A method for preparing Beauveria bassiana protoplasts using a breakdown enzyme

Abstract

The application provides a method for preparing Beauveria bassiana protoplast by using lyticase. The method comprises the following steps: obtaining Beauveria bassiana mycelium and washing the mycelium with a NaCl solution; mixing the washed mycelium with an enzyme solution according to a ratio of 1g:50mL and oscillating the enzyme solution for enzymolysis; after the enzymolysis is completed, post-treating the enzyme solution to obtain the Beauveria bassiana protoplast; and the concentration of the lyticase in the enzyme solution is 5-20g / L per gram. Under the optimal enzymolysis condition, the yield of the Beauveria bassiana protoplast reaches 2.56*10 7 6 / mL, which is about 2.56 times higher than that of the prior art.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering, specifically relating to a method for preparing Beauveria bassiana protoplasts using a breakdown enzyme. Background Technology

[0002] R-(+)-2-(4-hydroxyphenoxy)propionic acid (D-HPPA) is an important chiral intermediate in the synthesis of aryloxyphenoxypropionic acid ester (APP) herbicides. Currently, the main industrial production of this intermediate employs chemical methods, which suffer from drawbacks such as complex operation, numerous reaction steps, harsh reaction conditions, abundant byproducts, significant environmental pollution, and low yield. Biocatalysis, on the other hand, offers advantages such as stereoselectivity, mild reaction conditions, safety, environmental friendliness, high product purity, and easy product separation and extraction. Therefore, achieving the biological preparation of key chiral intermediates for aryloxyphenoxypropionic acid herbicides has significant economic and social benefits.

[0003] Beauveria bassiana can perform a variety of biocatalytic reactions, including methylation, glycosylation, and hydroxylation. Among these, the hydroxylation reaction of Beauveria bassiana has been successfully applied in the industrial production of steroidal and hormonal drugs. Utilizing the hydroxylation reaction of Beauveria bassiana to synthesize D-HPPA using D-PPA as a substrate not only overcomes the shortcomings of traditional chemical and fermentation methods but also offers advantages such as being green, efficient, simple, and convenient. Matthias et al. specifically converted the substrate D-PPA to the product D-HPPA using extracellular heme alcohol peroxidase from Agrocybe aegerita, achieving a conversion rate of 60%. BASF in Germany has achieved a conversion rate of 99% using Beauveria bassiana for biocatalytic synthesis of D-HPPA at a concentration of 50 g / L of D-PPA. The development of efficient and green synthetic technologies for chiral pesticides and their intermediates relies on efficient and stable molecular manipulation techniques. However, the preparation of Beauveria bassiana protoplasts still faces the problem of poor enzymatic hydrolysis. Summary of the Invention

[0004] To address the problem of poor enzymatic hydrolysis in the preparation of Beauveria bassiana protoplasts in existing technologies, this invention applies a breakdown enzyme to the preparation of Beauveria bassiana protoplasts and provides a method for preparing Beauveria bassiana protoplasts using the breakdown enzyme, as well as the obtained Beauveria bassiana protoplasts. Furthermore, this invention also provides a method for constructing a D-HPPA-producing genetically engineered Beauveria bassiana strain.

[0005] The technical solution adopted in this invention is: a method for preparing Beauveria bassiana protoplasts using a breakdown enzyme, comprising: obtaining Beauveria bassiana hyphae and rinsing them with NaCl solution; mixing the rinsed Beauveria bassiana hyphae with an enzymatic hydrolysate at a ratio of 1g:50mL and shaking for enzymatic hydrolysis; after the enzymatic hydrolysis is completed, post-treatment of the enzymatic hydrolysate is performed to obtain Beauveria bassiana protoplasts; wherein, the concentration of the breakdown enzyme in the enzymatic hydrolysate is 5-20g / L.

