Anti-nRNP / Sm antibody or antigen binding fragment thereof, detection reagent and kit

Abstract

The invention discloses an anti-nRNP / Sm antibody or an antigen binding fragment thereof, a detection reagent and a kit, and relates to the technical field of in-vitro diagnostic reagents. The anti-nRNP / Sm antibody or the antigen binding fragment thereof provided by the invention comprises a heavy chain variable region and a light chain variable region, the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO. 1; the amino acid sequence of the light chain variable region is as shown in SEQ ID NO. 2. The detection reagent provided by the invention comprises the anti-nRNP / Sm antibody or the antigen binding fragment thereof. The anti-nRNP / Sm antibody or the antigen binding fragment thereof provided by the invention solves the problems of traceability of positive blood and large-scale supply. By applying the scheme, the anti-nRNP / Sm or the antigen binding fragment thereof with high titer, high accuracy and good stability can be prepared, and a raw material source with excellent performance is provided for preparation of a calibration product / a positive control product / a quality control product of an anti-nRNP / Sm detection kit.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to an anti-nRNP / Sm antibody or an antigen binding fragment thereof, a detection reagent and a kit. Background Art

[0002] Autoimmune diseases (abbreviated as "autoimmune diseases") are diseases caused by the immune system's immune response to the body's own components, causing damage. Under normal circumstances, the immune system only responds to foreign substances that invade the body, such as bacteria, viruses, parasites, and transplants, and eliminates or rejects these foreign substances. Under the influence of certain factors, the body's tissue components or the immune system itself have certain abnormalities, causing the immune system to mistakenly attack its own components as foreign substances. At this time, the immune system will produce antibodies and active lymphocytes against some of the body's own components, damaging and destroying its own tissues and organs, leading to disease.

[0003] Due to the large number of types of autoimmune diseases, autoimmune diseases are usually divided into two categories. One is systemic autoimmune disease, which is characterized by the involvement of multiple organs or tissues throughout the body, such as rheumatoid arthritis, systemic lupus erythematosus, Sjögren's syndrome, systemic vasculitis, etc.; the other is organ-specific autoimmune disease, in which only one tissue or organ is affected, such as autoimmune liver disease, type 1 diabetes, etc.

[0004] Systemic sclerosis (SSc) is a connective tissue disease characterized by the hardening of collagen fibers in the skin system. Systemic sclerosis involving internal organs is also called systemic sclerosis. This disease ranks second only to lupus erythematosus among connective tissue diseases and is an "autoimmune disease."

[0005] Anti-nRNP / Sm antibody positivity is part of the autoantibody test and is of great significance for the diagnosis of autoimmune diseases. nRNP antibodies are antibodies against ribonucleic acid and often appear in mixed connective tissue diseases and other connective tissue diseases, such as lupus erythematosus, rheumatoid arthritis, Sjögren's syndrome, dermatomyositis, scleroderma, etc. Sm antibodies are specific antibodies for systemic lupus erythematosus, and their positive rate in systemic lupus erythematosus patients is about 40%, which has good specificity.

[0006] Anti-nRNP / SM positivity indicates abnormal immune function and possible autoimmune diseases. Anti-nRNP antibody positivity is mainly seen in mixed connective tissue disease and is an important basis for the diagnosis of mixed connective tissue disease. Anti-SM antibody positivity is closely related to systemic lupus erythematosus and is a marker antibody for systemic lupus erythematosus. Therefore, anti-nRNP / SM positivity mainly represents abnormal immune function in patients and may cause autoimmune diseases such as systemic lupus erythematosus, mixed connective tissue disease, etc.

[0007] Stable in-house quality control products can effectively monitor the precision and accuracy of test results. However, most of the commercial anti-nRNP / Sm antibody quality control products on the market are human positive serum, but the serum is difficult to source, and there are large differences between batches. The batch size is small and it comes from imports, which is expensive, limiting the clinical application of the test products. Therefore, there is an urgent need to independently develop anti-nRNP / Sm antibodies that can be mass-produced and have high affinity and specificity to achieve daily quality control in clinical laboratories. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide an anti-nRNP / Sm antibody or an antigen binding fragment thereof and application thereof, so as to solve the problems of unstable source of raw materials of existing quality control antibodies, large batch differences and low specificity.

