A five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting five parasites and its dedicated primers and probes

Abstract

The invention discloses a five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting five parasites and its special primers and probes, belonging to the field of biological detection technology. The kit provided by the invention can be used to simultaneously detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciolae and Echinococcus granulosus in the same system, and has the characteristics of qualitative and quantitative detection, high sensitivity, strong specificity, good repeatability and good stability.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and specifically relates to a five-fold real-time fluorescence quantitative PCR detection kit and a detection method for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, and more particularly to a five-fold probe method real-time fluorescence quantitative PCR detection kit, a detection method and a special detection primer and probe combination for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus in the same system. Background Art

[0002] Cryptosporidium parvum, Strongyloidesstercoralis, Trypanosoma cruzi, Theileria ovis, and Echinococcus granulosus are ubiquitous parasitic pathogens worldwide, with sheep, cattle, pigs, and rabbits considered intermediate hosts. Cryptosporidium parvum is an intestinal protozoan that can cause human disease, with clinical outcomes ranging from moderate to severe diarrhea and associated developmental delays and gastrointestinal diseases. It is also the most common infectious cause of AIDS cholangiopathy. Strongyloides stercoralis larvae can cause disease when they invade the human body through the skin or mucous membranes, or they can infect the host when the host ingests its eggs. Strongyloides disease lacks characteristic manifestations, and its clinical symptoms are related to the host's immune response and the degree of infection. Immunodeficient patients with underlying diseases or long-term glucocorticoid treatment are more likely to develop severe disease. High-throughput sequencing of patients' bronchoalveolar lavage fluid showed the presence of Strongyloides stercoralis. Trypanosoma cruzi infection is a complex zoonosis, transmitted by more than 130 species of triatomine bugs and maintained by more than 70 genera of mammalian hosts. Infection in humans can cause Chagas disease, which has serious consequences for public health and the national economy. Theileria is a blood protozoan transmitted by ticks. Infection can cause jaundice, tachycardia, fatigue, fever, decreased milk production, and miscarriage / stillbirth. Echinococcosis, also known as hydatid disease, is caused by the larvae of the tapeworm Echinococcus. Humans or animals are infected by ingesting water or food contaminated with eggs. Echinococcus granulosus can cause cystic echinococcosis, a zoonosis parasitic infection that poses a major public health risk.

[0003] Mixed infections with Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus are a major problem for sheep, cattle, pigs and rabbits, resulting in reduced welfare of the infected hosts and huge economic losses. Effective management and control of parasitic infections depends on early detection.

[0004] Oocysts, parasites and eggs of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus can be detected by microscopic examination, but this method has problems such as being harmful to the operator and the environment or having low sensitivity or being easily missed. Detection of parasite-specific antibodies in immunological methods is the main diagnostic tool, but this method is complicated to operate or has problems in specificity and sensitivity. In addition, for immunosuppressed individuals, serological tests may result in false negative or false positive results due to their immune status or reactivation of Chagas disease. In medical biology, molecular diagnosis based on unculturable internal parasites is an accurate method because of its sensitivity and specificity, and DNA is an unforgeable identity carrier. A common nucleic acid-based detection method is PCR, which has become the gold standard for parasite monitoring due to its high sensitivity and the availability of commercial kits. However, traditional agarose gel electrophoresis and screening of PCR amplification products are time-consuming, labor-intensive, cumbersome and labor-intensive. In addition, the traditional PCR method is prone to contamination due to the open tube mouth and is susceptible to inhibitors that may be present in sheep, cattle, pigs and rabbit specimens.

[0005] TaqMan probe-based real-time fluorescence quantitative PCR is a promising tool for detecting target genomes of infectious pathogens in different specimens (blood, tissue, fluid, feces) based on the continuous measurement of the accumulation of fluorescent signals during the amplification reaction. It has been used to detect many parasites, including Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp., and Echinococcus granulosus. For example, methods or kits for detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp., and Echinococcus granulosus by single-plex real-time fluorescence quantitative PCR based on TaqMan probes have been reported (Maksimov P, Bergmann H, Wassermann M, Romig T, Gottstein B, Casulli A, et al. (2020). Species detection within the Echinococcus granulosus sensu lato complex by novel probe-based real-time PCRs. Pathogens. 9 (10): 791. doi: 10.3390 / pathogens9100791).

