Application of overexpression of Osbzip64 gene in nitrogen high-efficiency utilization of rice

Abstract

The application discloses application of overexpression of an OsbZIP64 gene in nitrogen high-efficiency utilization of rice and belongs to the technical field of molecular breeding. The application discloses the role of the OsbZIP64 gene in nitrogen high-efficiency utilization of rice for the first time, and the expression level of the gene can be precisely regulated to realize regulation of nitrogen nutrient utilization rate of rice. Overexpression of the rice OsbZIP64 gene significantly improves the nitrogen utilization rate, seed setting rate, effective ear number, yield per plant and dry weight of the plant. Mutation of the OsbZIP64 gene significantly reduces the nitrogen utilization rate, seed setting rate, effective ear number, yield per plant and dry weight of the plant. The application not only promotes increase of the yield of rice, but also effectively alleviates environmental problems caused by excessive application of nitrogen fertilizer, and has great application potential in the field of agriculture, especially in cultivation of crop varieties capable of efficiently absorbing and utilizing nitrogen fertilizer. Wide application of the application will be expected to lead agricultural production to be more environmentally friendly and efficient, and provide strong scientific and technological support for solving global food security problems and environmental protection challenges.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of molecular breeding, and particularly relates to application of overexpression of an OsbZIP64 gene in nitrogen high-efficiency utilization of rice. BACKGROUND

[0002] Rice (Oryza sativa L.) is one of the most important food crops in Asia and even the whole world, and plays a vital role in guaranteeing world food security and meeting the growing demand for food of the population. Nitrogen is the most used fertilizer in the process of rice planting, and is crucial to the improvement of rice yield. The production and use of nitrogen fertilizer in China currently ranks first in the world, and the current use accounts for 38.3% of the global use. However, with the excessive application of nitrogen fertilizer in farmland, the pollution of nitrogen fertilizer to the environment is becoming increasingly serious, and improving the nitrogen utilization efficiency of rice has become one of the important ways to realize the sustainable development of agriculture and environmental protection. In order to realize the sustainable development of agriculture, it is necessary to explore a benign agricultural development road with high efficiency, low consumption, and consideration of production benefit and ecological benefit. And cultivating and utilizing rice varieties with high nitrogen utilization efficiency is one of the most effective ways to effectively utilize fertilizer resources and reduce environmental pollution.

[0003] Nitrogen plays an irreplaceable important role in the growth process of rice, directly affects the growth and development, yield and quality of rice, and its adaptability under adverse environmental conditions. The nitrogen utilization of rice includes the processes of nitrogen absorption, transport, assimilation and reuse, and involves the participation and regulation of multiple genes and multiple pathways. Nitrogen fertilizer exists in the form of nitrate nitrogen and ammonium nitrogen in the soil, and the absorption and transport of nitrate nitrogen and ammonium nitrogen are regulated by NO3 - transporters and NH4 + transporters. Nitrogen assimilation is realized through nitrate reductase, nitrite reductase, glutamine synthetase and glutamate synthetase, and the transport and distribution of nitrogen in the aboveground part of the plant are regulated by nitrogen transporters and amino acid transporters.

[0004] Plants have a rich nitrogen transport gene, which can absorb and redistribute nitrogen nutrients from the soil to meet the needs of crops at various stages of growth, development and reproduction. Among them, transcription factors play a key role in regulating the efficiency of plant nitrogen utilization. These transcription factors affect the physiological and molecular responses of plants under nitrogen deficiency or sufficiency by regulating the expression of related genes, thereby regulating the absorption, transport, distribution and utilization efficiency of nitrogen. In Arabidopsis thaliana, several bZIP transcription factors have been found to play an important role in the regulation of nitrogen utilization efficiency. Among them, an important transcription factor is AlatbZIP1. It achieves these functions by regulating the expression of a series of genes related to nitrogen metabolism, including nitrogen absorption, transport, distribution, and regulation of key enzymes in the nitrogen metabolism pathway. Future research needs to further reveal the specific role and interaction mechanism of different transcription factors in the nitrogen regulatory network, and provide theoretical and technical support for the development of nitrogen-efficient rice varieties. SUMMARY

[0005] The purpose of the present application is to provide the application of overexpression of OsbZIP64 gene in nitrogen-efficient rice, so as to provide a new candidate gene for the development of nitrogen-efficient rice varieties.

