shake well, activate the carboxyl groups for 5 minutes, then pour into reaction tubes 1 to 5 and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Then add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol) and heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when Fmoc proline is attached) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0142] Step 5. 3'-UTR ligation

[0143] Using the 3'-UTR sequence of α-globin as a template, we adjusted some bases to optimize translation efficiency and introduced five 3'-UTR sequences, as follows:

[0144] 1)GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA

[0145] 2)GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTAAAATTCCTGCACCCGTAAAAAGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA

[0146] 3)GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTAAAAAAAGCCCCTCCTAAAATTCCTGCACCCGTACCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA

[0147] 4)GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTAAAAAGTGGTCTTTGAATAAAGTCTGAGTTTTCGGCA

[0148] 5)GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTTTTCCTAAAAAAAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCGTGGTCTTTGAATAAAGTCTGAGTTTTCGGCA

[0149] The sequence was prepared by Shanghai Jierui Bioengineering Co., Ltd. The above 3'-UTR was dissolved in RNase-free water and added to the five reaction vessels containing peptide tags corresponding to step 4. The vessels were then washed three times with RNase-free water. The 3'-UTR was linked to the mRNA according to the technical protocol of T4 RNA Ligase 1. The specific operation was as follows: 10 x Reaction Buffer, T4 RNA Ligase 1, RNase Inhibitor, ATP (10mM), and PEG8000 were mixed in a ratio of 4:2:1:4:8, added to the reaction system at one time, and reacted at 37 degrees Celsius with nitrogen bubbling for 30 minutes. The reaction was stopped and the vessels were thoroughly washed three times with RNase-free water.

[0150] Step 6. Immobilization of amino acid tag 3

[0151] Combine the resins obtained in step 5, add 10 mL of a 20% piperidine-DMF solution to the tube, stir under nitrogen for 5 minutes, and filter. Add another 10 mL of a 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, filter, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Divide the resin into five equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 11-15 (L, F, W, Q, N) (3 times the amount of resin). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube in sequence. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube and shake well. After activating the carboxyl groups for 5 minutes, pour the mixture into reaction tubes 1 to 5 and react under nitrogen for 1 hour. Filter. Add another 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol). Heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when linked to Fmoc proline) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0152] Step 7. Adding tail of Poly A

[0153] The length of the poly A tail has a significant impact on the efficiency of mRNA translation and the number of times it is expressed. A length of 110 to 150 is generally suitable. This invention uses five poly A tails with lengths of 110, 120, 130, 140, and 150, all custom-made by Shanghai Jierui Bioengineering Co., Ltd.

[0154] Denature the mRNA-loaded resin at 65°C and rinse three times with RNase-free water. Ligate the poly A tail to the mRNA using T4 RNA Ligase 1. Specifically, mix 10x Reaction Buffer, T4 RNA Ligase 1, RNase Inhibitor, ATP (10mM), and PEG8000 in a ratio of 4:2:1:4:8, add all at once, and incubate at 37°C with nitrogen bubbling for 30 minutes. Stop the reaction and rinse thoroughly three times with RNase-free water.

[0155] This method generates a library of full-length G-CSF mRNAs encoding polypeptides. The mRNAs comprise mRNA units linked in the following order: a 5' cap and a 5' untranslated region (5'UTR), an mRNA coding sequence or a fragment thereof, a 3' untranslated region (3'UTR), and a polyadenylation tail (polyA). The library includes candidate mRNAs with full-length G-CSF coding sequences possessing five different 5' cap-5'UTR sequences, five different 3'UTR sequences, and five different polyT sequences, resulting in a library capacity of 5 x 5 x 5 = 125 mRNAs. Each candidate mRNA has a unique polypeptide barcode tag.

[0156] Example 2 Screening of mRNA Peptide Encoding Libraries Using Microfluidic Devices

[0157] The present invention provides a method for screening a polypeptide-encoding RNA library, which comprises the following steps: (a) providing the library comprising a plurality of beads having different polypeptide barcode tags and corresponding nucleic acid molecules or small molecule compounds; (b) releasing the nucleic acid molecules or small molecule compounds on each bead from the beads to produce a plurality of free nucleic acid molecules or small molecule compounds; (c) contacting the nucleic acid molecules or small molecule compounds on each bead with a single or multiple cells to screen the nucleic acid molecules or small molecule compounds to produce a plurality of different screened nucleic acid molecules or small molecule compounds; and (d) identifying the screened nucleic acid molecules or small molecule compounds by decoding the polypeptide barcode tags associated therewith.

[0158] The methods provided herein for screening polypeptide-encoding nucleic acid libraries or polypeptide-encoding small molecule compound libraries are suitable for use with microfluidics methods and microfluidic devices. Microfluidic devices are used to contain and transport fluidic materials such as liquids, and their flow channels have dimensions on the micrometer or even nanometer scale. Typical microfluidic devices typically include structural and functional units on the millimeter scale or smaller.