[0006] However, the conventional single-plex real-time fluorescence quantitative PCR method based on TaqMan probes is time-consuming and expensive to detect multiple parasites in the same sample. Although the multiplex real-time fluorescence quantitative PCR method based on TaqMan probes is expected to detect multiple target genes simultaneously through a single reaction, there are currently no five-plex TaqMan probe real-time fluorescence quantitative PCR detection methods and related detection products that can simultaneously detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciolae and Echinococcus granulosus in the same detection system. Summary of the invention

[0007] In view of one or more problems existing in the prior art, the present invention analyzes the published gene structure sequences of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus reference strains, designs specific primers and probes respectively, and performs system optimization and verification, and finally establishes a novel TaqMan probe five-fold real-time fluorescence quantitative PCR detection method that can simultaneously detect the above five parasites in a closed test tube (i.e., in the same reaction system). The method has high sensitivity and specificity, and has no cross-reaction with other parasite genomes. In addition, the method can also accurately identify Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus in different matrices. Therefore, this method can be applied to diagnosis, monitoring and epidemiology, and thus also provides a novel TaqMan probe five-fold real-time fluorescence quantitative PCR detection kit for the above five parasites and its special primers and probe sets. The present invention is mainly implemented by the following technical solutions.

[0008] In a first aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination, which is used to simultaneously detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus in the same system, wherein the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination comprises:

[0009] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Cryptosporidium parvum, comprising: a forward primer GZQCpgp60-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQCpgp60-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQCpgp60-P having a nucleotide sequence as shown in SEQ ID NO: 3;

[0010] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Strongyloides stercoralis, comprising: a forward primer GZQSsCOX1-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQSsCOX1-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQSsCOX1-P having a nucleotide sequence as shown in SEQ ID NO:6;

[0011] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Trypanosoma cruzi, comprising: a forward primer GZQTcSAT-F with a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer GZQTcSAT-R with a nucleotide sequence as shown in SEQ ID NO:8, and a TaqMan probe GZQTcSAT-P with a nucleotide sequence as shown in SEQ ID NO:9;

[0012] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Theileria, comprising: a forward primer GZQToSSUrRNA-F whose nucleotide sequence is shown in SEQ ID NO: 10, a reverse primer GZQToSSUrRNA-R whose nucleotide sequence is shown in SEQ ID NO: 11, and a TaqMan probe GZQToSSUrRNA-P whose nucleotide sequence is shown in SEQ ID NO: 12;

[0013] Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Echinococcus granulosus, comprising: a forward primer GZQEgND1-F having a nucleotide sequence as shown in SEQ ID NO: 13, a reverse primer GZQEgND1-R having a nucleotide sequence as shown in SEQ ID NO: 14, and a TaqMan probe GZQEgND1-P having a nucleotide sequence as shown in SEQ ID NO: 15;

[0014] The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at its 5' end and a fluorescent quenching group labeled at its 3' end.

[0015] In some embodiments, the 5′ end of the TaqMan probe GZQCpgp60-P is labeled with a FAM fluorescent emission group, and the 3′ end is labeled with an MGB-NFQ fluorescent quenching group; the 5′ end of the TaqMan probe GZQSsCOX1-P is labeled with a VIC fluorescent emission group, and the 3′ end is labeled with an MGB-NFQ fluorescent quenching group; the 5′ end of the TaqMan probe GZQTcSAT-P is labeled with an ABY fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQToSSUrRNA-P is labeled with a JUN fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; the 5′ end of the TaqMan probe GZQEgND1-P is labeled with a CY5 fluorescent emission group, and the 3′ end is labeled with an MGB-NFQ fluorescent quenching group.