[0006] To achieve the above-mentioned purpose, the present application provides the role of overexpression of OsbZIP64 gene in nitrogen-efficient rice, and the nucleotide sequence of the OsbZIP64 gene can be selected from the DNA sequence shown in 1) SEQ ID NO. 3, or 2) a nucleotide sequence that can hybridize to the DNA sequence shown in SEQ ID NO. 3 under high stringent conditions.

[0007] The OsbZIP64 gene protein sequence is as follows (a) or (b) or (c) protein:

[0008] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO. 4;

[0009] (b) a protein derived from (a) by substitution, deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 4 and having the same activity as (a);

[0010] (c) a protein encoded by other genes having more than 50% amino acid identity with the protein consisting of the amino acid sequence shown in SEQ ID NO. 4 and having the same activity as (a).

[0011] Preferably, overexpression of the rice OsbZIP64 gene improves the nitrogen utilization rate of the plant.

[0012] The application of overexpressing the OsbZIP64 gene in improving the yield of rice is as described above, and overexpressing the rice OsbZIP64 gene improves the seed setting rate, effective panicle number, yield per plant or dry weight of rice.

[0013] The application of the recombinant vector containing the overexpressed OsbZIP64 gene in improving the nitrogen utilization rate and yield of rice, wherein the recombinant vector is an overexpression vector.

[0014] An expression vector containing the nitrogen high-efficiency utilization gene OsbZIP64; a transgenic cell line containing the nitrogen high-efficiency utilization gene OsbZIP64; a host cell containing the nitrogen high-efficiency utilization gene OsbZIP64, wherein the host cell is a microbial cell, for example, a fungal cell or a bacterial cell, for example, but not limited to, Agrobacterium, yeast, Escherichia coli, etc.

[0015] The application of the host cell containing the recombinant vector of the OsbZIP64 gene in improving the nitrogen utilization rate and yield of rice, wherein the host cell is a microbial cell, preferably an Escherichia coli cell or an Agrobacterium cell.

[0016] The OsbZIP64 gene or an active fragment thereof or a recombinant expression vector containing the OsbZIP64 gene can be introduced into a plant cell by conventional transformation or transfection technology to obtain a transgenic plant cell, and further obtain a transgenic plant overexpressing the OsbZIP64 gene or the active fragment thereof.

[0017] It should be understood by those skilled in the art that the plant overexpressing the OsbZIP64 gene can be obtained by transgenic technology, for example, by Agrobacterium-mediated transfection, plasmid transformation, direct DNA transformation, microinjection and the like.

[0018] A rice plant overexpressing the OsbZIP64 gene.

[0019] The application of the OsbZIP64 gene in the breeding of rice varieties with high nitrogen utilization efficiency as described above.

[0020] A method for breeding a plant with high nitrogen utilization efficiency, the method comprising: introducing a nitrogen utilization efficiency gene OsbZIP64 or an active fragment thereof into a plant cell, thereby obtaining a transgenic plant with enhanced nitrogen utilization efficiency, or using a hybridization method to obtain a progeny plant overexpressing the nitrogen utilization efficiency gene OsbZIP64 or an active fragment thereof. In an embodiment of the present application, the plant includes, but is not limited to, rice, Arabidopsis, wheat, corn, cotton, canola or soybean, preferably rice. In an embodiment of the present application, the plant overexpressing the nitrogen utilization efficiency gene OsbZIP64 is further obtained. The specific transformation and selection methods in the method can be carried out according to various ways known in the art. In an embodiment of the present application, the method can be carried out according to the procedures described in the examples and appropriately modified according to different plants.

[0021] Preferably, the method further comprises a step of codon optimization of the above-mentioned gene for the codon usage of the plant before being introduced into the plant cell.