[0159] In the present invention, individual beads and / or individual or desired numbers of cells from a library can be encapsulated within droplets. The droplets are manipulated using microfluidics to allow candidate RNA molecules carried on the beads to interact with individual cells or cell clusters within a closed microspace, thereby screening for the desired RNA molecules.

[0160] FIG2 is an exemplary flow chart of the present invention using a microfluidic device to screen a polypeptide encoding RNA library. As shown in FIG2 , a single bead (microbead) of the library is encapsulated in a single first droplet, and a single or desired number of cells are encapsulated in a single second droplet, and the cells are sorted by fluorescence-activated droplet sorting (FADS) or deterministic lateral displacement (FADS). The invention relates to a method for screening droplets containing beads or cells by using a displacement method (DLD); treating the droplets containing the beads to allow each nucleic acid molecule to fall off the beads under conditions where a cleavable linker can be cleaved (e.g., UV irradiation) to obtain droplets containing free RNA molecules; then pairing a first droplet containing a single bead and a second droplet containing a single cell after screening, merging them into a single droplet, incubating cells in the merged droplet, observing and screening (e.g., by FADS) droplets that exhibit a desired improved biological response, collecting the screened droplets, breaking the droplets, separating and collecting the desired beads, and then removing and decoding the polypeptide barcode tag from the beads to obtain information about the corresponding RNA molecule, including the sequence or modifications it carries, based on the polypeptide barcode.

[0161] In one aspect of the present invention, co-incubating the nucleic acid molecules to be screened with multiple cells is beneficial for observing the signals generated by the effects of the nucleic acid molecules to be screened. Therefore, before droplet pairing, the method may further include a step of subjecting the droplets containing single cells to cell culture or fusing multiple droplets containing single cells to obtain droplets containing multiple cells.

[0162] In one aspect of the present invention, the method comprises forming droplets from a single bead or a single cell or a desired number of cells of the library, adding other reagents (such as reagents for detecting biological responses caused by the nucleic acid molecules or small molecule compounds in cells) to the solution, thereby introducing the reagents for subsequent reactions into the microenvironment (droplets) in which the cells are incubated.

[0163] In another exemplary method of the present invention using a microfluidic device to screen a polypeptide-encoding RNA library, the difference from the process of Figure 2 is that when forming droplets, a single bead (microbead) of the library and the single or desired number of cells are encapsulated in the same droplet. The droplets containing the beads and cells are then screened by fluorescence-activated droplet sorting (FADS) or deterministic lateral displacement (DLD); each nucleic acid molecule is detached from the beads under conditions where a cleavable linker can be cleaved (e.g., UV irradiation) to obtain droplets containing free RNA molecules, the cells are incubated, and droplets that exhibit the desired improved biological response are observed and screened (e.g., by FADS). The screened droplets are collected, the droplets are broken, and the desired beads are separated and collected. The polypeptide barcode tag is then detached from the beads and decoded, and information about the corresponding RNA molecule, including the sequence or modifications, is obtained based on the polypeptide barcode.

[0164] In the following examples, the full-length mRNA library encoding the polypeptide G-CSF prepared in Example 1 was screened using the microfluidic sorting process as illustrated in FIG2 .

[0165] The microfluidic device used includes a droplet generation unit for preparing beads containing cells or a full-length mRNA library encoding G-CSF polypeptides prepared in the Examples and / or droplets containing reagents dissolved in a solution. The droplet generation unit includes an inlet for the droplet carrier oil (carrier fluid) and another inlet for the droplet's aqueous phase component. Controllably encapsulating particles such as beads or cells into droplets is a well-known method in the art.

[0166] Figure 3 is a schematic diagram of an exemplary method and apparatus for forming droplets containing single cells. In this experiment, a flow channel with a height of 50 μm and a width of 100 μm was used. An aqueous solution containing HeLa cells and an oil (BioRad) were introduced at a ratio of 7 μL / min:1 μL / min, respectively. For FADS, a stain such as Calcein-AM was added to the cells.

[0167] Figures 4A and 4B are schematic diagrams and results, respectively, of an exemplary method for screening droplets containing a single mRNA library bead using the DLD method. DLD was used to sort the generated droplets. The flow channel was 50 μm high and 100 μm wide. An aqueous solution containing the mRNA library and an oil solution were introduced at a rate of 10 μL / min:13 μL / min. The DLD design parameters used were: pillar diameter D = 80 μm, pillar spacing G = 125 μm, center-to-center distance λ between adjacent pillars along the coordinate axis = D + G = 205 μm, relative offset distance Δλ in the y-direction = 8 μm, and relative offset coefficient ε in the y-direction = 0.03. As shown in Figure 4B, single droplets containing library beads moved diagonally forward along the offset direction of the pillar array, while empty droplets moved around the pillars. At the downstream screening outlet, droplets of different sizes were located on either side of the flow channel and entered different outlets, achieving screening of the empty droplets.

