Delivery system for targeted inhibition of GDF8 and application thereof

Abstract

The invention provides a delivery system for targeted inhibition of GDF8. The delivery system comprises RNA capable of inhibiting GDF8 gene expression and a delivery vector, a delivery carrier carrying the RNA and a targeting element are self-assembled in organ tissues of mammals to form a composite structure, and the composite structure searches the targeting element and sends the RNA capable of inhibiting GDF8 gene expression into target tissues so as to inhibit GDF8 expression in the target tissues. The siRNA in-vivo self-assembly transmission system has the beneficial effects that a targeted treatment mode of the tumor-induced amyotrophy disease is developed by utilizing the siRNA in-vivo self-assembly transmission system; according to the mode, an organ of a mammal can be used as a natural bioreactor, an endogenous miRNA secretion mechanism is utilized to assemble, process and secrete the siRNA wrapped by the exosome capable of targeting GDF8 to a circulatory system, and finally, the siRNA medicine is effectively transferred into muscles to treat the muscle atrophy disease induced by tumors.

Description

Technical Field

[0001] The present application relates to the field of biomedical technology, and in particular to a delivery system for targeted inhibition of GDF8 and its application in the preparation of products for treating muscular atrophy diseases. Background Art

[0002] Lewis lung carcinoma is a cell line (LLC) established from the lungs of C57BL mice bearing tumors derived from implantation of primary Lewis lung carcinomas and is widely used as a model of metastasis to study the mechanisms of cancer chemotherapeutic agents.

[0003] RNAi drugs provide a new direction for the study of muscular atrophy. RNA interference (RNAi) is a specific gene silencing phenomenon that is commonly found in organisms and is mediated by small interfering RNA (siRNA) and involves specific enzymes. It blocks gene expression at the transcriptional, post-transcriptional and translational levels, thereby exerting biological effects. It is now clear that siRNA can be produced endogenously by cells, that is, it is formed by the cleavage of linear long double-stranded RNA by the nuclease Dicer, or it can be introduced exogenously to exert its effects directly ( Figure 2 ). By designing appropriate siRNA, RNAi can theoretically be used to silence almost all genes. This species-conservative, highly efficient, and sequence-specific gene silencing technology can not only be used for basic research by knocking down specific genes, but also has great potential to become a new type of drug to interfere with the expression of pathogenic genes, thereby playing a role in gene therapy. Summary of the invention

[0004] In view of the above-mentioned technical limitations, the present application proposes a delivery system for targeted inhibition of GDF8 and its application in the preparation of products for treating muscular atrophy diseases; it overcomes the deficiencies and defects mentioned in the background technology.

[0005] To achieve the above objectives, this application adopts the following technical solutions:

[0006] The inventive point of the present application is to provide a delivery system for targeted inhibition of GDF8, the delivery system comprising: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying the RNA capable of inhibiting GDF8 gene expression and the targeting element self-assemble in the organ tissue of a mammal to form a composite structure, the composite structure searches for and delivers the RNA capable of inhibiting GDF8 gene expression into the target tissue through the targeting element, thereby inhibiting the expression of GDF8 in the target tissue.

[0007] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the RNA capable of inhibiting the expression of the GDF8 gene comprises: a promoter element and at least one of siRNA and coding siRNA capable of inhibiting the expression of the GDF8 gene.

[0008] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the nucleotide sequence of the siRNA capable of inhibiting the expression of the GDF8 gene is any one of SEQ ID No.1 to SEQ ID No.4;

[0009] SEQ ID No.1:

[0010] TAATGATTGTTTCCGTGGTAGGTTTTGGCCACTGACTGACCTACCACG AACAATCATTA;

[0011] SEQ ID No.2:

[0012] TAGAAAGTCAGACTCTGTAGGGTTTTGGCCACTGACTGACCCTACAG ACTGACTTTCTA;

[0013] SEQ ID No.3:

[0014] AACATTTGGGCTTGCCATCCGGTTTTGGCCACTGACTGACCGGATGG CGCCCAAATGTT;

[0015] SEQ ID No.4:

[0016] TCAATACTCTGCCAAATACCAGTTTTGGCCACTGACTGACTGGTATTT CAGAGTATTGA.