[0022] A method for breeding a plant with high nitrogen utilization efficiency, the method comprising: introducing a nitrogen utilization efficiency gene OsbZIP64 or an active fragment thereof into a plant cell, thereby obtaining a transgenic plant with enhanced nitrogen utilization efficiency, or using a hybridization method to obtain a progeny plant overexpressing the nitrogen utilization efficiency gene OsbZIP64 or an active fragment thereof. In an embodiment of the present application, the plant includes, but is not limited to, rice, Arabidopsis, wheat, corn, cotton, canola or soybean, preferably rice. In an embodiment of the present application, the plant overexpressing the nitrogen utilization efficiency gene OsbZIP64 is further obtained. The specific transformation and selection methods in the method can be carried out according to various ways known in the art. In an embodiment of the present application, the method can be carried out according to the procedures described in the examples and appropriately modified according to different plants.

[0023] In another embodiment, the nitrogen utilization efficiency gene OsbZIP64 is introduced into a progeny plant by a hybridization method.

[0024] For example, a plant comprising an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or an active fragment thereof is crossed with another plant to obtain a progeny plant, and a hybrid plant stably homozygous containing the nucleotide sequence or the active fragment thereof is screened, and the obtained hybrid progeny plant has improved nitrogen utilization efficiency compared with the plant without hybridization.

[0025] It should be understood by those skilled in the art that the above-mentioned method further comprises a step of codon optimization of the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 for the codon usage of the plant before being introduced into the plant cell.

[0026] The breeding method of the present application can be used for breeding rice, corn, wheat, cotton, rape, soybean, pasture or Arabidopsis, preferably for breeding rice. By using the method, plant varieties with improved nitrogen utilization efficiency can be obtained. The principle of breeding is to overexpress the OsbZIP64 gene in the plant, specifically, by overexpressing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or an active fragment thereof in the plant. The transgenic plants or hybrid offspring plants obtained by using the breeding method have growth advantages under low nitrogen and / or high nitrogen growth conditions. In the present application, the normal nitrogen application amount is generally 150 kg of nitrogen per hectare, and "low nitrogen growth conditions" generally refer to applying 0.1-0.5 times the normal nitrogen application amount of nitrogen fertilizer, and "high nitrogen growth conditions" generally refer to applying 1.5-2.0 times the normal nitrogen application amount of nitrogen fertilizer.

[0027] When used for breeding rice with improved nitrogen utilization efficiency, the breeding method comprises: introducing an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or an active fragment thereof into rice cells to obtain transgenic rice cells, generating transgenic rice plants expressing the isolated nucleotide sequence or the active fragment thereof from the transgenic rice cells, and the transgenic rice has improved nitrogen utilization efficiency compared with control rice which is not introduced with the isolated nucleotide sequence or the active fragment thereof; or the method comprises: crossing a rice plant containing the isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or an active fragment thereof with another rice plant to obtain offspring rice plants, and screening for hybrid plants stably homozygous containing the nucleotide sequence or the active fragment thereof, and the obtained hybrid offspring plants have improved nitrogen utilization efficiency compared with the rice plants which are not crossed.

[0028] In addition, the present application introduces an isolated nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO. 4 or an active fragment thereof into the mutant nlp7-1 cells of the model plant Arabidopsis thaliana with low nitrogen utilization efficiency, to obtain transgenic Arabidopsis thaliana cells, and generate transgenic Arabidopsis thaliana plants expressing the isolated nucleotide sequence or the active fragment thereof from the transgenic Arabidopsis thaliana cells, and the transgenic Arabidopsis thaliana has improved nitrogen utilization efficiency compared with the control Arabidopsis thaliana which is not introduced with the isolated nucleotide sequence or the active fragment thereof. This result shows that the gene provided by the present application is functionally conserved in the model plant, and provides strong evidence for the gene in different crop breeding.

[0029] In general, the nitrogen-efficient utilization gene provided by the present application, named OsbZIP64, is derived from rice, and is one of the following nucleotide sequences:

[0030] 1) a nucleotide sequence encoding the polypeptide shown in SEQ ID NO. 4;

[0031] 2) the DNA sequence of SEQ ID NO. 3;

[0032] 3) a nucleotide sequence hybridizing under high stringency conditions with the DNA sequence as defined in SEQ ID NO. 3.