[0009] In order to solve the above problems, the present invention proposes the following technical solutions:

[0010] In a first aspect, the present invention provides an anti-nRNP / Sm antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region and a light chain variable region;

[0011] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1; and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2.

[0012] The antibody or antigen-binding fragment thereof is a monoclonal antibody or a polyclonal antibody. The monoclonal antibody can be prepared by a variety of approaches and techniques, including hybridoma technology, phage display technology, single lymphocyte gene cloning technology, etc.

[0013] Furthermore, the anti-nRNP / Sm antibody or antigen-binding fragment thereof further comprises a heavy chain constant region, wherein the heavy chain constant region comprises:

[0014] The amino acid sequence of CH1 is shown in SEQ ID NO.3;

[0015] Hinge having an amino acid sequence as shown in SEQ ID NO.4; and

[0016] The amino acid sequence of Fc is shown in SEQ ID NO.5.

[0017] Furthermore, the heavy chain constant region is selected from the conserved amino acid sequence of the human IgG1 heavy chain constant region.

[0018] Furthermore, the anti-nRNP / Sm antibody or antigen-binding fragment thereof further comprises a light chain constant region CL, and the amino acid sequence of the light chain constant region CL is shown in SEQ ID NO.6.

[0019] Furthermore, the light chain constant region CL is selected from the conserved amino acid sequence of the human IgG1 light chain constant region.

[0020] Furthermore, the heavy chain amino acid sequence of the anti-nRNP / Sm antibody or its antigen-binding fragment is shown in SEQ ID NO.7, and the light chain amino acid sequence is shown in SEQ ID NO.8.

[0021] The method for preparing the antibody or its antigen-binding fragment is a conventional method in the art. The method for preparing the antibody or its antigen-binding fragment is preferably: isolating and obtaining from a host cell expressing the antibody or its antigen-binding fragment or obtaining by artificially synthesizing a protein sequence. The method for isolating and obtaining from a host cell expressing the antibody or its antigen-binding fragment is preferably as follows: cloning a nucleic acid molecule encoding the antibody or its antigen-binding fragment and having a point mutation into a vector, transforming the obtained vector into a host cell, and culturing the obtained host cell to isolate and purify the antibody or its antigen-binding fragment.

[0022] In a second aspect, the present invention provides a nucleic acid molecule encoding the anti-nRNP / Sm antibody or antigen-binding fragment thereof described in the first aspect.

[0023] Furthermore, the nucleotide sequence of the heavy chain variable region of the anti-nRNP / Sm antibody or its antigen-binding fragment is shown in SEQ ID NO.9, and the nucleotide sequence of the light chain variable region is shown in SEQ ID NO.10.

[0024] Furthermore, the anti-nRNP / Sm antibody or antigen-binding fragment thereof, the nucleotide sequence of the heavy chain constant region CH1 region is shown in SEQ ID NO.11; the nucleotide sequence of the Hinge region is shown in SEQ ID NO.12; and the nucleotide sequence of the Fc region is shown in SEQ ID NO.13.

[0025] Furthermore, the nucleotide sequence of the light chain constant region CL of the anti-nRNP / Sm antibody or its antigen-binding fragment is shown in SEQ ID NO.14.

[0026] Furthermore, the heavy chain nucleotide sequence of the anti-nRNP / Sm antibody or its antigen-binding fragment is shown as SEQ ID NO.15, and the light chain nucleotide sequence is shown as SEQ ID NO.16.

[0027] The method for preparing the nucleic acid molecule is a conventional method in the art, and preferably comprises the following steps: obtaining a nucleic acid molecule encoding the above-mentioned antibody or its antigen-binding fragment by gene cloning technology, or obtaining a nucleic acid molecule encoding the above-mentioned antibody or its antigen-binding fragment by artificial full sequence synthesis.