[0016] In a second aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, which comprises the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided in the first aspect of the present invention.

[0017] In some embodiments, the kit also includes a positive control, wherein the positive control includes a recombinant plasmid containing the gp60 gene of Cryptosporidium parvum (pCpgp60), a recombinant plasmid containing the COX1 gene of Strongyloides stercoralis (pSsCOX1), a recombinant plasmid containing the SAT gene of Trypanosoma cruzi (pTcSAT), a recombinant plasmid containing the SSU rRNA gene of Theileria fasciola (pToSSUrRNA), and a recombinant plasmid containing the ND1 gene of Echinococcus granulosus (pEgND1).

[0018] In some embodiments, the kit also includes a negative control, wherein the negative control includes a system that does not contain the gp60 gene of Cryptosporidium parvum, the COX1 gene of Strongyloides stercoralis, the SAT gene of Trypanosoma cruzi, the SSU rRNA gene of Theileria fasciola and the ND1 gene of Echinococcus granulosus, and can further be selected as nuclease-free water.

[0019] In the third aspect, the present invention provides the use of the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination provided in the first aspect of the present invention or the quintuple real-time fluorescence quantitative PCR detection kit provided in the second aspect of the present invention for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus in the same system.

[0020] In a fourth aspect, the present invention provides a five-fold real-time fluorescence quantitative PCR detection method for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, which comprises using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention or the five-fold real-time fluorescence quantitative PCR detection kit provided by the second aspect of the present invention to perform five-fold real-time fluorescence quantitative PCR amplification on genomic DNA extracted from the sample to be tested, and collecting fluorescence signals to perform qualitative detection of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, and / or to perform quantitative detection of parasite nucleic acids determined to be contained.

[0021] In some embodiments, the method comprises the following steps:

[0022] 1) Establishing a standard curve: using positive controls of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus to prepare plasmid standards of gradient concentrations (each plasmid standard contains positive controls of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus at equal concentrations); using plasmid standards of different concentrations as templates, using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention to perform five-fold real-time fluorescence quantitative PCR detection, after the detection, plotting the concentration Log10 value (X-axis) of each plasmid standard against its corresponding Ct value (Y-axis) to obtain a standard curve;

[0023] 2) extracting genomic nucleic acid from the sample to be tested, using the extracted genomic nucleic acid as a template, and performing quintuple real-time fluorescent quantitative PCR detection using the quintuple real-time fluorescent quantitative PCR primer and TaqMan probe combination provided by the first aspect of the present invention;

[0024] 3) using the specific amplification curve and the obtained Ct value to qualitatively detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, and / or quantitatively detecting the parasite nucleic acid determined to be contained according to the standard curve obtained in step 1).

[0025] In some embodiments, the reaction system for quintuple real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: GZQCpgp60-F, GZQCpgp60-R, GZQSsCOX1-F, GZQSsCOX1-R, GZQTcSAT-F, GZQTcSAT-R, GZQToSSUrRNA-F and GZQToSSUrRNA-R with a final concentration of 200-300 nM, GZQEgND1-F and GZQEgND1-R with a final concentration of 400-500 nM, GZQCpgp60-P, GZQSsCOX1-P, GZQTcSAT-P and GZQToSSUrRNA-P with a final concentration of 50-100 nM, and GZQEgND1-P with a final concentration of 100-200 nM.

[0026] In some embodiments, the reaction procedure for quintuple real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: 50°C for 2 min, 1 cycle; 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles.

