Construction method and application of genetically modified mesenchymal stem cells

Abstract

The invention discloses a construction method and application of a gene modified mesenchymal stem cell. The construction method comprises the following steps: constructing a recombinant lentivirus carrying PD-L1 and ICAM1 genes; the recombinant lentivirus carrying the PD-L1 gene and the ICAM1 gene is transfected with mesenchymal stem cells, and the mesenchymal stem cells are screened by puromycin, so that an engineered mesenchymal stem cell strain modified by the PD-L1 gene and the ICAM1 gene is obtained; the mesenchymal stem cells provided by the invention are modified by engineering genes of PD-L1 and ICAM1, and are screened by puromycin to obtain a mesenchymal stem cell strain capable of stably and highly expressing the genes of PD-L1 and ICAM1; after the mesenchymal stem cells highly expressing the PD-L1 and ICAM1 genes are intravenously injected into an autoimmune hepatitis animal model, the autoimmune hepatitis symptom can be remarkably relieved, the liver injury degree can be reduced, the expression of inflammatory factors can be regulated, the inflammatory reaction can be inhibited, and the obvious curative effect can be achieved.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a method for constructing gene-modified mesenchymal stem cells and applications thereof. Background Art

[0002] Mesenchymal stem / stromal cells (MSCs) are a type of adult stem cell derived from the early mesoderm of development, with self-replication and multidirectional differentiation potential, and are widely found in tissues such as bone marrow, fat, umbilical cord, placenta, and dental pulp. MSCs have strong paracrine, immunomodulatory, and injury repair properties, making them potential candidates for biological treatment of a variety of diseases; however, MSCs have strong heterogeneity, which poses a great obstacle to clinical translational applications. Therefore, the development of an immunomodulatory-enhanced MSCs with clinical translational potential is of great significance for stem cell therapy of a variety of diseases.

[0003] A large amount of research evidence shows that MSCs exert their immunomodulatory effects mainly through their expression of related immunomodulatory molecules. Studies have shown that programmed cell death 1 ligand 1 (PD-L1), as a cell surface molecule, can also be secreted outside the cell, that is, it can exert immunomodulatory effects through direct or indirect pathways. Our previous studies found that the expression of PD-L1 is positively correlated with the immunomodulatory ability of MSCs, and in the autoimmune hepatitis (AIH) mouse model, the therapeutic effect of MSCs with high expression of PD-L1 is significantly better than that of MSCs with low expression of PD-L1 (Bai et al, Stem Cell Res Ther. 2023 Dec 18; 14 (1): 370.). This research result fully demonstrates that PD-L1 is an important effector molecule for MSCs to exert their immunomodulatory function. It is worth noting that for MSCs in vivo treatment, in addition to carrying effector molecules that exert therapeutic effects, the large-scale and efficient migration and homing of MSCs to the site of lesions is a prerequisite for their therapeutic effect. The efficiency of their homing directly determines the effectiveness of their in vivo treatment.

[0004] A large number of studies have shown that ICAM1, as a cell adhesion molecule, mediates the recognition and adhesion between cells and cells and between cells and extracellular matrix. In recent years, researchers have found that ICAM1 plays an important role in the homing process of MSCs. When the bone marrow mesenchymal stem cells (BMMSCs) of mice overexpress the ICAM1 gene, their in vitro migration ability is significantly increased. More importantly, researchers have found that ICAM1 can mediate close contact between BMMSCs and T cells by binding to its receptor, lymphocyte function associated antigen-1 (LFA-1). When ICAM1 on the surface of BMMSCs is blocked or the expression of ICAM1 gene is downregulated, the immunosuppressive ability of BMMSCs is significantly reduced. This shows that ICAM1 plays an important role in mediating the homing process of MSCs migration.

[0005] Our previous studies have found that there are large differences in the expression of intercellular adhesion molecule 1 (ICAM1) in MSCs from different tissues or donors, and no MSCs cell lines or cell subpopulations that can simultaneously highly express PD-L1 and ICAM1 have been found. There are no reports on the combination of MSCs with PD-L1 and ICAM1 at home and abroad.