[0033] The so-called high stringency conditions are hybridization in a solution of 0.1 x SSPE (or 0.1 x SSC), 0.1% SDS at 65°C, and washing the membrane.

[0034] SEQ ID NO. 3 consists of 1254 bases, and its coding sequence is from the 1st base at the 5' end, encoding the amino acid sequence shown in SEQ ID NO. 4.

[0035] The expression vector, transgenic cell line and host strain containing the nitrogen utilization gene of the present application are also within the protection scope of the present application.

[0036] The primer pair for amplifying any of the fragments of OsbZIP64 is also within the protection scope of the present application.

[0037] The plant expression vector is used to introduce the nitrogen utilization gene of the present application into plant cells, so as to obtain a transgenic cell line and transgenic plant with enhanced nitrogen utilization efficiency.

[0038] The plant expression vector includes binary Agrobacterium vector and vector for plant microprojectile bombardment, etc. The plant expression can also contain the 3' untranslated region of the exogenous gene, i.e. containing polyadenyl signal and any other DNA fragment that can participate in mRNA processing or gene expression. The polyadenyl signal can guide the addition of polyadenyl to the 3' end of mRNA precursor, such as the 3' untranslated region of Agrobacterium crown gall inducing (Ti) plasmid gene (such as the nopaline synthase NOS gene), plant gene (such as soybean storage protein gene) has similar functions.

[0039] When using OsbZIP64 to construct a plant expression vector, any one of the enhanced promoters or inducible promoters can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, root-specific expression promoter, etc., which can be used alone or in combination with other plant promoters; in addition, when using the gene of the present application to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codon or adjacent regions start codon, etc., but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene.

[0040] For the convenience of identifying and screening the transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene (GUS gene, luciferase gene, etc.) encoding an enzyme or a luminescent compound that can produce a color change, a resistant antibiotic marker (gentamicin marker, kanamycin marker, etc.), or an anti-chemical reagent marker gene (such as a herbicide Bar gene), etc. For the safety of the transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under adverse conditions.

[0041] The plant expression vector carrying the OsbZIP64 of the present application can be transformed into plant cells or tissues by using a Ti plasmid, a Ri plasmid, a plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, etc. The transformed plant host can be a monocotyledonous plant such as rice, corn, wheat, etc., or a dicotyledonous plant such as Arabidopsis, soybean, rape, cotton, etc.

[0042] Through the growth experiments of the transgenic rice obtained by transforming the OsbZIP64 gene in different nitrogen level nutrient solutions and field experiments, it is proved that the gene can significantly improve the nitrogen utilization efficiency of the plants and the biomass of the plants after being transformed into the plants. Through the growth experiments of the transgenic Arabidopsis obtained by transforming the OsbZIP64 gene in different nitrogen level culture media, it is proved that the function of the gene is conserved in the model plants. The present application provides a basis for artificially enhancing the nitrogen utilization efficiency of plants, and will play an important role in cultivating plants (especially rice, corn, wheat, rape, soybean, cotton, etc.) with high nitrogen utilization efficiency.

[0043] Therefore, the present application provides the application of the overexpressed OsbZIP64 gene in the nitrogen high-efficiency utilization of rice, and the specific technical effects are as follows:

[0044] (1) The present application first discloses the role of the OsbZIP64 gene in the nitrogen high-efficiency utilization of rice, and the overexpression of the rice OsbZIP64 gene significantly improves the nitrogen utilization rate of the plants, and the mutation of the OsbZIP64 gene significantly reduces the nitrogen utilization rate of the plants;

[0045] (2) The overexpression of the rice OsbZIP64 gene significantly improves the seed setting rate, the effective ear number, the yield per plant, and the dry weight of the rice; the mutation of the OsbZIP64 gene significantly reduces the seed setting rate, the effective ear number, the yield per plant, and the dry weight of the rice;

[0046] (3) Mutating and / or overexpressing the OsbZIP64 gene, the plant develops normally, and the expression level of the gene can be precisely regulated to realize the regulation of nitrogen nutrient utilization rate of rice, which not only can promote the increase of rice yield, but also can effectively alleviate the environmental problems caused by excessive application of nitrogen fertilizer, and has great application potential in the field of agriculture, especially in the cultivation of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as key crops such as rice, corn, wheat, soybean, cotton and rapeseed, and its wide application will be expected to lead to more environmentally friendly and efficient agricultural production, and provide strong scientific and technological support for solving the global food security problem and environmental protection challenge.