[0017] The nucleotide sequences encoding the positive strand of the siRNA capable of inhibiting the expression of the GDF8 gene are: any one of SEQ ID No. 5 to SEQ ID No. 8;

[0018] SEQ ID No.5: CUACCACGAACAAUCAUUA;

[0019] SEQ ID No.6:CCUACAGACUGACUUUCUA;

[0020] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;

[0021] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.

[0022] The nucleotide sequences encoding the antisense strand of the siRNA capable of inhibiting the expression of the GDF8 gene are: any one of SEQ ID No. 9 to SEQ ID No. 12;

[0023] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;

[0024] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;

[0025] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;

[0026] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.

[0027] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the composite structure is an exosome.

[0028] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the targeting element comprises one, two or more targeting sequences.

[0029] The targeting sequence selected is MSP muscle targeting peptide, and the specific sequence is shown in SEQ ID No.13.

[0030] SEQ ID No. 13: ASSLNIA;

[0031] The nucleotide sequence encoding the MSP muscle targeting peptide is shown in SEQ ID No.14.

[0032] SEQ ID No. 14: gccagcagcctgaacatcgcc.

[0033] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the delivery vector is a plasmid vector or a viral vector.

[0034] Optionally, in the above-mentioned delivery system for targeted inhibition of GDF8, the viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

[0035] The second invention point of the present application is to provide an application of the above-mentioned delivery system for targeted inhibition of GDF8 in the preparation of a product for treating muscular atrophy diseases.

[0036] Optionally, in the above application, the product for treating muscle wasting diseases includes an agent for preventing the expression of GDF8 gene, and a drug having a preventive and / or therapeutic effect on muscle wasting diseases.

[0037] Optionally, in the above application, the muscle wasting disease is a tumor-induced muscle wasting disorder, preferably a Lewis lung cancer cell-induced muscle wasting disorder.

[0038] The beneficial effects of the present application are as follows: the present application utilizes the siRNA in vivo self-assembly delivery system to develop a targeted treatment method for tumor-induced muscular atrophy; this method can use the mammal's own organs as natural bioreactors, utilize the endogenous miRNA secretion mechanism, assemble, process, and secrete exosome-encapsulated siRNA that can target GDF8 into the circulatory system, and ultimately effectively deliver siRNA drugs into the muscles to treat tumor-induced muscular atrophy.

[0039] The delivery system for targeted inhibition of GDF8 provided in the present application and its application in the preparation of products for treating muscular atrophy diseases have the following advantages compared with the prior art:

[0040] 1) Effectiveness: Based on synthetic biology elements, human organs are used as natural bioreactors. With the help of the miRNA processing and maturation mechanism of eukaryotic cells, siRNA is generated and self-assembled into exosomes, entering the circulatory system and reaching various major organs;

[0041] 2) Safety: This delivery system utilizes the naturally occurring secretion mechanism, thus avoiding the toxicity caused by the use of various different carriers;

[0042] 3) Targeting: Delivery systems with muscle-specific targeting elements can deliver siRNA to muscle tissue, improving delivery efficiency while avoiding potential side effects;

[0043] 4) Upgradability: According to the needs of different muscle disease treatments, the targeting elements and targeted genes can be adjusted to meet the needs of personalized treatment;

[0044] 5) Easy to produce: This delivery system is based on a plasmid vector, which is easy to industrially produce and purify. Compared with other siRNA delivery methods, it greatly reduces the production difficulty and cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The design diagram of the self-assembly plasmid in one embodiment of the present application (the self-assembly plasmid already includes the targeting peptide MSP and siRNA GDF-8 ).

[0046] Figure 2In one embodiment of the present application, in vivo self-assembly of siRNA GDF-8 Schematic diagram of the process.

[0047] Figure 3 Shown is the detection result of mature siRNA in 293T cells and in supernatant exosomes 24 hours after transfection of the gene loop in one embodiment of the present application.

[0048] Figure 4 In one embodiment of the present application, 293T cells screen for effective siRNA gene loops; wherein,

[0049] Figure 4 A is the experimental flow chart;

[0050] Figure 4 B is the fluorescence expression result of overexpression plasmid GDF8-GFP;

[0051] Figure 4 C is the GDF8 protein expression level and statistical results.