[0006] Therefore, in order to solve the above problems, this paper proposes a method for constructing gene-modified mesenchymal stem cells and its application; by simultaneously expressing the immunosuppressive molecule PD-L1 and the homing molecule ICAM1 in the same MSCs cell line, an engineered immunoregulatory enhanced mesenchymal stem cell is constructed. This strategy will not only improve the homing efficiency of MSCs, but also improve its immunoregulatory ability, which may greatly improve the clinical therapeutic effect of MSCs, thereby solving the current technical bottleneck of MSCs clinical application. And a comprehensive evaluation of its safety and effectiveness was conducted at the cell level and animal level. Summary of the invention

[0007] The purpose of the present invention is to design a method for constructing gene-modified mesenchymal stem cells that can significantly alleviate the symptoms of autoimmune hepatitis, reduce the degree of liver damage, regulate the expression of inflammatory factors, and inhibit inflammatory responses in animal models.

[0008] In order to achieve the above technical effects, the present invention is implemented by the following technical solutions: A method for constructing genetically modified mesenchymal stem cells, characterized in that it consists of the following steps:

[0009] S1, construction of lentiviral plasmids that highly express PD-L1 and ICAM1 genes;

[0010] S2, co-transfecting the high-expression lentiviral plasmid carrying PD-L1 and ICAM1 genes with the envelope plasmid and the packaging plasmid into 293T cells, packaging the virus, and collecting the viral supernatant;

[0011] S3. The collected viral supernatant was used to transfect mesenchymal stem cells, and then selected by puromycin to obtain a stable engineered mesenchymal stem cell line with high expression of PD-L1 and ICAM1.

[0012] Furthermore, in S1, the construction of a lentiviral plasmid that highly expresses PD-L1 and ICAM1 genes specifically comprises the following steps:

[0013] S1.1. The human PD-L1 and ICAM1 gene sequences were found in NCBI, and PD-L1 and ICAM1 primers were designed using Primer5.0 software to perform PCR amplification of human PD-L1 and ICAM1 genes;

[0014] S1.2, connect the above PCR products to the T vector for sequencing, and the plasmid with the correct sequencing result is named T-PDL1-ICAM1;

[0015] S1.3, double-digest the lentiviral vector plasmids pLV-EF1A-SV40>EGFP:T2A:Puro and T-PDL1-ICAM1 plasmids with XbaI and EcoRI, and then recover the target bands with a gel recovery kit;

[0016] S1.4, the lentiviral vector plasmid pLV-EF1A-SV40>EGFP:T2A:Puro recovered from the gel was mixed with the T-PDL1-ICAM1 plasmid at a molar ratio of 1:4, T4 ligase and T4 ligase buffer were added, and the mixture was ligated at 4°C overnight to obtain a ligated plasmid;

[0017] S1.5, transform the obtained ligated plasmid into Escherichia coli, and then culture it at 37°C overnight; a plate transformed with pLV-hPDL1-hICAM1-EGFP can be obtained;

[0018] S1.6. Then, three single clones were randomly picked from the plate transformed with pLV-hPDL1-hICAM1-EGFP, and added into 10 mL LB medium containing ampicillin respectively. After 12 hours of amplification and culture, the plasmids were extracted and digested with XbaI and EcoRI for identification. The plasmids with correct digestion were sequenced for further verification. The lentiviral plasmid expressing pLV-hPDL1-hICAM1-EGFP was obtained if the sequencing was correct.

[0019] Furthermore, in S3, the mesenchymal stem cells are human mesenchymal stem cells, including tissue-derived mesenchymal stem cells and induced pluripotent stem cell-derived mesenchymal stem cells. Tissue-derived mesenchymal stem cells include umbilical cord mesenchymal stem cells, placental mesenchymal stem cells, bone marrow mesenchymal stem cells and adipose mesenchymal stem cells; pluripotent stem cells include human embryonic stem cells and induced pluripotent stem cells.

[0020] Furthermore, in S3, the concentration of puromycin is 0.8-1 μg / ml.