[0028] Those skilled in the art know that the base sequence encoding the amino acid sequence of the above-mentioned antibody or antigen-binding fragment thereof can be appropriately introduced with substitution, deletion, change, insertion or addition to provide a homologue of a polynucleotide. The homologue of the polynucleotide in the present invention can be prepared by replacing, deleting or adding one or more bases of the gene encoding the sequence of the antibody or antigen-binding fragment thereof within the range of maintaining the activity of the antibody, which is also included in the present invention.

[0029] In a third aspect, the present invention provides a vector comprising the nucleic acid molecule described in the second aspect.

[0030] The vector can be obtained by conventional methods in the art, that is, by connecting the nucleic acid molecule of the present invention to various expression vectors. The expression vector is any conventional vector in the art, as long as it can carry the aforementioned nucleic acid molecule. The vector preferably includes various plasmids, cosmids, phages or virus vectors, etc.

[0031] In a fourth aspect, the present invention provides a host cell comprising the nucleic acid molecule or the vector.

[0032] The preparation method of the host cell is a conventional preparation method in the art, preferably: the above-mentioned vector is transformed into a host cell to obtain it. The host cell is any conventional host cell in the art, as long as it can satisfy the above-mentioned vector to stably replicate itself and the nucleic acid carried can be effectively expressed. Preferably, the host cell is E.coli TG1 or BL21 cell (expressing single-chain antibody or Fab antibody), or CHO-K1 cell (expressing full-length IgG antibody). The aforementioned recombinant expression plasmid is transformed into a host cell to obtain a preferred host cell of the present invention. The transformation method is a conventional transformation method in the art, preferably a chemical transformation method, a heat shock method or an electroporation method.

[0033] The present invention also provides a use of the anti-nRNP / Sm antibody or its antigen binding fragment to detect the presence or level of the anti-nRNP / Sm antibody in a sample, or in preparing a kit for detecting the presence or level of the anti-nRNP / Sm antibody in a sample.

[0034] In a fifth aspect, the present invention provides a detection reagent, which comprises the anti-nRNP / Sm antibody or antigen-binding fragment thereof described in the first aspect.

[0035] In a sixth aspect, the present invention provides a kit comprising the anti-nRNP / Sm antibody or its antigen-binding fragment, or the detection reagent.

[0036] The present invention also provides the use of the anti-nRNP / Sm antibody or its antigen-binding fragment in detecting the presence or level of the anti-nRNP / Sm antibody in a sample, or in preparing a kit for detecting the presence or level of the anti-nRNP / Sm antibody in a sample; or the use of the detection reagent or the kit in detecting the presence or level of the anti-nRNP / Sm antibody in a sample.

[0037] It should be noted that the kit generally includes one or more detection reagents, which contain the specific antibodies to be measured, which can be used as quality control products, positive controls or standard products. Standard products are used to establish a standard curve with antibody concentration assignments, or a single positive control product can be used near the positive / negative cutoff value. Preferably, the standard or positive control product is prepared with the specific antibody to be tested or a material chemically similar thereto. Ideally, the standard or control product is manufactured to interact with other assay components in a manner similar to the test analyte (specific antibody). Usually a plurality of standards are included, which contain specific antibodies of different concentrations, and the concentrations of these antibodies span the concentration range of the object to be tested. When the detection agent is used as a standard, positive control or quality control product for anti-nRNP / Sm antibody detection, the concentration of the anti-nRNP / Sm antibody in the detection agent is indicated, that is, clear, and its concentration can be adjusted according to the needs of the detection.

[0038] Of course, the kit also includes other necessary detection reagent components for detecting anti-nRNP / Sm antibodies, such as chemiluminescent immunoassay-related reagent components, specifically, nRNP / Sm antigen-coated solid phase carrier components and labeled antibody reagent components.