[0027] In some embodiments, the judgment criteria of the qualitative detection are:

[0028] In the channel corresponding to the fluorescent emission group (e.g., FAM) labeled at the 5′ end of GZQCpgp60-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Cryptosporidium parvum nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Cryptosporidium parvum nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Cryptosporidium parvum nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged to be positive, otherwise it is judged to be negative;

[0029] In the channel corresponding to the fluorescent emission group (such as VIC) labeled at the 5′ end of GZQSsCOX1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Strongyloides stercoralis nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Strongyloides stercoralis nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Strongyloides stercoralis nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the re-examination Ct value is <38, it is judged to be positive, otherwise it is judged to be negative;

[0030] In the channel corresponding to the fluorescent emission group (e.g., ABY) labeled at the 5′ end of GZQTcSAT-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Trypanosoma cruzi nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Trypanosoma cruzi nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Trypanosoma cruzi nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0031] In the channel corresponding to the fluorescent emission group (e.g., JUN) labeled at the 5′ end of GZQToSSUrRNA-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Theileria nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Theileria nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Theileria nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-inspection. If the re-inspection Ct value is <38, it is judged to be positive, otherwise it is judged to be negative;

[0032] In the channel corresponding to the fluorescent emission group (e.g., CY5) labeled at the 5′ end of GZQEgND1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged to be positive for Echinococcus granulosus nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged to be negative for Echinococcus granulosus nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged to be suspicious for Echinococcus granulosus nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the re-examination Ct value is <38, it is judged to be positive, otherwise it is judged to be negative.

[0033] In some embodiments, the detection limits of the method for Cryptosporidium parvum, Strongyloides stercoralis, and Echinococcus granulosus are 1.7 copies / μL, 1.2 copies / μL, 1.5 copies / μL, 1.4 copies / μL, and 1.4 copies / μL, respectively.

[0034] Compared with the prior art, the present invention has the following characteristics:

[0035] 1. The present invention targets the current main domestic and foreign epidemic strains of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciolae and Echinococcus granulosus, respectively, and selects gp60 gene, COX1 gene, SAT gene, SSU rRNA gene and ND1 gene as target detection genes. After multiple gene sequences are compared, the segments with very low gene homology and more mutation sites are eliminated, and finally the highly conserved regions in the gp60 gene, COX1 gene, SAT gene, SSU rRNA gene and ND1 gene sequences are selected to design primers and probes. However, since the purpose of the present invention is to simultaneously detect the above-mentioned 5 parasite target detection genes in the same detection system (i.e., using 5 fluorescent channels), if the detection system for each target detection gene is not compatible, the Ct value gap of the detection is too large, and / or interference occurs between each primer and probe, it will lead to fluorescence inhibition, thereby affecting the detection rate during the detection process. In view of this, the inventors, through creative efforts, further designed and determined primer and probe sets with similar amplification efficiencies for detecting the above-mentioned five parasite nucleic acids in the shorter highly conserved sequences of the above-mentioned five target detection genes, and at the same time, by adjusting the ratio of primers to fluorescent probes in the detection system during the PCR amplification process, the amplification efficiency for different parasite nucleic acids was further kept consistent.

[0036] 2. When Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus co-infection occur, it is time-consuming, labor-intensive and costly to determine whether there is a co-infection of multiple parasites by single-plex fluorescence PCR alone. The present invention provides a method and a kit for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus in the same detection system. The method uses specific probes respectively targeting the gp60 gene of Cryptosporidium parvum, the COX1 gene of Strongyloides stercoralis, the SAT gene of Trypanosoma cruzi, the SSU rRNA gene of Theileria spp. and the ND1 gene of Echinococcus granulosus, and respectively labeled with fluorescent emission groups, so that it can detect and determine whether there is a co-infection of multiple parasites at one time, which saves time and labor, and can significantly reduce the detection cost.

[0037] 3. The method and kit provided by the present invention have strong specificity. There is no non-specific amplification curve for related parasites such as the four-winged thornless nematode, the hidden tubular nematode, the mouse tubular nematode and the colonic ciliate, which can ensure the accuracy of detection.

[0038] 4. The present invention provides a method and kit for rapid detection of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, which are qualitative, quantitative, highly sensitive (the detection limits of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus are 1.7 copies / μL, 1.2 copies / μL, 1.5 copies / μL, 1.4 copies / μL and 1.4 copies / μL, respectively), highly specific, reproducible and stable (the coefficient of variation (CV value) of intra-batch and inter-batch reproducibility tests are both less than 3%). BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0040] Figure 1 The present invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Cryptosporidium parvum.