[0021] Another object of the present invention is to provide an application of gene-modified mesenchymal stem cells, characterized in that the gene-modified mesenchymal stem cells are used in autoimmune diseases.

[0022] Furthermore, the gene-modified mesenchymal stem cells are made into stem cell preparations, which are then injected intravenously into a patient suffering from an autoimmune disease for treatment.

[0023] The beneficial effects of the present invention are:

[0024] The mesenchymal stem cells provided by the present invention are engineered and modified with PD-L1 and ICAM1, and are screened with puromycin to obtain a mesenchymal stem cell strain that stably overexpresses the PD-L1 and ICAM1 genes; after the mesenchymal stem cell strain overexpressing the PD-L1 and ICAM1 genes is injected into the tail vein of an autoimmune hepatitis animal model, the symptoms of autoimmune hepatitis can be significantly alleviated, the degree of liver damage can be reduced, the expression of inflammatory factors can be regulated, and the inflammatory response can be inhibited, and the therapeutic effect is significant. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0026] Figure 1 This is a map of the pLV-PDL1-ICAM1-EGFP lentiviral vector in Example 1 of the present invention;

[0027] Figure 2 The efficiency of pLV-PDL1-ICAM1-EGFP transfection into human umbilical cord mesenchymal stem cells was detected by GFP labeling in Example 2 of the present invention;

[0028] Figure 3 The RT-PCR method in Example 2 of the present invention is used to detect the expression of PD-L1 and ICAM1 genes;

[0029] Figure 4 The flow cytometry method for verifying the transfection of PD-L1 and ICAM1 into human umbilical cord mesenchymal stem cells in Example 2 of the present invention is as follows;

[0030] Figure 5 The results of ALT and AST detection in the blood of mice in Example 3 of the present invention;

[0031] Figure 6 This is the HE staining result of mouse liver in Example 3 of the present invention;

[0032] Figure 7 The results of the detection of inflammatory cytokines in mouse plasma in Example 3 of the present invention;

[0033] Figure 8 The results of ALT and AST detection in the blood of mice in Example 4 of the present invention;

[0034] Fig. 9 This is the HE staining result of mouse liver in Example 4 of the present invention. DETAILED DESCRIPTION

[0035] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] Example 1

[0037] The construction of human umbilical cord mesenchymal stem cell line MSCs-PDL1-ICAM1 overexpressing PD-L1 and ICAM1 genes comprises the following steps:

[0038] The nucleotide sequences of PD-L1 and ICAM1 genes are shown in the sequence listing.

[0039] PD-L1 Gene: 873bp

[0040]

[0041]

[0042] ICAM1 Gene: 1599 bp

[0043]

[0044]

[0045] Step 1: Design and amplification of PCR primers for PD-L1 and ICAM1 genes

[0046] The human PD-L1 and ICAM1 gene sequences were found in NCBI, and the nucleotide sequence and amino acid sequence information are shown in the sequence table. PD-L1 and ICAM1 primers were designed using Primer5.0 software.

[0047] Primer name Primer sequence (5' to 3') PD-L1-F GCCACCATGGTGAGCAAGGG PD-L1-R CGAAAGGCCCGGAGATGAGGA ICAM1-F ATGGCTCCCAGCAGCCCCCG ICAM1-R TCAGGGAGGCGTGGCTTGTG

[0048] Human umbilical cord mesenchymal stem cell cDNA was used as a template and the above-designed primers were used to perform PCR amplification of human PD-L1 and ICAM1 genes.

[0049] Step 2: Lentiviral packaging of pLV-hPDL1-hICAM1-EGFP plasmid

[0050] The human PD-L1 and ICAM1 sequences were constructed into the lentiviral vector pLV-EF1A-SV40>EGFP:T2A:Puro to obtain the lentiviral plasmid expressing pLV-hPDL1-hICAM1-EGFP.