[0039] In other aspects, the present invention also provides a method for screening anti-nRNP / Sm antibodies or antigen-binding fragments thereof, the specific steps of the method are as follows:

[0040] S1. Collect positive whole blood from patients with autoimmune nRNP / Sm;

[0041] S2, separating lymphocytes from the positive whole blood and extracting RNA;

[0042] S3, using the RNA obtained in step S2 as a template to reverse transcribe and synthesize cDNA, and then using the obtained cDNA as a template for PCR amplification, connecting the amplified product with a vector, and electrotransferring it into TG1 competent cells to construct a gene library of anti-nRNP / Sm antibodies or antigen-binding fragments thereof;

[0043] S4, amplifying the phage gene library, adding a helper phage, and then adding IPTG to induce expression to obtain a protein display library of anti-nRNP / Sm antibodies or antigen-binding fragments thereof;

[0044] S5. Perform at least three rounds of panning with biotinylated nRNP / Sm antigen to obtain phages of specific anti-nRNP / Sm antibodies or antigen-binding fragments thereof;

[0045] S6. Perform phage sequencing to obtain the gene sequence of the anti-nRNP / Sm antibody or its antigen-binding fragment, and then perform molecular cloning and recombinant expression to obtain the anti-nRNP / Sm antibody or its antigen-binding fragment.

[0046] Compared with the prior art, the technical effects achieved by the present invention include:

[0047] The anti-nRNP / Sm antibody or antigen-binding fragment thereof provided by the present invention solves the problem of traceability of positive blood and large-scale supply. The solution of the present invention can prepare anti-nRNP / Sm or antigen-binding fragment thereof with high titer, high accuracy and good stability, and provides a raw material source with excellent performance for the preparation of calibration products / positive control products / quality control products of anti-nRNP / Sm detection kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 The agarose gel electrophoresis results of RNA extracted from positive whole blood of the present invention;

[0049] Figure 2 The agarose gel electrophoresis result of the heavy chain variable region amplified by the present invention;

[0050] Figure 3 The agarose gel electrophoresis result of the light chain variable region amplified by the present invention;

[0051] Figure 4 is the amplification result of the ScFv fragment of the present invention;

[0052] Figure 5 This is a high affinity and specific anti-nRNP / Sm antibody screened by the present invention, and the SDS-PAGE test result;

[0053] Figure 6 The figure is the result of immunoblotting membrane strip detection of the nRNP / Sm antibody of the present invention. DETAILED DESCRIPTION

[0054] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments. Obviously, the embodiments described below are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0055] Example 1 Construction of ScFv phage display library and screening of anti-nRNP / Sm antibodies

[0056] 1.1 Positive blood collection

[0057] 2 mL of whole blood was collected from 30 positive patients with nRNP / Sm autoimmunity aged between 20 and 50 years old.

[0058] 1.2 Lymphocyte isolation and total RNA extraction

[0059] The collected positive whole blood was used to separate lymphocytes using the QIAamp RNABlood Mini kit (50) instructions. Total RNA was extracted according to the Trizol kit instructions. RNAse-free water was added as needed for dissolution and storage. The results were detected by agarose gel electrophoresis. Figure 1 As shown. Note that all materials used in the whole process must be RNase-free. Please wear a mask during the operation to prevent yourself from bringing in RNase and causing RNA degradation.

[0060] 1.3 Amplification of antibody heavy chain variable region and light chain variable region

[0061] According to the instructions of Takara reverse transcription kit PrimeScriptTMII 1st strand cDNA synthesiskit, the RNA obtained in 1.2 was used as a template for reverse transcription to synthesize cDNA. The obtained cDNA was then used as a template for PCR reaction to amplify the heavy chain variable region and light chain variable region sequences. The PCR reaction conditions and procedures were: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis. The length of the heavy chain variable region gene was about 375 bp; the length of the light chain variable region gene was about 330 bp. The primer sequences are shown in Table 1, and the agarose gel electrophoresis of the heavy chain variable region and the light chain variable region is shown in Table 1. Figure 2 and Figure 3 shown.

[0062] Table 1 Primers for amplification of heavy chain variable region and light chain variable region

[0063]

[0064]

[0065] 1.4 Amplification of ScFv fragments

[0066] The amplified heavy chain variable region and light chain variable region genes were used as templates and specific primers were used for PCR reaction. The PCR reaction conditions and procedures were as follows: 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 60 seconds, 68°C for 60 seconds, 30 cycles; 68°C for 5 minutes. The PCR product was identified by 1.2% agarose gel electrophoresis. The length of the ScFv fragment gene was about 750 bp. The primer sequences are shown in Table 2; the ScFv gel electrophoresis results are shown in Figure 4 shown.