[0041] Figure 2 The invention provides a standard curve for detecting Cryptosporidium parvum using the quintuple real-time fluorescence quantitative PCR detection method.

[0042] Figure 3 The present invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting Strongyloides stercoralis fluorescence amplification curve.

[0043] Figure 4 The present invention provides a standard curve for detecting Strongyloides stercoralis using the quintuple real-time fluorescence quantitative PCR detection method.

[0044] Figure 5 The invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Trypanosoma cruzi.

[0045] Figure 6 The invention provides a standard curve for detecting Trypanosoma cruzi using the quintuple real-time fluorescence quantitative PCR detection method.

[0046] Figure 7 The invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Theileria.

[0047] Figure 8 The standard curve for detecting Theileria by the quintuple real-time fluorescence quantitative PCR detection method provided by the present invention.

[0048] Fig. 9The present invention provides a five-fold real-time fluorescence quantitative PCR detection method for detecting the fluorescence amplification curve of Echinococcus granulosus.

[0049] Fig.10 The invention provides a standard curve for detecting Echinococcus granulosus using the five-fold real-time fluorescence quantitative PCR detection method.

[0050] Fig.11 This is a fluorescence amplification curve of a specificity test of the five-plex real-time fluorescence quantitative PCR detection method provided by the present invention. DETAILED DESCRIPTION

[0051] The invention designs and synthesizes specific primers and probes for the five target detection genes of Cryptosporidium parvum gp60 gene, Strongyloides stercoralis COX1 gene, Trypanosoma cruzi SAT gene, Theileria suturingii SSU rRNA gene and Echinococcus granulosus ND1 gene sequence, establishes a five-probe method real-time fluorescence quantitative PCR method that can simultaneously detect five kinds of parasites in the same system, and thus provides a convenient detection kit. The kit and the detection method can simultaneously detect the target detection genes of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria suturingii and Echinococcus granulosus, the primers and probes for different target detection genes do not interfere with each other, and have the characteristics of qualitative and quantitative detection, high sensitivity, strong specificity, good repeatability and good stability.

[0052] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. It should be noted that the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0053] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0054] All primers and probes used can be synthesized using existing techniques.

[0055] Example 1. Design and determination of primers and TaqMan probes for quintuple real-time fluorescence quantitative PCR for simultaneous detection of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola, and Echinococcus granulosus

[0056] The present invention targets the main epidemic strains of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus at home and abroad, respectively selects Cryptosporidium parvum gp60 gene, Strongyloides stercoralis COX1 gene, Trypanosoma cruzi SAT gene, Theileria spp. SSU rRNA gene and Echinococcus granulosus ND1 gene as target detection genes, and after multiple gene sequences are compared, segments with very low gene homology and many mutation sites are eliminated, and finally highly conserved regions in the gp60 gene, COX1 gene, SAT gene, SSU rRNA gene and ND1 gene sequences are selected to design primers and probes, and further make the amplification efficiency of nucleic acids for different parasites close, and no interference between the primers and probes will occur, and thus no fluorescence inhibition will occur, and finally determine the primer and probe combinations for detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, as shown below.

[0057] The primer-probe combination for detecting the gp60 gene of Cryptosporidium parvum includes:

[0058] Forward primer GZQCpgp60-F: 5′-AGGCGCAACTACCGAAACC-3′ (SEQ ID NO: 1);

[0059] Reverse primer GZQCpgp60-R: 5′-TTACAAATGAAGTGCCGCATTC-3′ (SEQ ID NO: 2);

[0060] TaqMan probe GZQCpgp60-P: 5'-(FAM)-TAGAAGCTACTCCAAAAGA-(MGB-NFQ)-3' (SEQ ID NO: 3).