[0051] Construction method: The above PCR products were connected to the T vector for sequencing, and the plasmid with correct sequencing was named T-PDL1-ICAM1. The lentiviral vector plasmid and T-PDL1-ICAM1 plasmid were double-digested with XbaI and EcoRI, and then the target band was recovered by gel recovery kit. The gel-recovered lentiviral vector pLV-EF1A-SV40>EGFP:T2A:Puro was mixed with T-PDL1-ICAM1 at a molar ratio of 1:4, T4 ligase and T4 ligase buffer were added, and the ligation was carried out at 4°C overnight. The ligated plasmid was transformed into Escherichia coli and then placed at 37°C for overnight culture. Three single clones were randomly selected from the plate transformed with pLV-hPDL1-hICAM1-EGFP, and added to 10mL LB medium containing ampicillin. After 12 hours of amplification and culture, the plasmid was extracted and digested with XbaI and EcoRI for identification. The plasmid with correct digestion was further verified by sequencing. The plasmid with correct sequencing is pLV-hPDL1-hICAM1-EGFP expression plasmid. The expression plasmid map is as follows: Figure 1 It needs to be further packaged into lentivirus.

[0052] Step 3: Infect human umbilical cord mesenchymal stem cells with lentivirus expressing PD-L1 and ICAM1. After lentivirus infection is completed, human umbilical cord mesenchymal stem cell lines that stably express PD-L1 and ICAM1 genes are selected by puromycin.

[0053] Step 4: The human umbilical cord mesenchymal stem cell lines that stably express PD-L1 and ICAM1 genes after screening are cultured on a large scale in vitro. After culture to P5, the cells are digested by adding an appropriate amount of trypsin for digestion, and finally washed three times with PBS for cell identification.

[0054] Example 2

[0055] The identification of PD-L1 and ICAM1 gene expression in engineered human umbilical cord mesenchymal stem cell lines includes the following steps:

[0056] 1. Observation of the efficiency of human umbilical cord mesenchymal stem cell transfection by lentivirus pLV-hPDL1-hICAM1-EGFP under a fluorescence microscope: 24 hours after human umbilical cord mesenchymal stem cells were transfected with lentivirus pLV-hPDL1-hICAM1-EGFP, the original culture medium was replaced with fresh complete culture medium, and the culture was continued. After 48 hours, the results were observed under a fluorescence inverted microscope. Figure 2 As shown, the transfection efficiency of PD-L1 and ICAM1 was found to be greater than 90%.

[0057] 2. Analysis of PD-L1 and ICAM1 gene expression by RT-PCR

[0058] The RNA of human umbilical cord mesenchymal stem cells transfected with pLV-hPDL1-hICAM1-EGFP was extracted by Trizol method and reverse transcribed into cDNA. At the same time, the RNA of human umbilical cord mesenchymal stem cells transfected with pLV-EF1A-SV40>EGFP:T2A:Puro empty vector was extracted and reverse transcribed into cDNA for experimental control. Primers were designed to amplify PD-L1 and ICAM1 gene fragments using these two cDNAs as templates, and the internal reference gene GAPDH was used. The primer information is shown in the table below.

[0059]

[0060]

[0061] RT-PCR results Figure 3 As shown, PCR amplification was performed using the cDNA of human umbilical cord mesenchymal stem cells transfected with the pLV-hPDL1-hICAM1-EGFP virus on the third day as a template, and gene fragments of PD-L1 and ICAM1 were detected, while no gene fragments of PD-L1 and ICAM1 appeared in human umbilical cord mesenchymal stem cells transfected with an empty vector, indicating that the PD-L1 and ICAM1 genes have been successfully inserted into the human umbilical cord mesenchymal stem cell genome and expressed.

[0062] 3. Flow cytometry to verify whether PD-L1 and ICAM1 are successfully transfected

[0063] PD-L1 and ICAM1 antibodies were added to the human umbilical cord mesenchymal stem cells transfected with PD-L1 and ICAM1 and transfected with empty vector for detection. The results of flow cytometry showed that PD-L1 and ICAM1 were successfully transfected into human umbilical cord mesenchymal stem cells ( Figure 4 ).

[0064] Example 3

[0065] This embodiment provides an engineered MSCs-PDL1-ICAM1 for use in mice with concanavalin-induced acute autoimmune hepatitis.