[0006] To address the issue of poor enzymatic hydrolysis during the preparation of Beauveria bassiana protoplasts, the inventors' team experimented with enzymatic hydrolysis of Beauveria bassiana using lysozyme, lysozyme, cellulase, chitinase, glucanase, driselase, snailase, and yatalase. They found that only driselase and yatalase were effective at hydrolyzing the mycelia. However, the combined effect of these two enzymes was less effective than that of driselase alone. Based on this, the present invention explored the optimal hydrolytic conditions for driselase and used the protoplasts obtained by this method as competent cells to construct a genetically engineered strain of Beauveria bassiana.

[0007] Preferably, the concentration of the breakdown enzyme in the enzymatic hydrolysate is 15-20 g / L, more preferably 15 g / L.

[0008] Preferably, the Beauveria bassiana includes Beauveria bassiana, Beauveria microsporum, and Beauveria bassiana brücken.

[0009] Preferably, the method for obtaining Beauveria bassiana mycelia includes: culturing Beauveria bassiana at 120–180 r / min and 25–35°C for 3–5 days to obtain a bacterial solution containing Beauveria bassiana mycelia; filtering the bacterial solution and rinsing it with a 0.7–1 M NaCl solution to obtain Beauveria bassiana mycelia. The concentration of the NaCl solution is further preferably 0.8 M.

[0010] Preferably, the temperature of the oscillating enzymatic hydrolysis is 25–35°C, and more preferably 28–30°C.

[0011] Preferably, the rotation speed of the oscillating enzymatic hydrolysis is 120-180 r / min, and more preferably 150 r / min.

[0012] Preferably, the temperature for the oscillating enzymatic hydrolysis is 1-3 hours, and more preferably 2.5-3 hours.

[0013] Preferably, the post-treatment method for the enzymatic hydrolysate includes: rinsing and filtering the hydrolysate with STC solution, centrifuging, and resuspending the precipitate in STC solution to obtain Beauveria bassiana protoplasts. The preferred STC solution is: 1.2M sorbitol, 10mM Tris (pH 7.5), and 50mM CaCl2. The preferred centrifugation temperature is 4°C and 2000 x g.

[0014] The present invention also provides Beauveria bassiana protoplasts prepared by the method.

[0015] This invention also provides the application of the collapse enzyme in the preparation of Beauveria bassiana protoplasts, the application comprising: obtaining Beauveria bassiana hyphae and rinsing them with NaCl solution; mixing the rinsed Beauveria bassiana hyphae with an enzymatic hydrolysate at a ratio of 1g:50mL and shaking for enzymatic hydrolysis; after enzymatic hydrolysis, post-treatment of the enzymatic hydrolysate to obtain Beauveria bassiana protoplasts; wherein the concentration of the collapse enzyme in the enzymatic hydrolysate is 5-20g / L.

[0016] This invention also provides a method for constructing a D-HPPA-producing *Beauveria bassiana* genetically engineered bacterium, comprising: constructing an expression plasmid containing the VHB gene, wherein the VHB gene is regulated by the promoter GPDA; introducing the expression plasmid containing the VHB gene into the protoplasts of *Beauveria bassiana* ZJB23323 to construct the *Beauveria bassiana* genetically engineered bacterium; wherein the protoplasts of *Beauveria bassiana* ZJB23323 are prepared by the method for preparing *Beauveria bassiana* protoplasts using a breakdown enzyme. *Beauveria bassiana* ZJB23323 has been disclosed in patent CN116590153A.

[0017] As a preferred method, the expression plasmid containing the VHB gene was introduced into the protoplasts of *Beauveria bassiana* ZJB23323 using a PEG-CaCl2-mediated chemical transformation. The transformations of *Beauveria bassiana* were screened using resistance selection, with the resistance gene being the glufosinate resistance gene Bar (GenBank accession number X17220). The specific transformation method includes: adding 100 μL of protoplast suspension and 10 μg of expression plasmid containing the VHB gene to a transformation tube, gently mixing, and incubating on ice for 15–20 min. Then, adding 50 μL of 60% PEG6000 and incubating on ice for 15–20 min, followed by adding 500 μL of 60% PEG6000 and 1 mL of STC solution. After thorough mixing, the transformation system is added to 10 mL of MYG semi-solid medium containing 0.5% agar powder with 200 μg / mL glufosinate resistance, cooled to room temperature. After shaking well, the medium is poured onto MYG plates with the same glufosinate resistance concentration and incubated at 28°C for 4–5 days to obtain transformants.