[0047] The technical solutions of the present application will be further described in detail below by means of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0048] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the description of the embodiments of the present application will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.

[0049] Figure 1 is the subcellular localization result of the OsbZIP64 gene in the first embodiment of the present application; wherein A is the GFP green fluorescent protein of the control group, B is the red fluorescent observation result of the control group, C is the protoplast state under bright field of the control group, D is the cell state under bright field of the control group, E is the GFP green fluorescent protein of OsbZIP64, F is the red fluorescent observation result of OsbZIP64, G is the protoplast state under bright field of OsbZIP64, H is the cell state under bright field of OsbZIP64,

[0050] Figure 2 is the physical map of the recombinant expression vector pEGOEP-OsbZIP64 constructed in the second embodiment of the present application;

[0051] Figure 3 is the relative expression amount result of the transgenic positive plant and the WT plant in the second embodiment of the present application;

[0052] Figure 4 is the physical map of the pYLCRISPRbZIP64-gRNA recombinant expression vector obtained in the third embodiment of the present application and the target position information map;

[0053] Figure 5 is the sequencing result information of the OsbZIP64 gene mutation site of the transgenic positive plant in the third embodiment of the present application;

[0054] Figure 6WT, OsbZIP64 gene overexpression line (OE-1, OE-2) and mutant line (KO-1, KO-2 and KO-3) seedling bud and root nitrogen absorption rate determination results in Example Four of the present application, wherein WT represents wild type rice;

[0055] Figure 7 WT, OsbZIP64 gene overexpression line (OE-1, OE-2) and mutant line (KO-1, KO-2 and KO-3) seedling bud and root nitrogen absorption rate determination results in Example Four of the present application, wherein WT represents wild type rice; DETAILED DESCRIPTION

[0056] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0057] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely by means of the accompanying drawings and examples. The following detailed description is a description of the examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0058] The methods used in the following examples are all conventional methods in the art unless otherwise specified, and the instruments, reagents and materials used are all commercially available unless otherwise specified.

[0059] Example One

[0060] Obtaining of OsbZIP64 gene cDNA sequence

[0061] (1) Total RNA was extracted from 7-day-old Dongnong 427 rice seedling leaves using TRIzol reagent (Invitrogen, Carlsbad, CA), and 1 μg of total RNA was reverse transcribed using a reverse transcription kit produced by Hangzhou Xinjing Biological Reagent Development Co., Ltd. according to the product usage guide to obtain the cDNA of OsbZIP64 gene.

[0062] The obtained cDNA was used as a template to amplify the OsbZIP64 gene cDNA sequence by RT-PCR using the upstream primer shown in SEQ ID NO.1 and the downstream primer shown in SEQ ID NO.2. The amplification system consisted of: 0.8 μL FastPfu polymerase (Beijing TransGen Biotech Co., Ltd.), 0.5 μL cDNA, 10 μL 5×PCR buffer, 100 μM dNTPs, 25 μM each of upstream and downstream primers, and then the reaction system was brought to 50 μL with double-distilled water. The PCR program was: 95℃ for 1 min, then 58℃ for 30 s, and finally 72℃ for 1 min, for a total of 40 cycles.

[0063] SEQ ID NO.1:AAGTGGTGTTTGCCCTTTGGACCTC

[0064] SEQ ID NO.2:GAGGTCCAAAGGGCAAACACCACTT

[0065] After the reaction, the PCR product was subjected to agarose gel electrophoresis and then recovered using a gel recovery kit. The recovered product was sent to the company for sequencing, and the CDS sequence of the OsbZIP64 gene (nucleotide sequence of the PCR amplification product) was obtained as shown in SEQ ID NO.3. The protein sequence encoded by the amplification product was analyzed and shown in SEQ ID NO.4, which consists of 417 amino acid residues.