[0066] 1. MSCs-PDL1-ICAM1 treatment of acute autoimmune hepatitis model mice:

[0067] (1) Preparation of concanavalin A: Dissolve 5 mg of Con A powder in 2.5 mL of PBS solution and shake to make Con A working solution (2 mg / mL).

[0068] (2) Modeling was performed by intravenous injection, with an injection volume of 200 μL / mouse;

[0069] (3) 30 min after modeling, the control group was injected with 200 μL sterile PBS through the tail vein, and the MSCs group and MSCs-PDL1-ICAM1 group were injected with 5 × 106 cells / mouse through the tail vein. 48 h after injection, the animals were killed, and blood and liver were collected for liver function, cytokines, lymphocyte subsets and pathological tests;

[0070] 2. Detection of related indicators after MSCs were applied to acute autoimmune hepatitis model mice:

[0071] (1) Liver function test: After the blood was collected from the eyeball of the experimental mouse, it was immediately placed in the prepared dry EP tube. After standing for 15 minutes, it was centrifuged at 3000 rpm for 15 minutes. After standing, the supernatant was taken as plasma. After labeling, the plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were detected using an automatic biochemical analyzer. The results are as follows: Figure 5 As shown, compared with the MSCs group, the MSCs-PDL1-ICAM1 group had lower plasma ALT and AST levels and had a better therapeutic effect.

[0072] (2) Liver pathology detection: After the mouse liver tissue was fixed with 4% PFA for 24 hours, it was dehydrated with regular increasing ethanol and immersed in xylene solution until it became transparent. The liver tissue was embedded in paraffin and sliced ​​with a paraffin slicer. After dewaxing and dehydration, it was stained with hematoxylin and eosin. Neutral gum was added to the slices, and the excess droplets were wiped off and allowed to air dry before microscopic examination. The results are as follows Figure 6As shown in the figure, compared with the control group, the liver cells of mice in the PBS group were swollen, the hepatic cords were arranged in disorder, a large number of mononuclear cells infiltrated and multiple flaky necrosis areas were observed. The MSCs group was slightly relieved compared with the PBS group, but cell swelling, necrosis and flaky light-stained areas were still observed; however, the hepatic cells in the MSCs-PDL1-ICAM1 group were still swollen, and the hepatic cord structure was not clear, but it was significantly better than the PBS group, and no flaky necrosis areas of hepatic cells were observed.

[0073] (3) Cytokine detection:

[0074] Mouse whole blood was centrifuged at 1000 g for 10 min, and the supernatant was taken as plasma, which was stored in a -80°C refrigerator for later use. IL-6, TNF-α and IFN-γ inflammatory factors were detected, and the kit was purchased from Abcam. The specific steps are as follows:

[0075] 1) According to the instructions, weigh 1.0 mL of standard / specimen diluent, add it to the lyophilized standard, wait for it to dissolve at room temperature, let it stand for about 15 minutes, mix well, and then dilute the concentration to 2000 pg / ml, 1000 pg / ml, 500 pg / ml, 250 pg / ml, 125 pg / ml, 62.5 pg / ml, 31.25 pg / ml, and 0 pg / ml;

[0076] 2) Dilute the concentrated enzyme-bound substance to a concentration of 1:100 using biotinylated antibody diluent;

[0077] 3) dilute the concentrated enzyme conjugate to 1:100 using enzyme conjugate diluent;

[0078] 4) The serum of each group of mice was diluted 1:2 and centrifuged to remove suspended matter;

[0079] 5) Take out the strips from the balanced sealed bag, put different concentrations of standard samples and diluted mouse plasma from each group into the corresponding wells, seal the reaction wells with sealing tape, and incubate at 37°C for 90 minutes;

[0080] 6) Repeat the wells for samples and blanks, and then wash the plate 4 times. Shake off the liquid in the wells as much as possible, add 350μL of washing solution to each well, let it stand for about 30 seconds, shake off the liquid again, and pat dry on filter paper;