[0067] Table 2 Amplification primer sequences of ScFv fragments

[0068] Primer name Primer sequences MH-VH-scFv-F gtcctcgcaccatggcc MHkappaCLscFv-NotI raccgcctccgcggccgcgaagacagatggtgcagccacagt MH-VH-scFv-F gtcctcgcaccatggcc MHLambdaCLscFv-NotI raccgcctccgcggccgcagaggasggygggaacagagtgac

[0069] 1.5 Construction of antibody gene library

[0070] The vector pCANTAB-5E and the second round amplification product were double-digested with Not I and Nco I, respectively, and the digestion products were recovered using a gel recovery kit and ligated using T4 DNA ligase. The ligation products were purified using a PCR product purification kit. All the purified ligation products were added to 50 μL TTG1 electroporation competent cells for electroporation under the conditions of 1 mm electroporation cup and 1800 V voltage. After adding culture medium for recovery culture, 10 μL gradient dilutions were taken for plating, and the number of colonies was calculated to obtain an antibody library capacity of 2.4×10 8 .

[0071] 1.6 Phage library amplification

[0072] Take 50 μL of the above bacterial library and inoculate it into 50 mL of 2*YT medium containing 2% glucose and ampicillin, culture at 37℃220rpm until OD600=0.5, add 500 μL of helper phage M13KO7, and infect at 37℃ for 1 hour. Centrifuge and change to 50 μg / mL kanamycin and 100 μg / mL ampicillin, and culture overnight at 26℃, 220rpm. Centrifuge and take 40 mL of supernatant, add 10 mL of PEG / NaCl (20% / 2.5M) solution and mix thoroughly, centrifuge and discard the supernatant, wash the precipitate with 1 mL of ice-cold PBS, and remove insoluble matter by high-speed centrifugation.

[0073] 1.7 Antibody Screening

[0074] The streptavidin magnetic beads were blocked with 3% milk-PBS for 2h, and the phage library was blocked for 1h. An appropriate amount of biotinylated SCL70 antigen was added to the blocked phage library, and the mixture was mixed at room temperature and 36°C for 1h; the blocked magnetic beads were added, washed 10 times with PBST, and the phage bound to the antigen was eluted with 0.2M glycine solution. The eluted phages were transfected with TG1 and entered the next round of screening. The screening operation was repeated. After 3 rounds of screening, the positive clones were verified by ELISA, and an antibody with high affinity was obtained, named nRNP / Sm-14D9. The amino acid sequence of the heavy chain variable region of the antibody obtained by sequencing analysis of nRNP / Sm-14D9 is shown in SEQ ID NO.1, and the nucleotide sequence encoded by it is SEQ ID NO.9. The amino acid sequence of the light chain variable region is SEQ ID NO.2, and the nucleotide sequence encoded by it is shown in SEQ ID NO.10.

[0075] Example 2 Recombinant preparation and performance verification of nRNP / Sm antibody

[0076] 2.1 Gene synthesis

[0077] 2.1.1 This embodiment provides an anti-nRNP / Sm antibody, comprising a light chain and a heavy chain. The amino acid composition of the light chain is VL-CL from the N-terminus to the C-terminus, and the sequence is SEQ ID NO.2-SEQ ID NO.6; the amino acid composition of the heavy chain is VH-CH1-Hinge-Fc from the N-terminus to the C-terminus, and the sequence is SEQ ID NO.1-SEQ ID NO.3-SEQ ID NO.4-SEQ ID NO.5.

[0078] 2.1.2 Based on the anti-nRNP / Sm antibody sequence, the Kozak sequence: gccgccacc; the signal peptide sequence (SEQ ID NO.17) and the termination codon sequence: taa were introduced and sent to a gene synthesis company (Qingke) for codon optimization and gene synthesis.

[0079] SEQ ID NO17: Signal peptide sequence

[0080] atggactggacgtggcggattctctctttcttgttgcagcagcaaccggagcacatagc.