[0168] Figure 5 illustrates an exemplary re-injection of a first droplet containing a single bead and a second droplet containing a single cell. UV irradiation of the bead-containing droplet cleaves the linker, releasing the RNA from the bead, leaving the droplet with free mRNA. Furthermore, by adjusting the flow cycle of the first droplet to match that of the second droplet, the first and second droplets form a one-to-one pairing at the channel interface in an "ABAB" pattern.

[0169] The combination of a single bead droplet and a single cell droplet is fused into a droplet containing a single bead and a cell after passing through the electric field set in the microfluidic device. Electrode processing flow: The production of electrodes by MEMS processing technology is divided into four steps: (1) SU-8 photoresist is evenly applied to the surface of the substrate by spin coating to form a photoresist coating; (2) The pre-designed electrode pattern is transferred to the substrate by photolithography; (3) The electrode pattern is first deposited on the surface of the substrate by physical vapor deposition. of titanium, as an adhesion layer, and then deposited (4) The excess photoresist and gold film are released by cleaning to obtain the pre-designed electrode. Electric field parameters: approximately 250 V / cm, 90 kHz.

[0170] In one aspect of the present invention, it is necessary to promote the entry of the free nucleic acid molecules into the cell. In the method of the present invention, various methods known in the art for promoting the permeability of cells to extracellular nucleic acids or small molecules can be used to promote the entry of free nucleic acid molecules or small molecules into the cell (e.g., by diffusion). For example, electroporation or spatial squeezing can be used to create transient pores in the cell membrane, thereby promoting the entry of free nucleic acid molecules or small molecules into the cell.

[0171] Figure 6 illustrates how electroporation applies an electric field to a droplet, transiently perforating the cell membrane and promoting the entry of free mRNA into the cell. Before entering the electric field, the droplet contains cells, beads with polypeptide barcodes, and free mRNA molecules. After the electric field, the free mRNA molecules enter the cell, or enter more than before. Voltage: approximately 6 V, field duration: approximately 2.0 ms.

[0172] In one aspect of the invention, cells contained within the droplets are incubated to allow them to produce a biological response induced by the nucleic acid molecule or small molecule compound.

[0173] FIG. 7 is a graph showing exemplary results of an incubation zone of droplets containing mRNA library beads and cells.

[0174] In this example, CISBIO's HUMAN GCSF KITS were used to detect the expression of candidate mRNAs encoding GCSF in cells. GCSF Eu Cryptate Antibody and GCSF d2 Antibody were diluted 20-fold and then mixed in equal volumes to a final concentration of 40 pg / ml. After thorough mixing, the mixture was injected into the flow channel of droplets containing library beads, where they were encapsulated with the library beads to form droplets.

[0175] After passing through the electric field as shown in FIG6 , the droplets containing cells, beads with polypeptide barcodes, and free mRNA molecules were incubated in an incubation zone at 25 degrees for 24 hours.

[0176] Screening by FADS: The incubated droplets are sequentially passed through FACS with a detection wavelength of 665 nm. Droplets with excitation light intensity exceeding the background are selected into the collection channel and collected at the end.

[0177] Purification, excision and MS detection of optimized library beads

[0178] Use a disposable dropper to loosen the screened beads collected in the reaction tube and pour them into a 1000 mL reaction flask. (Residual resin in the reaction tube can be rinsed with ether and filtered into the 1000 mL reaction flask.) After incubating the resin on ice for 5 minutes, slowly add 100-150 mL of cleavage solution (trifluoroacetic acid: anisole: m-cresol: ethanedithiol: water = 82.5:5:5:2.5:5) under magnetic stirring. Cleave on ice for 30 minutes, then bring to room temperature and react for 2.5 hours. Add 900 mL of glacial ether (approximately 10 times the volume of the cleavage solution) with rapid stirring, stir at room temperature for 30 minutes, and then let it rest for 20 minutes.

[0179] The resulting reaction solution was poured into a G4 fritted funnel and filtered, washed twice with ether, and the filter cake was dissolved in water (25 mL x 3) for the peptide and filtered. The sample was dissolved in water and subjected to MS analysis. The results are shown in Table 1 below:

[0180] Table 1 Screened mRNA molecules and peptide tags

[0181] Example 3 Functional verification of the mRNA screened

[0182] A. Isolation and Culture of PBMCs

[0183] The mRNA numbered G-CSF1 was selected for functional verification.