[0052] Figure 5 It is shown as an example of the present application, C2C12 cells screen for effective siRNA gene loops; wherein,

[0053] Figure 5 A is the experimental flow chart;

[0054] Figure 5 B is the expression and statistical results of GDF8 protein in cells after transfection of siRNA gene loop;

[0055] Figure 5 C shows the effect of the siR4 gene loop obtained by transfection screening before differentiation on myotube formation and the statistical results.

[0056] Figure 6 Shown is the identification result of serum exosomes in one embodiment of the present application.

[0057] Figure 7 The results are shown in one embodiment of the present application, in which exosomes derived from mouse liver and serum inhibit GDF-8 expression in vitro after injection of the gene loop; wherein,

[0058] Figure 7 A shows the detection process and results of liver-derived exosomes;

[0059] Figure 7 B shows the detection process and results of serum-derived exosomes.

[0060] Figure 8 It shows the detection process of PKH26 labeling self-assembled exosomes in vivo and tracing them in vivo in one embodiment of the present application; wherein,

[0061] Figure 8 A is the detection process of liver-derived exosomes;

[0062] Figure 8 B shows the detection process of serum-derived exosomes.

[0063] Fig. 9 Shown is the test result of PKH26 labeling self-assembled exosomes in vivo and tracing them in vivo in one embodiment of the present application; wherein,

[0064] Fig. 9 A is the detection result of liver-derived exosomes;

[0065] Fig. 9 B is the detection result of serum-derived exosomes.

[0066] Fig.10 Shown is the treatment result of WT mice injected with siRNA gene loop for 2 weeks in one embodiment of the present application; wherein,

[0067] Fig.10 A is the experimental flow chart;

[0068] Fig.10 B is the weight change curve;

[0069] Fig.10 C is the statistical result of tibialis anterior (TA) wet weight;

[0070] Fig.10 D is the statistical result of the mouse grasping strength test;

[0071] Fig.10 E is the anatomical appearance of the mouse.

[0072] Fig.11 Shown is the therapeutic molecular phenotype of WT mice injected with siRNA gene loop for 2 weeks in one embodiment of the present application; wherein,

[0073] Fig.11 A is the whole-body immunohistochemistry result of GDF8 in tibialis anterior muscle (TA);

[0074] Fig.11 B is the expression and statistical results of GDF8 protein in tibialis anterior muscle (TA) after injection of siRNA gene loop;

[0075] Fig.11 C shows the expression results of GDF8 mRNA and downstream genes.

[0076] Fig.12 It is shown as an example of the present application, in vivo self-assembled exosome siRNA functional verification in LLC cancer-induced muscle atrophy mice; wherein,

[0077] Fig.12 A is the statistical data comparison of tumor-free weight, tibialis anterior (TA) muscle weight percentage, and grip strength test in each group of LLC cancer-induced muscle atrophy mice;

[0078] Fig.12 B is the anatomical appearance of mice in each group;

[0079] Fig.12 C shows the expression results of GDF8 protein in each group of mice after injection of siRNA gene loop. DETAILED DESCRIPTION

[0080] In order to make the purpose, technical solution and advantages of the present application more clear, the present application is further described in detail below. However, it should be understood that the description here is only used to explain the present application and is not used to limit the scope of the present application.

[0081] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present application, and the terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. The reagents and instruments used herein are all commercially available, and the characterization means involved can refer to the relevant descriptions in the prior art, which will not be repeated herein.

[0082] In order to further understand the present application, the present application is further described in detail below in conjunction with the best embodiment.

[0083] Example 1

[0084] A delivery system for targeted inhibition of GDF8, comprising: RNA capable of inhibiting GDF8 gene expression and a delivery vector; the delivery vector carrying the RNA capable of inhibiting GDF8 gene expression and a targeting element self-assemble in mammalian organ tissue to form a composite structure, the composite structure searches for and delivers the RNA capable of inhibiting GDF8 gene expression into the target tissue through the targeting element, thereby inhibiting the expression of GDF8 in the target tissue.

[0085] The RNA capable of inhibiting the expression of the GDF8 gene comprises: a promoter element and at least one of siRNA and coding siRNA capable of inhibiting the expression of the GDF8 gene.