[0081] 2.2 Antibody expression vector construction

[0082] 2.2.1 Amplification of antibody heavy and light chain fragments

[0083] Using the synthesized light chain and heavy chain genes as templates, the PCR reaction solution was prepared according to the following components: 50 ng DNA template, 1 μL forward primer, 1 μL reverse primer, 5 μL 10xExTaq buffer, 0.25 μL HS ExTaq, and then supplemented to 50 μL with ddH2O. Reaction conditions: 98°C for 3 minutes; 94°C for 50 seconds, 55°C for 30 seconds, 68°C for 40 seconds, and 72°C for 10 minutes. Recover DNA and determine the concentration, and store it at -20°C for a short term.

[0084] Table 3: Primer sequences for heavy and light chain amplification

[0085]

[0086] 2.2.2pcDNA3.1 vector digestion and vector-antibody ligation

[0087] The vector enzyme digestion reaction system is as follows: take 5 μg of pcDNA3.1 empty load, 2 μL Hind III, 2 μL EcoR I, 10 μL 10x buffer, add ddH2O to 100 μL, react at 37°C for 1 hour. Perform 1% agarose gel electrophoresis, recover DNA and determine the concentration, and store at -20°C for a short term.

[0088] The vector and antibody connection system is as follows: take 50 ng vector fragment, 10 ng antibody fragment, 5 μg 2x buffer, 1 μL seamless cloning ligase, add ddH2O to 10 μL, and react at 37°C for 30 min.

[0089] 2.2.3 Plating and sequencing

[0090] The transformation system is as follows: Take 100 μL Top10 competent cells, 10 μL ligation reaction solution, mix well, and place on ice for 30 minutes. Heat shock at 42°C for 90 seconds, and place on ice for 5 minutes. Then spread on LB solid plate containing 100 μg / mL ampicillin antibiotics, and invert and culture overnight at 37°C. Pick a single clone and transfer it to LB liquid medium containing 100 μg / mL ampicillin antibiotics, culture it at 37°C, 220rpm in a shaker for 6 hours, and send it for sequencing.

[0091] 2.2.4 Plasmid extraction

[0092] Sequence alignment sequencing results, the correct sequence of the bacterial liquid was inoculated into 400mL LB liquid containing 100μg / mL ampicillin antibiotics, and cultured overnight at 37℃, 220rpm in a shaker. The plasmid was extracted using a plasmid extraction kit (OMEGA, D6924-04), the plasmid concentration was detected by UV spectrophotometer, and stored at -20℃ for later use.

[0093] 2.3 Preparation of anti-nRNP / Sm antibodies

[0094] 2.3.1 Resuscitate 293F cells with serum-free medium (Expi 293 medium) until the density reaches 3-5×10 6 cells / mL, 0.5×10 6 Cells were subcultured every 3-4 days, and the cells were adapted to the third generation. 6 cells / mL, subculture 500mL / bottle, take 250μg of the extracted heavy chain plasmid and 300μg of the light chain plasmid, and use 25mL of reduced serum medium (Opti-MEM TM ) and mix well; take 1.65mL PEI (1mg / mL), mix it with 25mL serum-free culture medium (Expi 293 culture medium), then add PEI to the plasmid, mix well, let it stand for 15min, add 500mL of cells that have been passaged, and culture in a shaker (culture conditions are 37°C, 8% CO2, 120rpm).

[0095] 2.3.2 24 hours after plasmid addition, feed (0.5% enhancer 1 and 5% enhancer 2) was added, and then cultured for 4-6 days until the cell density reached about 60%. Centrifuge at 1000rpm and room temperature for 10min. Take the supernatant, centrifuge at 12000rpm and room temperature for 30min, filter at 0.22μm, purify the quality control antibody with Protein G (cytiva) filler, dialyze and ultrafilter with PBS, and detect the protein concentration with a spectrophotometer and the protein purity with SDS-PAGE. The test results are shown in Table 4 and Figure 5 .