[0018] The genetically engineered strain of *Beauveria bassiana*, which produces D-HPPA, was applied to the microbial fermentation process for the preparation of D-HPPA. The application includes: using the wet cells obtained from the fermentation culture of the genetically engineered *Beauveria bassiana* producing D-HPPA as a catalyst, and D-PPA as a substrate, a reaction system is constructed in a buffer solution to synthesize D-HPPA.

[0019] The beneficial effects of this invention: To solve the problem of poor enzymatic hydrolysis in the preparation of Beauveria bassiana protoplasts, the inventors' team tried using lysozyme, lysozyme, cellulase, chitinase, glucanase, driselase, snail enzyme, and yatalase to enzymatically hydrolyze Beauveria bassiana. They found that only driselase and yatalase had an enzymatic hydrolytic effect on mycelia. However, the hydrolytic effect of the two enzymes combined on mycelia was not as good as that of driselase alone. Based on this, this invention explored the optimal enzymatic hydrolysis conditions for driselase. Under the optimal hydrolysis conditions, the protoplast yield of Beauveria bassiana reached 2.56*10⁻⁶. 7 Compared to the method used by Li Shujiang, Zhu Tianhui, and others to prepare protoplasts using cellulase:snailase:lysozyme, the protoplast yield increased by approximately 2.56 times. Based on this method, this invention also provides a method for constructing a genetically engineered strain of D-HPPA-producing Beauveria bassiana. By enhancing the oxygen utilization rate of Beauveria bassiana, the conversion efficiency of the substrate D-PPA is improved. After static biofilm fermentation, the H-PPA yield can reach 25 g / L or higher on the tenth day, slightly higher than the starting strain, providing a new approach for preparing competent cells by overexpressing potential genes. Attached Figure Description

[0020] Figure 1 This is a morphological image of the Beauveria bassiana protoplasts obtained in Example 1 of the present invention under a 40× optical microscope.

[0021] Figure 2 This is a gel image for verifying the PUC19-VHB transformant in Example 2 of the present invention.

[0022] Figure 3 This is a fermentation diagram of the PUC19-VHB transformant in Example 2 of the present invention. Detailed Implementation

[0023] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0024] Example 1: Preparation of Beauveria bassiana protoplasts using a breakdown enzyme under different enzymatic hydrolysis conditions

[0025] Beauveria bassiana protoplasts were prepared using the decomposition enzyme according to the conditions shown in Table 1. The specific steps are as follows.

[0026] (1) Beauveria bassiana was inoculated into a 250 mL Erlenmeyer flask and cultured at 150 r and 28 ℃ for 3-5 days to obtain mycelia in a liquid environment. After filtration through four layers of gauze, it was rinsed 3-5 times with 0.8 M NaCl solution for use.

[0027] (2) Preparation of enzyme hydrolysate: The concentrations of the decomposing enzyme in the enzyme hydrolysate were 5, 10, 15 and 20 g / L, respectively;

[0028] (3) Mix 1g of the mycelium obtained in step (1) with 10mL of the enzyme hydrolysate prepared in step (2) at different concentrations in 50mL centrifuge tubes, place them on a shaker at 150r / min for 1, 1.5, 2, 2.5 and 3h respectively, and enzymatically hydrolyze at 24, 26, 28 and 30℃ respectively.

[0029] (4) After the enzymatic hydrolysis, the hydrolysate was rinsed on a sterile filter cloth with STC solution (1.2M sorbitol, 10mM Tris (pH 7.5), 50mM CaCl2). After rinsing twice, the solution was centrifuged at 4℃ / 2000xg. The precipitate was resuspended in STC solution to obtain Beauveria bassiana protoplasts.