[0081] 7) Leave a blank well and add 100 μL of biotinylated antibody working solution to each of the remaining wells, seal the reaction wells, and incubate at 37°C for 1 h;

[0082] 8) Wash the plate 4 times, leaving blank wells, add 100 μL of enzyme conjugate working solution to each well, seal the reaction wells, and incubate at 37°C for 30 min;

[0083] 9) Wash the plate 4 times, add 100 μL of color developer to each well, incubate at 37°C for 15 min, add 100 μL of stop solution to each well, and mix well;

[0084] 10) Measure and record the OD450 value, and draw a standard curve manually, with the concentration of the standard as the horizontal axis and the OD value as the vertical axis. Use a smooth line to connect the coordinate points of each standard. The concentration of the specimen can be found on the standard curve through its OD value.

[0085] The results are as follows Figure 7 As shown, compared with the MSCs group, the MSCs-PDL1-ICAM1 group had lower levels of IL-6, TNF-α and IFN-γ inflammatory factors in plasma and had better therapeutic effect.

[0086] Example 4

[0087] This example provides an application of engineered MSCs-PDL1-ICAM1 in the treatment of chronic autoimmune hepatitis mice induced by liver antigens:

[0088] 1. Establishment of an autoimmune hepatitis mouse model induced by liver antigen (S-100)

[0089] (1) Preparation of S-100: 10 C57BL / 6 mice aged 4-6 weeks were anesthetized by intraperitoneal injection of 0.2 mL of 2% pentobarbital. After the mice were fully anesthetized, they were immersed in 75 mL / L ethanol for disinfection for 5 min. After disinfection, the mice were placed on a dissecting board, skinned, and the sternum was cut off to expose the beating heart and liver in the abdominal cavity. Pre-cooled PBS buffer was perfused through the ventricular cavity (punctured into the apex of the heart) until the color of the liver changed from dark red to grayish white. The grayish white liver was separated and removed, and the It was cut into small pieces, and the residual blood was washed with 4°C citrate-PBS solution, and then an equal amount of citrate-PBS solution was added to the homogenizer for homogenization, and then placed in a centrifuge tube; the homogenate was repeatedly frozen and thawed 3 times at -80°C to achieve the purpose of cell disruption; centrifuged at 2000rpm for 10min, and the supernatant was ultracentrifuged at 100000g for 1h to finally obtain the supernatant (called S-100), and the S-100 concentration was adjusted to make its final concentration 0.5-2mg / mL.

[0090] (2) Model establishment: S-100 liver antigen or saline was mixed with complete Freund's adjuvant (CFA) at a ratio of 1:1 to prepare reagent 1 and reagent 2, respectively; two groups of mice were intraperitoneally injected with reagent 1 (S-100 antigen + CFA) or reagent 2 (saline + CFA) 1 mL / mouse, respectively. The group injected with reagent 1 was called the AIH model group, and the group injected with reagent 2 was called the control group. The same dose was injected on the 7th day after the first immunization. After the 4th week, blood and liver tissue were collected to detect the levels of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and other liver function indicators; HE, Masson and Sirius red methods were used to observe the pathological changes of liver disease, and the changes in lymphocyte subsets were detected in peripheral blood.

[0091] 2. Evaluation of the effect of MSCs-PDL1-ICAM1 on S-100-induced autoimmune hepatitis

[0092] (1) Eighty C57BL / 6 mice were randomly divided into four groups, with 20 mice in each group: control group, AIH model group, treatment group 1: MSCs, and treatment group 2: MSCs-PDL1-ICAM1;

[0093] (2) After the AIH model was successfully established, MSCs were infused once on days 0, 7, 14, and 21 by tail vein injection. During the infusion period, the control group and the AIH model group were infused with the same volume of PBS. The number of MSCs injected into the tail vein of the MSCs group was 1×106 / kg each time;

[0094] (3) After the MSCs treatment cycle, the animals were observed for another 8 weeks and finally killed to observe relevant indicators.

[0095] (4) Liver function test: The specific operation steps are the same as Example 2. The results are as follows Figure 8 As shown, compared with the MSCs group, the MSCs-PDL1-ICAM1 group had lower plasma ALT and AST levels and had a better therapeutic effect.