[0096] Table 4 Plasmid extraction concentration test results

[0097] - Heavy chain Light chain Concentration (ng / μL) 1233 1089 Volume (mL) 2.1 2.3

[0098] Table 5 Antibody concentration test results

[0099] - nRNP / Sm Antibody Expression volume (mL) 500 Detection concentration (mg / mL) 4.72 Final yield (mg / L) 141.6

[0100] 2.4 ELISA activity verification of antibodies

[0101] The expressed antibodies were tested by ELISA. The nRNP / Sm antigen was coated on the enzyme label strip, coated overnight at 4°C, and washed 3 times; the enzyme label strip was blocked with blocking solution, incubated at 37°C for 2h, and washed 3 times; the sample was added, incubated at 37°C for 30min, and washed 3 times; the human secondary antibody HRP was added, incubated at 37°C for 30min, and washed 3 times; color development, 10min, stop, and read. The test results are shown in Table 6.

[0102] Table 6 nRNP / Sm antibody ELISA activity test results

[0103]

[0104]

[0105] Example 3 Antibody stability verification

[0106] In this example, the anti-nRNP / Sm antibody was prepared with negative blood as a quality control product for stability assessment.

[0107] 3.1 Thermal stability: The prepared nRNP / Sm quality control product was divided into four equal portions, 1 mL / portion. One portion was placed at -20°C as a control, and the other three portions were placed at 37°C. One portion was taken out at the 7th day, 14th day, and 1 month time points and then placed at -20°C. After 1 month, the four quality control products were tested, and the ELISA test results of the samples taken out at each time point were compared with those of the samples that had been stored at -20°C.

[0108] 3.2 Freeze-thaw stability: The prepared nRNP / Sm quality control product was divided into four equal portions, 1 mL / portion. One portion was placed at -20°C as a control, and the other three portions were placed at -20°C and then freeze-thawed 3, 5, and 10 times, respectively. After the samples were collected, their activity was tested by ELISA for analysis. The results are shown in Table 7

[0109]

[0110] From the ELISA test results, the anti-nRNP / Sm antibody of the present invention has a performance comparable to that of the control group (stored at -20°C) after 1 month of accelerated stability test at 37°C, indicating that the antibody has good stability. After 3 freeze-thaw cycles, its activity is comparable to that before freeze-thaw, and after 5 freeze-thaw cycles, its activity will be significantly reduced. The thermal stability of the antibody of the present invention is qualified, and the storage cannot exceed 5 freeze-thaw cycles.

[0111] Example 4 Immunoblotting Application of nRNP / Sm Antibody

[0112] 4.1 Prepare the kit (antinuclear antibody spectrum IgG detection kit, DL1590-6401-3G) and operate according to the kit operating instructions.

[0113] 4.1.1 All reagents must be equilibrated at room temperature (18-25°C) for 30 minutes before use.

[0114] 4.1.2 Antigen-coated test strips: Use directly. To prevent condensation of the strips, open the package only after the strips have reached room temperature. After taking out the strips, seal the original package immediately and store it at 2-8°C.

[0115] 4.1.3 Washing buffer: 10 times concentrated. When using, use a clean pipette to draw the required amount from the bottle and dilute it with distilled water 1:10. If you need to incubate one test strip, dilute 1mL of concentrated buffer with 9mL of distilled water. The diluted buffer should be used up on the same working day.

[0116] 4.1.4 Sample buffer: Use directly.

[0117] 4.1.5 Substrate solution: Use directly. It is light sensitive and the bottle cap should be tightly closed immediately after use.

[0118] 4.1.6 Enzyme conjugate: 10-fold concentrated. When using, draw the required enzyme conjugate from the bottle with a clean pipette and dilute it 1:10 with sample buffer. If you need to incubate one test membrane strip, dilute 0.15mL of enzyme conjugate with 1.35mL of sample buffer. The diluted enzyme conjugate should be used up on the same working day.

[0119] 4.1.7 nRNP / Sm antibody dilution: dilute nRNP / Sm antibody 1:101 with sample buffer. For example, dilute 15μL nRNP / Sm antibody with 1.5mL sample buffer and mix thoroughly. The diluted nRNP / Sm should be used up on the same working day.