[0066] SEQ ID NO.3:

[0067]

[0068]

[0069] SEQ ID NO.4:

[0070]

[0071] (2) Subcellular localization of the OsbZIP64 gene was performed. The empty pEGOEP vector was digested with ECORI, the pEGOEP vector fragment was recovered by gel electrophoresis, and homologous recombination was performed to ligate the target gene into the vector. Transformation was then performed, single spots were selected, and sequencing was conducted. Subcellular localization was clarified by transfecting rice protoplasts, and fluorescence signals were observed using a laser confocal microscope. The results are as follows: Figure 1 As shown, the green fluorescence signal of the control group sample transformed with the empty vector was present in the rice protoplast, while the green fluorescence signal of the OsbZIP64 fusion protein appeared in the nucleus region of the protoplast, indicating that the protein encoded by the OsbZIP64 gene is located in the nucleus.

[0072] Example 2

[0073] Construction of OsbZIP64 gene overexpression vector and obtaining of transgenic positive plants

[0074] (1) Using the primer sequence shown in SEQ ID NO. 5 and SEQ ID NO. 6, the CDS fragment obtained in Example 1 was used as a template for PCR, and the reaction system was 2x PCR buffer 25 μL, 2 mM dNTPs 10 μL, 1 μL of each of the upstream and downstream primers, KOD-FX 1 μL, template 1 μL, and ddH2O to 50 μL. The PCR reaction conditions were: 98°C for 3 min; 98°C for 10 sec, 68°C for 2 min, 32 cycles; 68°C for 4 min.

[0075] SEQ ID NO. 5:

[0076] ACTAGGGTCTCGCACCAAGGTACATGACCTCGGCGGCGCCGGCGGCCGCGCAGTT

[0077] SEQ ID NO. 6:

[0078] ACTAGGGTCTCTCGCCCGCCGGCTCGCGCGGGCGCGCCGCCCAGAGCGA

[0079] The PCR product was subjected to agarose gel electrophoresis, and the 1251 bp electrophoretic fragment was recovered using a gel recovery kit. The enzyme digestion-ligation reaction system was constructed using the components shown in Table 1, and the enzyme digestion-ligation reaction conditions were: 37°C for 5 min, 20°C for 5 min.

[0080] Table 1

[0081] Reagent Amount 10x CutSmart Buffer 1.5 μl 10 mM ATP 1.5 μl pEGOEO empty plasmid 100 ng Gel recovered fragment of interest 50 ng BsaI-HF 10U T4 DNA ligase 35U H2O Final 15 μl

[0082] (2) Take a tube of 100 μL DH5a E. coli competent cells and mix with 5 μL of the obtained ligation product, ice bath for 30 min. Then quickly place in a 42°C constant temperature water bath, heat shock for 90 s, ice bath for 2 min, then add 500 μL of LB liquid medium, mix well. 37°C, 200 rpm for 45 min, so that the cells return to normal growth state. Uniformly spread the bacterial liquid on the Kana-resistant LB solid medium plate, after 30 min, place in a 37°C constant temperature incubator, and incubate overnight.

[0083] The single colony was picked and colony PCR was performed using primers shown in SEQ ID NO. 7 and SEQ ID NO. 8. The PCR system was as follows: 2x Taq Mix 10 μL, 0.5 μL of each primer, and ddH2O was added to 20 μL. The PCR reaction program was as follows: 95 °C for 5 min; 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 2 min, 25 cycles; 72 °C for 5 min. The band size was about 1400 bp. The positive bacterial plaque detected was picked and shaken.

[0084] SEQ ID NO. 7: CACGGGGGACTCTTGCCACC

[0085] SEQ ID NO. 8: GACACGCTGAACTTGTGG

[0086] The plasmid was extracted by using a plasmid extraction kit, and was sent to a company for sequencing. The plasmid with correct sequencing was the recombinant expression vector pEGOEO-OsbZIP64, and a physical map thereof is shown in Figure 2

[0087] (3) The recombinant expression vector pEGOEO-OsbZIP64 constructed above was introduced into wild type Dongnong 427 by using an Agrobacterium EHA105 mediated genetic transformation method (for details, refer to Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 16: 271-282).