[0184] Take the volunteer's blood, collect and dilute to 70mL with DPBS, and evenly distribute in 2 50mL conical tubes. 10mL of Ficoll Paque (GE Healthcare1) is gently placed under the blood layer. The test tube is centrifuged at 2000rpm, low acceleration and low braking for 30 minutes. Remove the tube and gently transfer the buffy coat PBMC layer to a new 50mL conical flask and wash with DPBS. The tube is centrifuged at 1450rpm for 10 minutes. The supernatant is aspirated and the PBMC pellet is resuspended and washed in 50mL of DPBS. The test tube is centrifuged at 1250rpm for 10 minutes. Repeat the washing step and resuspend the PBMC pellet in 19mL of Optimem I (Gibco11058) and count. The cell suspension is adjusted to a concentration of 3.0×10^6 cells / ml viable cells. Then, these cells are plated in 5 96-well tissue culture medium-treated round-bottom culture plates with 50μL per well per donor. Within 30 minutes, 50 μL of the transfection mixture was added to each well. 4 hours after transfection, the culture medium was supplemented with 10 μL of fetal bovine serum (Gibco 10082).

[0185] B. Preparation for Transfection

[0186] G-CSF1 mRNA, luciferase encoding mRNA, and TLR agonist R848 (Invivogen tlrl-r848) were diluted to 38.5 ng / μL in a final volume of 2500 μL of Optimem I.

[0187] In addition, 110 μ L of Lipofectamine 2000 (Invitrogen 11668-027) was diluted with 6.76 mL of Optimem I. In a 96-well plate, 9 equal portions of 135 μ L of each mRNA, positive control (R-848) or negative control (Optimem I) were added to 135 μ L of diluted Lipofectamine 2000. The plate containing the material to be transfected was incubated for 20 minutes. The transfection mixture was then transferred to each well of the human PBMC plate with 50 μ L per well. The plate was then incubated at 37° C. At 2, 4, 8, 20 and 44 hours, each plate was removed from the incubator and the supernatant was frozen.

[0188] After the last plate was removed, the supernatant was analyzed using a human G-CSF ELISA kit (Invitrogen KHC2032) and a human IFN-α ELISA kit (Thermo Scientific 41105-2). Each condition was performed in duplicate.

[0189] C. Protein and Innate Immune Response Analysis

[0190] The ability of mRNA to produce the encoded protein is assessed over time (G-CSF production), as is the ability of mRNA to trigger innate immune recognition by measuring interferon-α production. The use of in vitro PBMC cultures is an accepted way to measure the immunostimulatory potential of oligonucleotides (Robbins et al., Oligonucleotides, 2009, 19: 89-102).

[0191] Results were added to the standard curves of each ELISA plate using a four-parameter logistic curve fit. Tables 2 and 3 show the mean values ​​of G-CSF, interferon-α (IFN-α), and tumor necrosis factor α (TNF-α) production over time from three independent PBMC donors as determined by specific ELISA.

[0192] In the G-CSF ELISA, the background signal from the Lipofectamine 2000 (LF2000) untreated condition was subtracted at each time point. The data showed that specific production of human G-CSF protein by human peripheral blood mononuclear cells could be significantly generated.

[0193] Table 2 Expression of screened mRNA molecules

[0194] Table 3 Activity of the screened mRNA molecules

[0195] Example 4: Construction of a small molecule polypeptide encoding library for HDAC6 inhibitors

[0196] Fmoc-L-Asp(OAll)-Wang Resin (0.8 mmol / g, 100-200 mesh, 1% DVB) and labeled amino acids 1-20 (20 Fmoc-protected carboxylic acids) were purchased from Jier Biochemical (Shanghai) Co., Ltd. Piperidine, DCC, HOBt, HATU, HOAt, and trifluoroacetic acid were all purchased from SIGMA. Other chemical reagents were purchased from Inochem Chemical Reagent Co., Ltd.

[0197] Step 1 Immobilization of amino acid tag 1

[0198] Silanization treatment of peptide reaction tubes: Pour 10% trimethylsilyl chloride-toluene solution into the reaction tube and let it sit overnight. Filter (the filtrate can be reused). After treatment, the reaction tube walls will not stick to the resin. Add 850mg of Fmoc-L-Asp(OAll)-Wang Resin (0.8mmol / g, 100-200mesh, 1% DVB) to the peptide synthesis tube. Add 10mL of 20% piperidine-DMF solution to the tube, stir under nitrogen for 5 minutes, and filter. Then add 10mL of 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, and filter. Add 10mL of DCM, stir under nitrogen for 1 minute, and filter. Add 10mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Divide the resin into five equal portions and place them in different reactors. Add 1.5 mmol each of amino acids 1-5 (D, S, E, M, H), followed by 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube, shake well, and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to transfer a small amount of resin (30 beads will suffice) to a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol) and heat in a 110°C metal reaction bath for 3 minutes. The reaction is complete if the beads are colorless (slightly reddish when Fmoc proline is attached) and the solution is light yellow. If the resin balls or solution appear light blue, the reaction may not be complete. Add the above reaction reagents and repeat the process until the reaction is complete.