[0030] The prepared Beauveria bassiana protoplasts were counted using a snowball counter, and the results are shown in Table 1. Protoplast count (units / mL) = (total number of protoplasts in 100 small squares / 100) × 400 × 1000 × dilution factor.

[0031] Table 1. Preparation of Beauveria bassiana protoplasts using collapse enzyme under different enzymatic hydrolysis conditions.

[0032]

[0033] According to methods 1, 2, 8, and 4, when the driselase concentration is less than 15 g / L, the number of protoplasts gradually increases with increasing driselase concentration. However, when the concentration reaches 20 g / L, the number of protoplasts decreases instead of increasing. According to methods 5-9, an excessively long hydrolysis time (3 h) does not further improve the hydrolysis effect; in fact, the number of protoplasts obtained is slightly lower than under the 2.5 h condition. Considering the effect of increased temperature on cell activity, the maximum hydrolysis temperature was set at 30℃. Therefore, as shown in Table 1, the optimal hydrolysis conditions are a driselase concentration of 15 g / L, a hydrolysis time of 2.5 h, and a hydrolysis temperature of 30℃.

[0034] Comparative Example 1: Preparation of Beauveria bassiana protoplasts using different enzymes under the same enzymatic hydrolysis conditions

[0035] Following the steps of Example 1, under the enzymatic hydrolysis conditions of Method 13, *Beauveria bassiana* was enzymatically hydrolyzed using 15 g / L of lysozyme, lysozyme, cellulase, chitinase, glucanase, snail enzyme, and yatalase, respectively. The results are shown in Table 2. Lysozyme, lysozyme, cellulase, chitinase, glucanase, and snail enzyme showed no hydrolytic effect on the mycelia of *Beauveria bassiana*. The hydrolytic effect of combining yatalase and lysozyme in different proportions was far inferior to that of either yatalase or lysozyme alone. The hydrolytic effect of lysozyme alone was significantly better than that of yatalase, with protoplast yield reaching 2.56 × 10⁻⁶ under the conditions of Method 13. 7 per mL.

[0036] Table 2. Preparation of Beauveria bassiana protoplasts using different enzymes under the same enzymatic hydrolysis conditions.

[0037] method enzymes <![CDATA[Number of protoplasts (10 7 cells / mL)]]> Method 14 Lysozyme 0 Method 15 Lysosomes 0 Method 16 Cellulase 0 Method 17 Chitinase 0 Method 18 glucanase 0 Method 19 snail enzyme 0 Method 20 yatalase enzyme 1.04 Method 20 16 g / L breakdown enzyme + 4 g / L yatalase enzyme 0.19 Method 21 12 g / L breakdown enzyme + 8 g / L yatalase enzyme 0.0825 Method 22 8 g / L breakdown enzyme + 12 g / L yatalase enzyme 0.06 Method 23 4 g / L catabolase + 16 g / L yatalase 0.12

[0038] Comparative Example 2: Preparation of Beauveria bassiana protoplasts using conventional methods

[0039] Traditional methods utilize common enzymes such as lysozyme, lysozyme, cellulase, chitinase, glucanase, and snailase to prepare protoplasts of Beauveria bassiana. Among these, Li Shujiang, Zhu Tianhui, and others used cellulase, snailase, and lysozyme in a ratio of 5:2.5:2.5 (mg / mL) to prepare protoplasts. The enzymatic hydrolysis temperature was 32℃, and the hydrolysis time was 3 hours, achieving a protoplast yield of up to 1*102. 7 The number of cells / mL is significantly higher than that of Li Shujiang, Zhu Tianhui, and others. Compared with the methods of Li Shujiang, Zhu Tianhui, and others, the method of preparing protoplasts in this invention achieves a protoplast yield of 2.56 times (method 13) and 2.44 times (method 8) using a single enzyme. It also has the advantages of shorter enzymatic hydrolysis time and lower enzymatic hydrolysis temperature. Furthermore, the lower enzymatic hydrolysis temperature (28-30℃) can reduce the impact of high temperature on cell activity.