[0088] After the transgenic plants grew up, the leaves were cut and DNA was extracted. The obtained DNA was used as a template for PCR to screen positive plants into which the OsbZIP64 gene was transferred, and seeds were collected from single plants until T2 generation to detect transgenic positive homozygous plants.

[0089] ​The transgenic positive homozygous lines germinated on MS medium (see Table 2 for formula) were identified by qRT-PCR to determine the expression amount of OsbZIP64 gene in each line. The expression amount of OsbZIP64 in wild type and overexpression lines was also detected. The specific operation is as follows: take the 7-day-old seedlings of OsbZIP64 overexpression lines and wild type, extract total RNA according to the method in step 1, and obtain cDNA by reverse transcription. Take the cDNA as template, take ACTIN1 gene as internal reference (the upstream primer sequence of amplifying ACTIN1 gene is shown as SEQ ID NO. 9, and the downstream primer sequence is shown as SEQ ID NO. 10), take the primers shown as SEQ ID NO. 11 and SEQ ID NO. 12, and use Q-PCR kit (Takara Premix ExTaqT MII) produced by Dalian Baosheng Engineering Company to perform qRT-PCR. The qRT-PCR system is: 10 μM LP 0.25 μL, 10 μM RP 0.25 μL, cDNA 0.3 μL, ddH2O 4.2 μL, SYBR Green reagent 5 μL. The qRT-PCR program is: 95℃, 1 min; 95℃, 5 s; 60℃, 30 s, 40 cycles.

[0090] SEQ ID NO. 9: TGGTCGTACCACAGGTATTGTGTT

[0091] SEQ ID NO. 10: AAGGTCGAGACGAAGGATAGCAT

[0092] SEQ ID NO. 11: ATGACCTCGGCGGCGCCGGCGGCCG

[0093] SEQ ID NO. 12: CGGCCGCCGGCGCCGCCGAGGTCAT

[0094] Two lines of overexpression OsbZIP64 gene rice lines were selected from the constructed lines, named OE-1 and OE-2, respectively, for subsequent experiments. The relative expression amount results of OE-1, OE-2 and WT plants are shown in Table 3. Figure 3

[0095] Table 2: MS medium formula (1L)

[0096] 10x Macro Elements (MSmax) 100 mL 100x Micro Elements (MSmin) 10 mL Iron salt 10 mL Sucrose 100g Water q.s. to 1 L

[0097] Example Three

[0098] Construction of OsbZIP64 gene CRISPR-cas9 expression vector and obtaining of transgenic positive plants

[0099] ​(1) According to the "Golden Gate" cloning method, the gRNA expression cassette with a target point is connected to the pYLCRISPR / Cas9Pubi-H vector skeleton, and the constructed vector is the pYLCRISPRbZIP64-gRNA recombinant expression vector (physical map and target point position information see Figure 4 ).

[0100] (2) Obtaining and identifying OsbZIP64 gene CRISPR-cas9 transgenic plants

[0101] The pYLCRISPRbZIP64-gRNA recombinant expression vector obtained in step (1) is introduced into wild type Dongnong 427 rice variety by Agrobacterium EHA105 mediated genetic transformation method (for specific steps, see Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, 1994, Plant Journal 6:271-282).

[0102] After the transgenic plants grow, the leaves are cut to extract DNA, and the primers shown in SEQ ID NO. 13 and SEQ ID NO. 14 are used for PCR, and the PCR product is sent to the company for sequencing, and the positive plants with effective mutation of OsbZIP64 gene are screened out, and the seeds are collected for single plant, and the homozygous plants are detected in T2 generation. From the obtained multiple OsbZIP64 gene mutant lines, 3 lines are selected for subsequent experiments, and the selected 3 OsbZIP64 gene mutant lines are named as KO-1, KO-2 and KO-3 respectively, and the sequencing results of the 3 lines are shown in Figure 5 , the OsbZIP64 gene of KO-1 line has a deletion of 1 base at the target point position, the OsbZIP64 gene of KO-2 line has an insertion of 2 bases at the target point position, and the OsbZIP64 gene of KO-3 line has a deletion of 3 bases at the target point position.