[0061] The detection segment for the gp60 gene of Cryptosporidium parvum is:

[0062] AGGCGCAACTACCGAAACCATAGAAGCTACTCCAAAAGAAGAATGCGGCACTTCATTTGTAA (SEQ ID NO: 16).

[0063] The primer probe combination for detecting the COX1 gene of Strongyloides stercoralis includes:

[0064] Forward primer GZQSsCOX1-F: 5′-TTTGTTGATAATGGTTTGGGTACTAGTT-3′ (SEQ ID NO: 4);

[0065] Reverse primer GZQSsCOX1-R: 5'-CACTAGAACCAGGATGACCTGAAGTA-3' (SEQ ID NO: 5); TaqMan probe GZQSsCOX1-P:

[0066] 5'-(VIC)-AACAATTTATCCTCCTCTATC-(MGB-NFQ)-3' (SEQ ID NO: 6).

[0067] The detection segment for the COX1 gene of Strongyloides stercoralis is:

[0068] TTTGTTGATAATGGTTTGGGTACTAGTTGAACAATTTATCCTCCTCTATCTACTTCAGGTCATCCTGGTTCTAGTG (SEQ ID NO: 17).

[0069] The primer probe combination for detecting the SAT gene of Trypanosoma cruzi includes:

[0070] Forward primer GZQTcSAT-F: 5′-CGAGCGGCTGCTACATCA-3′ (SEQ ID NO: 7);

[0071] Reverse primer GZQTcSAT-R: 5′-TTGTTTGGTGTCCAGTGTGTGA-3′ (SEQ ID NO: 8);

[0072] TaqMan probe GZQTcSAT-P:

[0073] 5'-(ABY)-AGGCACTCTCTGTCACTATCTGTTTGCGTG-QSY-3' (SEQ ID NO: 9).

[0074] The detection segment for the SAT gene of Trypanosoma cruzi is:

[0075] CGAGCGGCTGCTACATCACACGTTGTGGTCTAAATTTTTGTTTCCAATTATGAATGGT GGGAGTCAGAGGCACTCTCTGTCACTATCTGTTTGCGTGTTCACACACTGGACACCAAA CAA (SEQ ID NO: 18).

[0076] The primer-probe combination for detecting the Theileria SSU rRNA gene includes:

[0077] Forward primer GZQToSSUrRNA-F: 5′-GAGTATCAATTGGAGGGCAAGTCT-3′ (SEQ ID NO: 10);

[0078] Reverse primer GZQToSSUrRNA-R: 5′-AACTACGAGCTTTTTAACTGCAACAA-3′ (SEQ ID NO: 11);

[0079] TaqMan probe GZQToSSU rRNA-P: 5'-(JUN)-CAGCAGCCGCGGTAATTCCAGC-(QSY)-3' (SEQ ID NO: 12).

[0080] The detection segment for the Theileria SSU rRNA gene is:

[0081] GAGTATCAATTGGAGGGCAAGTTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAA TAGCGTATATTAAAATTGTTGCAGTTAAAAAGCTCGTAGTT (SEQ ID NO: 19).

[0082] The primer-probe combination for detecting the ND1 gene of Echinococcus granulosus includes:

[0083] Forward primer GZQEgND1-F: 5′-CGGTTCGATGTGCTTTTGG-3′ (SEQ ID NO: 13);

[0084] Reverse primer GZQEgND1-R: 5′-AGCACAAAAAATCACCACACACATA-3′ (SEQ ID NO: 14);

[0085] TaqMan probe GZQEgND1-P: 5'-(CY5)-TCTGTTAGGTTTGAGGCTT-(MGB-NFQ)-3' (SEQ ID NO: 15).

[0086] The detection segment for the ND1 gene of Echinococcus granulosus is:

[0087] CGGTTCGATGTGCTTTTGGATCTGTTAGGTTTGAGGCTTGTTTTATGTGTGTGGTGAT TTTTTGTGCT (SEQ ID NO: 20).