[0199] Step 2: Immobilization of the library molecule core

[0200] To each of the five resins prepared in step 1, add 10 mL of dichloromethane, stir under nitrogen, and allow the resin to swell for 5 minutes. Then, filter the DCM and wash with 10 mL of DMF. After fully swelling with acetonitrile, add 10 mM PhSiH3, Pd(PPh3)4, and 10 mL of DCM. After 30 minutes, filter the solution and wash with acetonitrile. Then, add 10 mL of dichloromethane, stir under nitrogen, and allow the resin to swell for 5 minutes. Then, filter the DCM and wash with 10 mL of DMF. Repeat this washing process three times. To the deprotected AllOC (allyl ester) functionalized resin was added 1.5 mmol of each of the following five nuclei: 1-tert-butoxycarbonyl-4-hydroxyproline allyl ester, 4-tert-butoxycarbonyl-2-hydroxypiperazine-5-carboxylic acid allyl ester, 4-tert-butoxycarbonyl-2-hydroxythiazine-5-carboxylic acid allyl ester, 4-tert-butoxycarbonyl-2-hydroxymorpholine-5-carboxylic acid allyl ester, and 4-tert-butoxycarbonyl-2-hydroxyselenanine-5-carboxylic acid allyl ester. Anhydrous acetonitrile, DCC, and HOBt were added sequentially. The mixture was capped and shaken at room temperature under nitrogen purge for 24 hours.

[0201] Step 3: Immobilization of amino acid tag 2

[0202] Combine the resins obtained in step 2 and add 10 mL of a 20% piperidine-DMF solution to the tube. Stir under nitrogen for 5 minutes, then filter. Add another 10 mL of a 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, then filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, then filter. Then, add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, then filter. Repeat this washing process three times. Divide the resin into 15 equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 1-15 (G, A, V, L, D, F, W, Y, N, K, Q, T, C, P, R). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube in sequence. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube and shake well. Activate the carboxyl groups for 5 minutes, then pour into reaction tubes 1 to 15 and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Then, add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol). Heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when Fmoc proline is attached) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0203] Step 4: Build the connection of unit 1

[0204] The following compounds were used as building blocks 1 of the HDAC6 small molecule library:

[0205] In 15 parts of resins prepared in step 3, add 10mL methylene dichloride respectively, nitrogen blowing stirs, and after swelling resin 5min, suction filtration DCM adds 10mL DMF and washes once.With 10% trifluoroacetic acid after the abundant swelling of acetonitrile, suction filtration is removed solution after 30 minutes, with after the acetonitrile washing, add 10mL methylene dichloride respectively, nitrogen blowing stirs, and after swelling resin 5min, suction filtration DCM adds 10mL DMF and washes once.Repeatedly wash three times like this.Add 15 each 1.5mmol of building block 1 respectively to the functionalized resin that sloughs BOC (tert-butyloxycarbonyl) protection, add anhydrous acetonitrile, DCC, HOBt successively, add nitrogen blast oscillating reaction 24 hours under the back room temperature of adding a cover.

[0206] Step 5: Immobilization of amino acid tag 3

[0207] Combine the resins obtained in step 4 and add 10 mL of a 20% piperidine-DMF solution to the tube. Stir under nitrogen for 5 minutes, then filter. Add another 10 mL of a 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, then filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, then filter. Then, add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, then filter. Repeat this washing process three times. Divide the resin into 15 equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 1-15 (G, A, V, L, D, F, W, Y, N, K, Q, T, C, P, R). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube in sequence. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube, shake well, and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Then add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol) and heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when Fmoc proline is attached) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0208] Step 6: Build the connection of unit 2

[0209] The following compounds were used as building blocks 2 of the HDAC6 small molecule library:

[0210] In 15 parts of resins prepared by step 5, add 10mL methylene dichloride respectively, nitrogen blowing stirs, and after swelling resin 5min, suction filtration DCM adds 10mL DMF and washes once.With the PhSiH that 10mM is added after the full swelling of acetonitrile , Pd (PPh ) , and 10ml DCM, suction filtration is removed solution after 30 minutes, with after the acetonitrile washing, add 10mL methylene dichloride respectively, nitrogen blowing stirs, and after swelling resin 5min, suction filtration DCM adds 10mL DMF and washes once.Repeatedly wash three times like this.Add 15 building blocks 2 each 1.5mmol respectively to the functionalized resin that sloughs ALLOC (allyl ester group) protection, add anhydrous acetonitrile, DCC, HOBt successively, add nitrogen blast oscillating reaction 24 hours under the back room temperature of adding a cover.