[0086] The nucleotide sequence of the siRNA capable of inhibiting the expression of the GDF8 gene is any one of SEQ ID No. 1 to SEQ ID No. 4;

[0087] SEQ ID No.1:

[0088] TAATGATTGTTTCCGTGGTAGGTTTTGGCCACTGACTGACCTACCACG AACAATCATTA;

[0089] SEQ ID No.2:

[0090] TAGAAAGTCAGACTCTGTAGGGTTTTGGCCACTGACTGACCCTACAG ACTGACTTTCTA;

[0091] SEQ ID No.3:

[0092] AACATTTGGGCTTGCCATCCGGTTTTGGCCACTGACTGACCGGATGG CGCCCAAATGTT;

[0093] SEQ ID No.4:

[0094] TCAATACTCTGCCAAATACCAGTTTTGGCCACTGACTGACTGGTATTT CAGAGTATTGA.

[0095] The nucleotide sequences encoding the positive strand of siRNA capable of inhibiting the expression of the GDF8 gene are: any one of SEQ ID No. 5 to SEQ ID No. 8;

[0096] SEQ ID No.5: CUACCACGAACAAUCAUUA;

[0097] SEQ ID No.6:CCUACAGACUGACUUUCUA;

[0098] SEQ ID No.7: CGGAUGGCGCCCAAAUGUU;

[0099] SEQ ID No. 8: UGGUAUUUCAGAGUAUUGA.

[0100] The nucleotide sequences encoding the antisense strand of siRNA capable of inhibiting the expression of the GDF8 gene are: any one of SEQ ID No.9 to SEQ ID No.12;

[0101] SEQ ID No.9: UAAUGAUUGUUUCCGUGGUAG;

[0102] SEQ ID No.10: UAGAAAGUCAGACUCUGUAGG;

[0103] SEQ ID No.11: AACAUUUGGGCUUGCCAUCCG;

[0104] SEQ ID No. 12: UCAAUACUCUGCCAAAUACCA.

[0105] The composite structure is an exosome.

[0106] The targeting element comprises one, two or more targeting sequences.

[0107] The targeting sequence selected is MSP muscle targeting peptide, and the specific sequence is shown in SEQ ID No.13.

[0108] SEQ ID No. 13: ASSLNIA;

[0109] The nucleotide sequence encoding the MSP muscle targeting peptide is shown in SEQ ID No.14.

[0110] SEQ ID No. 14: gccagcagcctgaacatcgcc.

[0111] The delivery vector is a plasmid vector or a viral vector.

[0112] The viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

[0113] The present application also provides an application of the above-mentioned delivery system for targeted inhibition of GDF8 in the preparation of a product for treating muscular atrophy diseases.

[0114] Products for treating muscle wasting diseases include agents that block the expression of the GDF8 gene and drugs that have preventive and / or therapeutic effects on muscle wasting diseases.

[0115] The muscle wasting disease is a tumor-induced muscle wasting disorder, preferably a Lewis lung cancer cell-induced muscle wasting disorder.

[0116] Example 2

[0117] In vitro assembly and validation of targeted siRNA self-assembly system:

[0118] 1. Self-assembly system design and effectiveness:

[0119] according to Figure 1The design diagram shown is used to construct a siRNA self-assembly system. According to the design, after the system is introduced into mammalian tissues and cells, the system can utilize the mammal's own miRNA processing and secretion mechanism to self-assemble into exosomes (core gene loop) containing siRNA; in addition, by adding muscle targeting peptide (MSP) and co-expressing the Lamp2b protein on the outer membrane of the exosomes, the MSP targeting peptide is simultaneously expressed on the surface of the exosome membrane, and after being secreted into the circulatory system, it is enriched in muscle cells through the targeting element.

[0120] First, each component was constructed and the effectiveness of each component was verified in vitro using 293T tool cells (HEK-293T), the efficiency of siRNA transcription by the self-assembly system was tested, and whether siRNA was effectively encapsulated into the cell supernatant exosomes was tested;

[0121] The empty vector was treated with restriction endonucleases, and after the linear vector was recovered, the GDF8 siRNA sequence was embedded into the pre-miR-155 skeleton to form the siRNA expression element and connected to the vector using T4 ligase, and the FLAG-Lamp2b sequence and the MSP-Lamp2b sequence were connected to the vector as targeting elements; the obtained connection products were subjected to transformation experiments and coated on resistance plates; the single clone was picked out on the next day, and the correctness of the plasmid sequence was determined by sequencing;

[0122] Figure 3 It shows that the four designed mature siRNA sequences targeting GDF8 (SEQ ID No.1-SEQ IDNo.4) were loaded into the gene loop, and the gene loop that can effectively inhibit the expression of GDF8 was screened out by in vitro experiments. The results showed that the normal expression of the four mature siRNAs could be detected when the cells were collected 24 hours after transfection.