[0096] (5) Liver pathology detection: The specific operation steps are consistent with Example 4. The results are as follows Fig. 9 As shown in the figure, the mice with successful modeling showed destruction of liver lobule structure, disordered cell morphology and structure, infiltration of a large number of inflammatory cells, and a large amount of fibrosis. After MSCs treatment, the above symptoms were alleviated, but compared with the MSCs group, the MSCs-PDL1-ICAM1 group had a better therapeutic effect.

Claims

1. A method for constructing genetically modified mesenchymal stem cells, characterized in that: It consists of the following steps: S1, construction of lentiviral plasmids that highly express PD-L1 and ICAM1 genes; S2, co-transfecting the high-expression lentiviral plasmid carrying PD-L1 and ICAM1 genes with the envelope plasmid and the packaging plasmid into 293T cells, packaging the virus, and collecting the viral supernatant; S3. The collected viral supernatant was used to transfect mesenchymal stem cells, and then selected by puromycin to obtain a stable engineered mesenchymal stem cell line with high expression of PD-L1 and ICAM1.

2. The method for constructing genetically modified mesenchymal stem cells according to claim 1, characterized in that: In S1, the construction of a lentiviral plasmid that highly expresses PD-L1 and ICAM1 genes specifically includes the following steps: S1.

1. The human PD-L1 and ICAM1 gene sequences were found in NCBI, and PD-L1 and ICAM1 primers were designed using Primer5.0 software to perform PCR amplification of human PD-L1 and ICAM1 genes; S1.2, connect the above PCR products to the T vector for sequencing, and the plasmid with the correct sequencing result is named T-PDL1-ICAM1; S1.3, double-digest the lentiviral vector plasmids pLV-EF1A-SV40>EGFP:T2A:Puro and T-PDL1-ICAM1 plasmids with XbaI and EcoRI, and then recover the target bands with a gel recovery kit; S1.4, the lentiviral vector plasmid pLV-EF1A-SV40>EGFP:T2A:Puro recovered from the gel was mixed with the T-PDL1-ICAM1 plasmid at a molar ratio of 1:4, T4 ligase and T4 ligase buffer were added, and the mixture was ligated at 4°C overnight to obtain a ligated plasmid; S1.5, transform the obtained ligated plasmid into Escherichia coli, and then culture it at 37°C overnight; a plate transformed with pLV-hPDL1-hICAM1-EGFP can be obtained; S1.

6. Then, three single clones were randomly picked from the plate transformed with pLV-hPDL1-hICAM1-EGFP, and added into 10 mL LB medium containing ampicillin respectively. After 12 hours of amplification and culture, the plasmids were extracted and digested with XbaI and EcoRI for identification. The plasmids with correct digestion were sequenced for further verification. The lentiviral plasmid expressing pLV-hPDL1-hICAM1-EGFP was obtained if the sequencing was correct.

3. The method for constructing genetically modified mesenchymal stem cells according to claim 1, characterized in that: In S3, the mesenchymal stem cells are human mesenchymal stem cells, including tissue-derived mesenchymal stem cells and induced pluripotent stem cell-derived mesenchymal stem cells. Tissue-derived mesenchymal stem cells include umbilical cord mesenchymal stem cells, placental mesenchymal stem cells, bone marrow mesenchymal stem cells and adipose mesenchymal stem cells; pluripotent stem cells include human embryonic stem cells and induced pluripotent stem cells.

4. The method for constructing genetically modified mesenchymal stem cells according to claim 1, characterized in that: In S3, the concentration of puromycin is 0.8-1 μg / ml.

5. An application of gene-modified mesenchymal stem cells, characterized in that: Application of the gene-modified mesenchymal stem cells in autoimmune diseases.

6. The use of a genetically modified mesenchymal stem cell according to claim 5, characterized in that: Specifically, gene-modified mesenchymal stem cells are made into stem cell preparations, which are then injected intravenously into a patient suffering from an autoimmune disease for treatment.

Images