[0211] Step 7: Immobilization of amino acid tag 4

[0212] Combine the resins obtained in step 6 and add 10 mL of a 20% piperidine-DMF solution to the tube. Stir under nitrogen for 5 minutes, then filter. Add another 10 mL of a 20% piperidine-DMF solution, stir under nitrogen for 20 minutes, then filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, then filter. Then, add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, then filter. Repeat this washing process three times. Divide the resin into 15 equal portions and place them in separate reactors. Add 1.5 mmol each of amino acids 1-15 (G, A, V, L, D, F, W, Y, N, K, Q, T, C, P, R). Add 1.5 mmol of HOBT and 1.5 mmol of HBTU to each tube in sequence. Add 10 mL of DMF to each tube and shake to dissolve. Finally, add 300 μL of DIPEA to each tube, shake well, and react under nitrogen for 1 hour. Filter. Add 10 mL of DCM, stir under nitrogen for 1 minute, and filter. Then add 10 mL of DMF to each reaction tube, stir under nitrogen for 1 minute, and filter. Repeat this washing process three times. Use a capillary to pick up a small amount of resin (30 resin beads are sufficient) and place it in a 1.5 mL centrifuge tube. Add one drop of 5% ninhydrin-ethanol solution (99.9% anhydrous ethanol) and heat in a 110°C metal reaction bath for 3 minutes. If the resin beads are colorless (slightly red when Fmoc proline is attached) and the solution is light yellow, the reaction is complete. If the resin beads or solution are light blue, the reaction may not be complete. Add additional reagents and repeat the process until the reaction is complete.

[0213] Step 8: Build the connection of unit 3

[0214] The following compounds were used as building blocks 3 of the HDAC6 small molecule library:

[0215] To each of the 15 portions of resin prepared in step 7, add 10 mL of dichloromethane, stir under nitrogen, and swell the resin for 5 minutes. Then, filter the DCM and wash it with 10 mL of DMF. After fully swelling the resin with acetonitrile, add 10 mM PhSiH3, Pd(PPh3)4, and 10 mL of DCM. After 30 minutes, filter the solution and wash it with acetonitrile. Then, add 10 mL of dichloromethane, stir under nitrogen, and swell the resin for 5 minutes. Then, filter the DCM and wash it with 10 mL of DMF. Repeat this washing process three times. To the functionalized resin that had been deprotected from ALLOC (allyl ester group), add 1.5 mmol each of the 15 building blocks 3. Then, add anhydrous acetonitrile, DCC, and HOBt in sequence. After capping, shake under nitrogen bubbling at room temperature for 24 hours. This yields a polypeptide-encoded small molecule library with a library capacity of 5 × 15 × 15 × 15 = 16,875.

[0216] Example 5 Screening of a library of polypeptide-encoded small molecule HDAC6 inhibitors

[0217] 1. Expression and purification of HDAC6 protein

[0218] Add 1 μl of recombinant pET-28a expression plasmid to competent BL21 (DE3) bacteria and place them in an ice bath for 20 minutes; heat shock at 42°C for 90 seconds, spread the bacteria on a solid culture medium containing 30 μg / ml kanamycin, and culture at 37°C overnight; pick a single clone of bacteria and add it to a liquid culture medium containing 30 μg / ml kanamycin and 0.25 mM ZnSO4, and culture at 37°C with shaking until the OD600 of the bacterial solution reaches 0.6; add 0.5 mM IPTG and induce expression overnight at 20°C or 37°C; centrifuge the bacterial solution at 4000 r / min for 10 minutes, discard the supernatant, and resuspend the bacterial pellet with PBS; ultrasonically disrupt the bacteria, collect the supernatant and pellet by centrifugation, dissolve the pellet with buffer solution A, and mix the supernatant and pellet with SDS-PAGE loading buffer solution respectively. After heat denaturation, perform SDS-PAGE electrophoresis detection.

[0219] Repeat the above protein expression steps to induce large-scale expression of HDAC6 protein at low temperature (20°C). After centrifugation, the cells were lysed with buffer B and disrupted by sonication, followed by collection of the supernatant. The Ni-NDA chromatography column was pre-equilibrated with 5 column volumes of Ni-NDA binding buffer, and the supernatant containing the target protein was loaded. Incubate for 1 hour, collecting the flow-through. The column was washed with 20 column volumes of buffer C to remove endotoxins. The column was washed with Ni-NDA rinse buffer, and the flow-through was collected. The target protein was eluted with Ni-NDA elution buffer, and the flow-through was collected. Each of the collected flow-throughs was mixed with SDS-PAGE loading buffer, heat-denatured, and analyzed by SDS-PAGE electrophoresis. The purified protein was placed in a dialysis bag and dialyzed overnight against protein storage buffer. The protein was concentrated with PEG 20000 and stored at -80°C until use.

[0220] Prepare SDS-PAGE gels, load the above samples, and run through the upper stacking gel and lower separation gel at 80V and 120V, respectively; transfer the lower separation gel at a constant current of 300mA, and then block the PVDF membrane in 5% skim milk powder for 1 hour; dilute the His antibody at a ratio of 1:1000, and incubate the PVDF membrane in the primary antibody dilution overnight; wash the membrane three times with TBST buffer solution, and then incubate with the corresponding secondary antibody dilution solution; after washing with TBST buffer solution, develop and expose the membrane using an ECL kit to determine the quality of protein expression.