[0123] Among them, CMV-MSP-siR-4 was most stably expressed in cells and supernatant exosomes, and had the most significant knockdown effect in 293T cells.

[0124] Figure 4 The results show that 293T cells were transfected with a GDF8 overexpression plasmid (expressing GFP fluorescent protein) and simultaneously transfected with a siRNA gene loop to screen for effective siRNA gene loops ( Figure 4 A); The results showed that the four siRNA gene loops could effectively inhibit the GFP fluorescence intensity expressed by 293T cells, among which the siR4 gene loop had the strongest inhibitory effect ( Figure 4 B), Western blot results also showed that the siR4 gene loop had a significantly better inhibitory effect on GDF8 expression than other siRNA gene loops ( Figure 4 C).

[0125] 2. Gene circuit screening:

[0126] 293T tool cells were transiently transfected with GDF8 overexpression plasmids, followed by transfection with four designed siRNA gene loops (with different siRNA mature body sequences), and the inhibitory effects of different gene loops on transiently overexpressed GDF8 mRNA (qRT-PCR) and protein expression (Western blot) were detected. The muscle cell line C2C12 was used to transfect the above four gene loops ( Figure 5 ), further verifying the inhibitory effect of the gene circuit on endogenous GDF8 mRNA and protein expression in muscle cells;

[0127] Further validation in the muscle cell line C2C12 was performed as Figure 5 As shown in A, different siRNA gene loops were directly transfected into myotubes differentiated for 3 days, and it was found that the inhibitory effect of siR4 gene loop on endogenous GDF8 in C2C12 myotubes was significantly better than that of other siRNA gene loops ( Figure 5 B). Moreover, transfection of siR4 gene loop before differentiation significantly increased the number of myotubes formed ( Figure 5 C). These results demonstrate that the siR4 gene loop can effectively inhibit GDF8 expression in vitro, thereby effectively promoting myogenesis.

[0128] Subsequent identification and functional validation experiments all used the most effective siR4 gene loop.

[0129] 3. Exosome identification:

[0130] Twelve hours after the mice were injected with the gene loop at a dose of 5 mg / kg, the serum exosomes were extracted from the mice, and the Nanoparticle Tracking Analysis (NTA) test showed that there was no significant difference in the content and particle size distribution of serum exosomes among the three groups of mice. Electron microscopy analysis showed that the morphological structure was intact and there was no significant difference. Finally, Western blot experiments on exosome marker proteins showed that there was no significant difference in the content of exosome marker proteins among the three groups ( Figure 6 ), demonstrating that injection of the gene loop does not affect exosome secretion.

[0131] Example 3

[0132] Functional verification of exosome siRNA self-assembled in vivo:

[0133] After mice were injected with the gene loop at a dose of 5 mg / kg, their livers were extracted at 6 and 12 hours ( Figure 7 A) and serum ( Figure 7B) Exosomes were co-cultured with C2C12 myotube cells, and the expression of GDF-8 in the cells was detected by Western blot after 24 hours.

[0134] from Figure 7 It can be seen that exosomes derived from mouse liver and serum after injection of the gene loop can inhibit the expression of GDF-8 in vitro.

[0135] Tracing of self-assembled exosomes in vivo:

[0136] After mice were injected with the gene loop at a dose of 5 mg / kg, their livers were extracted at 6 and 12 hours ( Figure 8 A) and serum ( Figure 8 B) Exosomes were labeled with PKH26 lipophilic dye in vitro and then injected into recipient mice via tail vein injection. The skeletal muscles of the mice were sectioned and stained 24 hours later.

[0137] from Figure 8 and Fig. 9 It can be seen that the liver after adding the targeting peptide MSP ( Fig. 9 A) and serum ( Fig. 9 B) Exosomes can be effectively delivered to skeletal muscle (TA).