[0088] Example 2: Five-plex real-time fluorescence quantitative PCR detection method

[0089] The method for simultaneously performing five-fold real-time fluorescence quantitative PCR detection of five parasites in a sample to be tested using the primer and probe combination designed in Example 1 in the same detection system specifically comprises the following steps:

[0090] 1. Extract the total DNA of the sample to be tested for later use;

[0091] 2. Prepare the reaction system: For example, a 20 μL reaction system may include: 10 μL TaqMan Mix (purchased from ThermoFisher Scientific), 3 μL primers and TaqMan probe Mix (GZQCpgp60-F concentration is 220 nM (final concentration, the same below), GZQCpgp60-R concentration is 220 nM, GZQCpgp60-P concentration is 60 nM, GZQSsCOX1-F concentration is 220 nM, GZQSsCOX1-R concentration is 220 nM, GZQSsCOX1-P concentration is 60 nM, GZQTcSAT-F concentration is 220 nM, GZQTcSAT-R concentration is 220 nM, GZQTcSAT-P concentration is 60 nM, GZQSSU rRNA-F concentration is 220 nM, GZQSSU rRNA-R concentration is 220 nM, GZQTcSAT-P concentration is 60 nM, GZQSSU rRNA-F concentration is 220 nM, GZQSSU rRNA-R concentration is 220 nM, GZQTcSAT-P concentration is 60 nM, GZQSSU rRNA-F concentration is 220 nM, GZQSSU rRNA- rRNA-R concentration is 220nM, GZQToSSU rRNA-P concentration is 60nM, GZQEgND1-F concentration is 440nM, GZQEgND1-R concentration is 440nM, GZQEgND1-P concentration is 120nM), 5μL template DNA and 2μL nuclease-free water.

[0092] 3. Amplification program: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles. Five fluorescence channels were used, namely: FAM fluorescence channel: the fluorescence emission group is "FAM" and the quenching group is "MGB-NFQ"; VIC fluorescence channel: the fluorescence emission group is "VIC" and the quenching group is "MGB-NFQ"; ABY fluorescence channel: the fluorescence emission group is "ABY" and the quenching group is "QSY"; JUN fluorescence channel: the fluorescence emission group is "JUN" and the quenching group is "QSY"; CY5 fluorescence channel: the fluorescence emission group is "CY5" and the quenching group is "MGB-NFQ".

[0093] 4. Result determination

[0094] The positive control has five channels with Ct values ​​less than 30 and a specific S-shaped fluorescence amplification curve, and the negative control has no Ct value and no specific fluorescence amplification curve. If both are true, the experimental results can be determined to be true. The test result judgment criteria are shown in Table 1.

[0095] Table 1: Test result judgment criteria

[0096]

[0097] In the FAM fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Cryptosporidium parvum nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Cryptosporidium parvum nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Cryptosporidium parvum nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0098] In the VIC fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Strongyloides stercoralis nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Strongyloides stercoralis nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Strongyloides stercoralis nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0099] In the ABY fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Trypanosoma cruzi nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Trypanosoma cruzi nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Trypanosoma cruzi nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0100] In the JUN fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged as positive for Theileria nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, it is judged as negative for Theileria nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged as suspicious for Theileria nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the Ct value is <38, it is judged as positive, otherwise it is judged as negative;

[0101] In the CY5 fluorescence channel, if the Ct value of the sample to be tested is ≤35 and a specific S-shaped fluorescence amplification curve appears, it is judged to be positive for Echinococcus granulosus nucleic acid; if there is no Ct value and no specific amplification curve, it is judged to be negative for Echinococcus granulosus nucleic acid; if 35<Ct value<38 and a specific fluorescence amplification curve appears, it is judged to be suspicious for Echinococcus granulosus nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-examination. If the Ct value is <38, it is judged to be positive, otherwise it is judged to be negative.