[0103] Example Four

[0104] Evaluation of nitrogen utilization efficiency of transgenic positive lines obtained in examples two and three

[0105] 1. Nitrogen absorption rate of WT, overexpression lines and mutant lines at seedling stage

[0106] Each line is grown to seedling stage under normal conditions in the field, and the nitrogen absorption rate of each line is determined. The results are shown in Figure 6As shown, the nitrogen uptake rate of the shoot and root of the seedling overexpression line is significantly higher than that of the wild type, while the nitrogen uptake rate of the shoot and root of KO-1, KO-2 and KO-3 lines is significantly lower than that of the wild type.

[0107] 2. Growth status of WT, overexpression line and mutant line under normal field conditions

[0108] Each line is grown for 3 months under normal field conditions, the growth status of each line is observed, and the seed setting rate, effective ear number, yield per plant and dry weight of each line are photographed and counted, and the counting results are as shown in Table 2. Figure 7 As shown, the seed setting rate of the overexpression line is slightly increased, but not obvious, the effective ear number is significantly increased, the yield is significantly increased, and the dry weight is significantly increased; while the seed setting rate of KO-1, KO-2 and KO-3 lines is slightly decreased, but not obvious, but the effective ear number is significantly decreased, the yield is significantly decreased, and the dry weight is significantly decreased; the above data show that the rice overexpressing OsbZIP64 gene has obvious advantages in growth in the field, suggesting that this gene will be a gene with broad application prospects, which can improve the nitrogen use efficiency of crops, thereby increasing the biomass and yield of crops and reducing environmental pollution.

[0109] Therefore, the application first discloses the role of OsbZIP64 gene in the nitrogen high-efficiency utilization of rice, and overexpression of rice OsbZIP64 gene significantly improves the nitrogen utilization rate of the plant, and mutation of OsbZIP64 gene significantly reduces the nitrogen utilization rate of the plant; overexpression of rice OsbZIP64 gene significantly improves the seed setting rate, effective ear number, yield per plant and dry weight of rice; mutation of OsbZIP64 gene significantly reduces the seed setting rate, effective ear number, yield per plant and dry weight of rice; mutation and / or overexpression of OsbZIP64 gene, the plant develops normally, the expression level of the gene can be accurately controlled to realize the regulation of the nitrogen nutrient utilization rate of rice, which not only can promote the increase of rice yield, but also can effectively alleviate the environmental problems caused by excessive application of nitrogen fertilizer, and has great application potential in the field of agriculture, especially in the cultivation of crop varieties that can efficiently absorb and utilize nitrogen fertilizer, such as key crops such as rice, corn, wheat, soybean, cotton and oilseed rape, and its wide application will be expected to lead agricultural production to be more environmentally friendly and efficient, and provide strong scientific and technological support for solving the global food security problem and environmental protection challenge.

[0110] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application rather than limit them, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. overexpression OsbZIP64 The application of the genes in nitrogen high-efficiency utilization of rice is characterized in that: The OsbZIP64 The nucleotide sequence of the gene is shown as SEQ ID NO. 3, and the protein sequence is shown as SEQ ID NO.

4.

2. The overexpression of claim 1 OsbZIP64 The application of the genes in increasing yield of rice is characterized in that: Overexpression of rice OsbZIP64 genes increases seed set, effective panicle number, yield per plant, or dry weight in rice.

3. A composition comprising the recombinant vector of claim 1 OsbZIP64 The application relates to the application of a recombinant vector containing a gene in improving nitrogen utilization and yield of rice, characterized in that: The recombinant vector is an overexpression vector.

4. A composition comprising the compound of claim 3 OsbZIP64 The application relates to the application of a host cell of a genetic recombination vector in improving nitrogen utilization and yield of rice, characterized in that: The host cell is an E. coli cell or an Agrobacterium cell.

Images