[0138] Functional validation of in vivo self-assembled exosomal siRNA in wild-type mice:

[0139] Mice were injected with the gene loop at a dose of 5 mg / kg every other day for two weeks ( Fig.10 A). During the period, the weight changes were monitored. One day after the last injection, the grip strength test was performed and the tibialis anterior muscle (TA) was weighed. The results showed that the injection of CMV-MSP-siRNA GDF-8 The body weight of mice in one group ( Fig.10 B), TA weight ( Fig.10 C) and grip ( Fig.10 D) have increased significantly, and the muscle photography also directly shows that the calf muscle circumference of the hind legs has increased significantly ( Fig.10 E). Immunohistochemistry of mouse TA ( Fig.11 A) and Western blot experiments ( Fig.11 B) also showed that CMV-MSP-siRNA GDF-8 The content of GDF-8 in the TA of one group of mice was significantly reduced. RT-qPCR detection of gene expression in the TA tissue of mice revealed that the expression of GDF-8 and its downstream genes was significantly reduced ( Fig.11 C).

[0140] from Fig.10 and Fig.11It can be seen that CMV-MSP-siRNA GDF-8 Significant effects were observed in short-term treatment of WT mice.

[0141] Functional validation of in vivo self-assembled exosomal siRNA in LLC cancer mice:

[0142] 1×10 5 LLC cells were implanted in the armpits of mice and treated with gene loop injections three days later, every other day for one month. One day after the last injection, the grip strength test was performed and the tibialis anterior (TA) muscle was weighed. The results showed that injection of CMV-MSP-siRNA GDF-8 The body weight, TA weight and grip strength of one group of mice after tumor removal were significantly increased ( Fig.12 A), and the muscle photography also directly showed that the calf muscle circumference of its hind legs increased significantly ( Fig.12 B) Western blot experiments on mouse TA tissue also showed that CMV-MSP-siRNA GDF-8 The content of GDF-8 in TA of one group of mice was significantly reduced ( Fig.12 C).

[0143] from Fig.12 It can be seen that CMV-MSP-siRNA GDF-8 It showed significant therapeutic effect in LLC-induced muscle atrophy.

[0144] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A delivery system for targeted inhibition of GDF8, characterized in that: The delivery system comprises: RNA capable of inhibiting the expression of the GDF8 gene and a delivery vector; the delivery vector carrying the RNA capable of inhibiting the expression of the GDF8 gene and a targeting element self-assemble in the organ tissue of a mammal to form a composite structure, and the composite structure searches for and delivers the RNA capable of inhibiting the expression of the GDF8 gene into the target tissue through the targeting element, thereby inhibiting the expression of GDF8 in the target tissue.

2. The targeted GDF8 inhibition delivery system according to claim 1, characterized in that: The RNA capable of inhibiting the expression of the GDF8 gene comprises: a promoter element and at least one of siRNA and coding siRNA capable of inhibiting the expression of the GDF8 gene.

3. The targeted GDF8 inhibition delivery system according to claim 2, characterized in that: The nucleotide sequence of the siRNA capable of inhibiting the expression of the GDF8 gene is any one of SEQ ID No.1 to SEQ ID No.4; The nucleotide sequences encoding the positive strand of the siRNA capable of inhibiting the expression of the GDF8 gene are: any one of SEQ ID No. 5 to SEQ ID No. 8; The nucleotide sequences encoding the antisense strand of siRNA capable of inhibiting the expression of the GDF8 gene are any one of SEQ ID No. 9 to SEQ ID No.

12.

4. The targeted GDF8 inhibition delivery system according to claim 1, characterized in that: The composite structure is an exosome.

5. The targeted GDF8 inhibition delivery system according to claim 1, characterized in that: The targeting element comprises one, two or more targeting sequences.

6. The targeted GDF8 inhibition delivery system according to claim 1, characterized in that: The delivery vector is a plasmid vector or a viral vector.

7. The targeted GDF8 inhibition delivery system according to claim 6, characterized in that: The viral vector includes at least one of a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

8. Use of the delivery system for targeted inhibition of GDF8 according to any one of claims 1 to 7 in the preparation of a product for treating muscle wasting diseases.

9. The use according to claim 8, characterized in that: The product for treating muscle wasting diseases includes reagents for preventing the expression of GDF8 gene and drugs having preventive and / or therapeutic effects on muscle wasting diseases.

10. The use according to claim 9, characterized in that: The muscle wasting disease is a tumor-induced muscle wasting disorder, preferably a Lewis lung cancer cell-induced muscle wasting disorder.

Images