[0221] 2. Screening of compound libraries

[0222] 200 pmol of the target protein was immobilized on 15 μL of NHS-activated agarose resin. The loaded resin was then incubated with 100 pmol of a DNA-encoded compound library in 100 μL of PBST buffer (supplemented with salmon sperm DNA) at 4°C for 2.5 hours. After incubation, the resin was washed seven times with 100 μL of PBS to remove unbound library compounds. 20 μL of H2O was added to the resin, and the bound library compounds were eluted by heating to 95°C for 10 minutes. The resulting solution was subjected to structural analysis.

[0223] 3. Purification, cleavage and MS detection of the optimal resin

[0224] Stir the resin in the reaction tube with a disposable dropper to loosen it and pour it into a 1000 mL reaction flask (residual resin in the reaction tube can be rinsed with ether and then filtered and poured into the 1000 mL reaction flask). After incubating the resin on ice for 5 minutes, slowly add 100-150 mL of lysis buffer (trifluoroacetic acid: anisole: m-cresol: ethanedithiol: water = 82.5:5:5:2.5:5) under magnetic stirring. Incubate the lysis buffer on ice for 30 minutes, then move to room temperature and react for 2.5 hours. Note: Do not shake the reaction flask after adding the lysis buffer to prevent the magnetic beads from clinging to the wall. Add 900 mL of glacial ether (approximately 10 times the volume of the lysis buffer) with rapid stirring, stir at room temperature for 30 minutes, and let it rest for 20 minutes. Pour the reaction solution from the previous step into a G4 fritted funnel and filter it. Rinse the filter cake twice with ether. Dissolve the peptide in water (25 mL x 3) and filter it. Dissolve the sample in water and analyze with MS.

[0225] The results are shown in Table 4 below.

[0226] Table 4 Screened small molecule compounds and peptide tags

[0227] Example 6 Functional Verification of Preferred Compounds

[0228] Equilibrate the test compound to room temperature and perform a 4-fold serial dilution with DMSO in a 384-well plate, starting at a working concentration of 250 nM and proceeding through a seven-step concentration gradient. Using an Echo 550, transfer 250 nL of the diluted solution to a 384-well reaction plate. Transfer 250 nL of DMSO to the control wells (Max and Min). Dilute the HDAC6 enzyme stock solution to 1.67x with 1x enzyme reaction buffer. Dilute the reaction substrate to 2.5x with 1x enzyme reaction buffer. Add 15 μL of the diluted enzyme working solution to each reaction well, and 15 μL of 1x enzyme reaction buffer to the Min well. Incubate at room temperature for 15 minutes. Add 10 μL of the diluted enzyme reaction substrate to each reaction well and incubate at room temperature for 4 hours to allow for full reaction. Terminate the reaction by adding 3.5× Trypsin reaction stop solution to each well and incubate at 37°C for 90 minutes. Read the fluorescence signal at the end of the reaction using a microplate reader.

[0229] The calculation formula for the HDAC6 inhibition rate of the compound is as follows:

[0230] Where Mean(Max) is the mean of the assay values ​​for each Max well (DMSO and enzyme only); Mean(Max) represents the mean of the assay values ​​for each Min well (no enzyme); and Sample Signal is the mean of the assay values ​​for each compound-treated well. GraphPad Prism software was used to fit dose-response curves and calculate the IC50 values ​​for enzyme inhibition (as shown in Table 5).

[0231] Table 5 Inhibitory activity of preferred compounds on HDAC6

[0232] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A polypeptide-encoding nucleic acid or small molecule compound library, comprising a plurality of nucleic acid molecules or small molecule compounds, wherein each of the nucleic acid molecules or small molecule compounds has a corresponding polypeptide barcode tag.

2. The library according to claim 1, comprising a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and a nucleic acid molecule or small molecule compound corresponding to the polypeptide barcode tag, optionally, the nucleic acid molecule or small molecule compound is releasably attached to the bead.

3. The library according to claim 1 or 2, wherein the polypeptide barcode tag is formed by sequentially linking n amino acid residue building blocks, wherein n is an integer of 3-10, preferably an integer of 4-8, for example, n is 4 or 5 or 6; and the nucleic acid molecule is formed by sequentially linking m nucleic acid units, or the small molecule compound is composed of m compound building blocks, wherein m is the same as the number n of amino acid residue building blocks in the corresponding polypeptide barcode tag on the bead.

4. The library according to claim 3, wherein each nucleic acid unit and each amino acid residue building unit are assembled onto the beads sequentially and alternately, or each compound building unit and each amino acid residue building unit are assembled onto the beads sequentially and alternately.

5. The library according to claim 2, wherein the beads are hydrogel particles, such as gel particles of polyacrylamide, agarose, alginate, etc.

6. The library according to claim 1 or 2, wherein Each amino acid residue unit in the polypeptide barcode tag includes one or more (eg, 2-8) amino acid residues. For example, the amino acid residue unit includes one or two amino acid residues.