[0040] Example 2: Construction of a D-HPPA-producing Beauveria bassiana genetically engineered strain

[0041] (1) Construction of expression plasmid containing VHB gene: The overexpression plasmid PUC19-VHB was constructed using the PUC19 plasmid containing the ampicillin resistance gene. The promoter of the target gene VHB from Fusarium fujikuroi was GPDA. The Beauveria bassiana transformants were screened using resistance screening, and the resistance gene was the glufosinate resistance gene Bar (GenBank accession number X17220). The primers used in the construction process are shown in Table 3. The total PCR reaction system was 50 μL: 2 μL Fusarium fujikuroi 978# whole genome template, 25 μL 2×PhantaMix Buffer, 2 μL each of forward and reverse primers, 1 μL dNTPMix, 1 μL PhantaMix Super-Fidelity, and ddH2O to make up to 50 μL (the reagents used in the PCR reaction were purchased from Novizan Biosciences Co., Ltd.). The PCR reaction conditions were: 95℃ for 10 min, (95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, 30 cycles), and extension at 72℃ for 10 min.

[0042] Table 3. Primer Table

[0043] Primers sequence AF GCCGGTCTTGCGATGCAACGTATCTTATTTAAAGTGCGTTG GPDA-R GGTGATGTCTGCTCAAGCG BF TATTCTACCCAAGCATCCAAATGAGCCCAGAACGACGC BR ATCGCAAGACCGGCAA trpc-R TTGGATGCTTGGGTAGAATAGG VHB-F TGAGCAGACATCACCATGCTGGACCAGCAGACATTAATATT VHB-R CCCTCTTGCTCAATCATTACTCCACGGCCTGAGCATA YF TGCATCTAGATATCGGATCC Y-VHB-R CACAATGGGATAGTGGGC

[0044] (2) The expression plasmid PUC19-VHB was introduced into the protoplasts of Beauveria bassiana ZJB23323 prepared by method 8 in Example 1 to obtain the D-HPPA-producing Beauveria bassiana genetically engineered strain. Beauveria bassiana ZJB23323 has been disclosed in patent CN116590153A and is deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M2023584, deposit date: April 21, 2023, address: Wuhan University, Wuhan, China, 430072. The constructed PUC19-VHB plasmid was transformed and integrated using a PEG-CaCl2-mediated chemical transformation method: 100 μL of protoplast suspension and 10 μg of the prepared PUC-VHB plasmid were added to a transformation tube, gently mixed, and incubated on ice for 20 min. Then, 50 μL of 60% PEG6000 was added, and the tube was incubated on ice for 20 min. Finally, 500 μL of 60% PEG6000 and 1 mL of STC solution were added and thoroughly mixed. This transformation system was then added to 10 mL of MYG semi-solid medium (MYG medium: maltose 5 g / L, yeast extract 5 g / L, glucose 10 g / L, sucrose 171 g / L, agar powder 15 g / L) containing 0.5% agar powder and cooled to room temperature (MYG medium: maltose 5 g / L, yeast extract 5 g / L, glucose 10 g / L, sucrose 171 g / L, agar powder 15 g / L) containing 200 μg / mL glufosinate resistance. The mixture was shaken well and poured onto MYG plates with the same glufosinate resistance concentration. The plates were incubated at 28°C for 4–5 days to obtain transformants. The transformants were sent to Qingke Technology for sequencing, using YF / Y-VHB-R primers. A validation gel image of the PUC19-VHB transformants is shown below. Figure 2 .

[0045] (3) The genetically engineered strain of Beauveria bassiana that produces D-HPPA was applied to the microbial fermentation preparation of D-HPPA. Using the genetically engineered strain of Beauveria bassiana that produces D-HPPA and the wet cells obtained by fermentation culture of the starting strain as catalysts, and D-PPA as substrate, a reaction system was formed in a buffer solution to synthesize D-HPPA.

[0046] Seed culture: Scrape an appropriate amount of spore powder from an agar plate containing 50g / LPPA into a fermentation medium and culture it on a shaker for 3-5 days.

[0047] Liquid volume: 20mL / 250mL small shake flask.