[0120] 4.2 Immunoblotting

[0121] 4.2.1 Preprocessing:

[0122] Take out the required membrane strips and place them in the incubation tank. The numbered side of the membrane strips faces upward. Add 1.5 mL of sample buffer to the incubation tank, incubate at room temperature on a rocking shaker for 5 minutes, and then aspirate the liquid in the incubation tank.

[0123] 4.2.2nRNP / Sm Antibody Incubation

[0124] 1.5 mL of the diluted nRNP / Sm antibody was added to each incubation tank, and the mixture was incubated on a rocking shaker at room temperature (18° C. to 25° C.) for 30 minutes.

[0125] 4.2.3 Cleaning:

[0126] Aspirate the liquid in the tank and wash the membrane strips 3 times with 1.5 mL of washing buffer on a rocking platform, each time for 5 minutes.

[0127] 4.2.4 Enzyme conjugate incubation:

[0128] 1.5 mL of diluted enzyme conjugate (alkaline phosphatase-labeled anti-human IgG) was added to the incubation chamber and incubated on a rocking shaker at room temperature for 30 minutes.

[0129] 4.2.5 Cleaning:

[0130] Aspirate the liquid in the tank and wash the membrane strips 3 times with 1.5 mL of washing buffer on a rocking platform, each time for 5 minutes.

[0131] 4.2.6 Substrate incubation:

[0132] 1.5 mL of substrate solution was added to each incubation tank, and incubated on a rocking shaker at room temperature (18°C to 25°C) in the dark for 10 minutes.

[0133] 4.2.8 Result judgment:

[0134] Place the test membrane strip in the result determination template and determine the result after air drying.

[0135] Results Figure 6 From the results of the membrane strips, it can be seen that the anti-nRNP / Sm antibody of the present invention can specifically bind to the nRNP / Sm antigen and can be used for nRNP / Sm autoimmunity detection.

[0136] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0137] The above is a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of various equivalent modifications or replacements within the technical scope disclosed by the present invention, and these modifications or replacements should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention shall be based on the protection scope of the claims.

Claims

1. An anti-nRNP / Sm antibody or an antigen-binding fragment thereof, characterized in that: including a heavy chain variable region and a light chain variable region; The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.1; The amino acid sequence of the light chain variable region is shown in SEQ ID NO.

2.

2. The anti-nRNP / Sm antibody or antigen-binding fragment thereof according to claim 1, characterized in that: Also included is a heavy chain constant region, the heavy chain constant region comprising: The amino acid sequence of CH1 is as shown in SEQ ID NO.3; Hinge having an amino acid sequence as shown in SEQ ID NO.4; and The amino acid sequence of Fc is shown in SEQ ID NO.

5.

3. The anti-nRNP / Sm antibody or antigen-binding fragment thereof according to claim 1, characterized in that: It also includes a light chain constant region CL, and the amino acid sequence of the light chain constant region CL is shown in SEQ ID NO.

6.

4. The anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, characterized in that: The heavy chain amino acid sequence of the anti-nRNP / Sm antibody or its antigen-binding fragment is shown in SEQ ID NO.7, and the light chain amino acid sequence is shown in SEQ ID NO.

8.

5. A nucleic acid molecule, characterized in that Encodes the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

6. A carrier, characterized in that Comprising the nucleic acid molecule of claim 5.

7. A host cell, characterized in that Comprising the nucleic acid molecule according to claim 5, or the vector according to claim 6.

8. A detection reagent, characterized in that: The detection reagent comprises the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1 to 4.

9. A kit, characterized in that It comprises the anti-nRNP / Sm antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, or the detection reagent according to claim 8.

10. Use of the anti-nRNP / Sm antibody or its antigen-binding fragment according to any one of claims 1 to 4 in detecting the presence or level of anti-nRNP / Sm antibodies in a sample, or in preparing a kit for detecting the presence or level of anti-nRNP / Sm antibodies in a sample; or use of the detection reagent according to claim 8 or the kit according to claim 9 in detecting the presence or level of anti-nRNP / Sm antibodies in a sample.

Images