7. The library according to claim 1, wherein The library is an mRNA or RNAi library.

8. The library according to claim 7, wherein the mRNA is formed by sequentially connecting m mRNA units, wherein m is the same as the number n of amino acid residue units in the corresponding polypeptide barcode tag on the bead.

9. The library according to claim 8, wherein The mRNA unit includes an mRNA coding sequence or a fragment thereof, flanking regions of the mRNA (eg, 5' untranslated region or 3' untranslated region or 3' UTR) and / or terminal regions (eg, 5' cap, poly A tail or polyT).

10. The library according to claim 7, wherein the mRNA is an mRNA encoding a target protein or a variant thereof, such as an mRNA encoding an antibody or a fragment thereof, a vaccine or a therapeutic protein.

11. A library according to claim 2, wherein the nucleic acid molecules or small molecule compounds in the library have a cleavable linker that is releasably connected to the bead, and the cleavable linker includes a linker selected from the following linkers: enzymatically cleavable linkers; nucleophile / base sensitive linkers; reduction sensitive linkers; photocleavable linkers; electrophile / acid sensitive linkers; metal-assisted cleavage sensitive linkers; oxidation sensitive linkers; and a combination of two or more of the foregoing, for example, the cleavable linker is a UV light cleavable linker.

12. A method for screening a library of polypeptide-encoding nucleic acids or small molecule compounds, the library comprising a plurality of nucleic acid molecules or small molecule compounds, wherein each nucleic acid molecule or small molecule compound has a corresponding polypeptide barcode tag, the method comprising identifying the corresponding nucleic acid molecule or small molecule compound by decoding the polypeptide barcode tag, The method comprises contacting the nucleic acid molecule or small molecule compound library with a biological target, for example, a cell, and a biological macromolecule such as a protein, nucleic acid, and polysaccharide.

13. The method of claim 12, comprising contacting the library with a biological target under conditions suitable for binding of the nucleic acid molecules or small molecule compounds of the library to the biological target, optionally comprising removing library members that do not bind to the target, and analyzing tags associated with small nucleic acid molecules or small molecule compounds bound to the target.

14. The method of claim 12, wherein the library comprises a plurality of beads, each bead comprising a polypeptide barcode tag attached to the bead and a nucleic acid molecule or small molecule compound corresponding to the polypeptide barcode tag, optionally, the nucleic acid molecule or small molecule compound is releasably attached to the bead.

15. The method according to claim 14, wherein the method comprises the following steps: (a) providing the library comprising a plurality of beads having different polypeptide barcode tags and corresponding nucleic acid molecules or small molecule compounds; (b) releasing the nucleic acid molecules or small molecule compounds on each bead from the bead to produce a plurality of free nucleic acid molecules or small molecule compounds; (c) contacting the nucleic acid molecules or small molecule compounds on each bead with a single or multiple biological targets (e.g., cells) to screen the nucleic acid molecules or small molecule compounds to produce screened nucleic acid molecules or small molecule compounds; (d) identifying the screened nucleic acid molecules or small molecule compounds by decoding the polypeptide barcode tags associated therewith, Preferably, the beads are hydrogel particles, such as polyacrylamide, agarose, alginate and other gel particles, Optionally, step (d) includes the step of removing the polypeptide barcode tag from the beads, And, optionally, step (b) comprises releasing each nucleic acid molecule from the bead under conditions whereby the cleavable linker is cleavable to produce a plurality of free nucleic acid molecules.

16. The method according to claim 15, wherein step (a) comprises encapsulating different beads of the library in a plurality of first discrete entities, preferably, wherein a single one of the plurality of first discrete entities statistically contains one of the beads, And, wherein step (c) comprises encapsulating the biological target (e.g., cell) in a plurality of second discrete entities, preferably, wherein a single one of said plurality of second discrete entities statistically contains one cell or a desired number of cells, Preferably, the discrete entities are droplets.

17. The method of claim 16, further comprising sorting a first discrete entity containing the beads or a second discrete entity containing a biological target (e.g., a cell) from the discrete entity, such as a droplet, wherein the sorting is performed, for example, by fluorescence-activated droplet sorting (FADS) or deterministic lateral displacement (DLD).

18. The method of claim 16, wherein a single bead of the library is encapsulated in a single first droplet, the single or desired number of cells is encapsulated in a single second droplet, and then the first droplet containing the beads and the second droplet containing the cells are merged to form one droplet.

19. The method according to claim 15, wherein Step (d) comprises one or more of the following steps: a step of collecting the screened droplets; the step of breaking the droplet; The steps of separating and collecting the beads; The step of removing the polypeptide barcode tag from the beads.

20. A discrete entity library of polypeptide-encoding nucleic acids or small molecule compounds, comprising beads of the polypeptide-encoding nucleic acids or small molecule compound library as defined in any one of claims 1 to 11, wherein the beads are encapsulated in a single discrete entity, preferably, the discrete entity is a droplet.

Images