[0048] Transfer inoculation amount: 10%, 2 mL per bottle.

[0049] Fermentation medium formula: 50 g / L R-PPA, 40 g / L glucose, 10 g / L yeast extract, 0.977 g / L anhydrous magnesium sulfate, 0.755 g / L anhydrous calcium chloride, 1.8 g / L dipotassium hydrogen phosphate, 0.75 g / L potassium dihydrogen phosphate, 50 ml / L trace elements (2000 mg / L EDTA-2Na, 600 mg / L ferrous sulfate heptahydrate, 200 mg / L zinc sulfate, 150 mg / L manganese sulfate, 30 mg / L boric acid, 20 mg / L cobalt chloride hexahydrate, 40 mg / L copper chloride dihydrate, 40 mg / L nickel chloride hexahydrate, 5 mg / L sodium molybdate dihydrate).

[0050] After inoculation, the cultures were placed in a fermentation room at 28°C for static culture. On the fourth and seventh days of fermentation, 3 mL and 5 mL of glucose solution (400 g / L) were added, respectively. On the tenth day of fermentation, samples (engineered strains v1, v2, v3, v10, v11, and v12) were taken and the H-PPA yield was detected by HPLC after treatment of the products.

[0051] HPLC detection method:

[0052] (1) Preparation of mobile phase: A phosphoric acid solution with a pH of 2.0 was prepared using ultrapure water and mixed with chromatographic grade acetonitrile at a ratio of 6:4 (V:V). The prepared mobile phase was filtered through a 0.22 μm organic filter membrane and degassed by ultrasonication before use.

[0053] (2) HPLC conditions: The chromatographic column was an Elite C18 Hypersil ODS 25μm (4.6mm×250mm); the mobile phase was an aqueous phosphoric acid solution (pH=2): acetonitrile = 6:4 (V:V); the flow rate was 1mL / min; the detector was a DAD; the detection wavelength was 220nm; the injection volume was 5μL; and the column temperature was 30℃.

[0054] After static biofilm fermentation, the H-PPA production of certain engineered strains, such as v2, v10, and v11, reached 25 g / L or more on the tenth day, which was slightly higher than that of the starting strain wt (23 g / L). This provides a new approach for preparing competent cells by overexpressing potential genes.

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered Beauveria bassiana strain producing D-HPPA, characterized in that, Include: Construction of expression plasmids containing Fusarium fujikuroi the VHB gene from the source, which is under the control of the promoter GPDA; Introducing the expression plasmid containing VHB gene into the chassis fungus Beauveria bassiana The genetically engineered Beauveria bassiana strain is constructed in the protoplast of ZJB23323. Among them, the chassis bacteria Beauveria bassiana The protoplasts of ZJB23323 were prepared by the following method: [obtaining...] Beauveria bassiana ZJB23323 mycelia were rinsed with NaCl solution. The rinsed mycelia were then mixed with the enzymatic hydrolysate at a ratio of 1 g:50 mL, and the mixture was shaken for enzymatic hydrolysis. The hydrolysis conditions were: 15 g / L of degrading enzyme, 2.5 h of hydrolysis time, and 28–30 °C. After hydrolysis, the hydrolysate was post-treated to obtain… Beauveria bassiana ZJB23323 protoplast.

2. The method of claim 1, wherein, The method for obtaining the mycelium comprises: Beauveria bassiana ZJB23323 was cultured at 120-180 r / min and 25-35 °C for 3-5 days to obtain a mycelium-containing bacterial liquid; the bacterial liquid was filtered and washed with 0.7-1 M NaCl solution to obtain mycelium.

3. The method of claim 1, wherein, The rotation speed of the oscillation enzymolysis is 120-180 r / min.

4. The method of claim 1, wherein, The method for post-treating the enzymolysis liquid comprises: The enzyme hydrolysate is washed with the STC solution, and the precipitate is resuspended in the STC solution after centrifugation to obtain the enzyme hydrolysate Beauveria bassiana ZJB23323 protoplasts.

Images