[0102] Example 3: Quintuple real-time fluorescence quantitative PCR detection kit

[0103] The present invention also provides a five-fold real-time fluorescence quantitative PCR detection kit for simultaneously identifying and detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus in the same detection system, which may include:

[0104] Example 1 The five-plex real-time fluorescence quantitative PCR primers and TaqMan probe designed and determined for simultaneous detection of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus are specifically:

[0105] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Cryptosporidium parvum include: a forward primer GZQCpgp60-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQCpgp60-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQCpgp60-P having a nucleotide sequence as shown in SEQ ID NO: 3;

[0106] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Strongyloides stercoralis include: a forward primer GZQSsCOX1-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQSsCOX1-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQSsCOX1-P having a nucleotide sequence as shown in SEQ ID NO:6;

[0107] The real-time fluorescence quantitative PCR primers and TaqMan probe for detecting Trypanosoma cruzi include: a forward primer GZQTcSAT-F whose nucleotide sequence is shown in SEQ ID NO:7, a reverse primer GZQTcSAT-R whose nucleotide sequence is shown in SEQ ID NO:8, and a TaqMan probe GZQTcSAT-P whose nucleotide sequence is shown in SEQ ID NO:9;

[0108] The real-time fluorescence quantitative PCR primers and TaqMan probe for detecting Theileria include: a forward primer GZQToSSUrRNA-F whose nucleotide sequence is shown in SEQ ID NO: 10, a reverse primer GZQToSSUrRNA-R whose nucleotide sequence is shown in SEQ ID NO: 11, and a TaqMan probe GZQToSSUrRNA-P whose nucleotide sequence is shown in SEQ ID NO: 12;

[0109] The real-time fluorescent quantitative PCR primers and TaqMan probe for detecting Echinococcus granulosus include: a forward primer GZQEgND1-F having a nucleotide sequence as shown in SEQ ID NO:13, a reverse primer GZQEgND1-R having a nucleotide sequence as shown in SEQ ID NO:14, and a TaqMan probe GZQEgND1-P having a nucleotide sequence as shown in SEQ ID NO:15.

[0110] The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at the 5' end and a fluorescent quenching group labeled at the 3' end. For example, the fluorescent emission group can be selected from the group consisting of FAM, VIC, ABY, JUN, and CY5, and the fluorescent quenching group can be selected from the group consisting of MGB-NFQ and QSY, and the fluorescent emission groups labeled at the 5' end of the TaqMan probe for different parasites are different.

[0111] Specifically, in the kit provided by the present invention, the 5′ end and 3′ end of each TaqMan probe can be labeled as follows: the 5′ end of the TaqMan probe GZQCpgp60-P is labeled with FAM, and the 3′ end is labeled with MGB-NFQ; the 5′ end of the TaqMan probe GZQSsCOX1-P is labeled with VIC, and the 3′ end is labeled with MGB-NFQ; the 5′ end of the TaqMan probe GZQTcSAT-P is labeled with ABY, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQToSSUrRNA-P is labeled with JUN, and the 3′ end is labeled with QSY; the 5′ end of the TaqMan probe GZQEgND1-P is labeled with CY5, and the 3′ end is labeled with MGB-NFQ. The reason why the present invention selects the five fluorescent emission groups of FAM, VIC, ABY, JUN, and CY5 is that experiments have shown that the relative emission spectra of the five fluorescent emission groups have a high degree of matching with the filters of different channels of the instrument, the overlapping spectra are small, and the intensities of the five fluorescent signals are comparable, so better performance can be obtained in a multiple experimental system.

[0112] For the convenience of detection, the kit also includes a positive control (as described in detail in Example 4 below), wherein the positive control includes a recombinant plasmid containing the gp60 gene of Cryptosporidium parvum (pCpgp60), a recombinant plasmid containing the COX1 gene of Strongyloides stercoralis (pSsCOX1), a recombinant plasmid containing the SAT gene of Trypanosoma cruzi (pTcSAT), a recombinant plasmid containing the SSU rRNA gene of Theileria fasciola (pToSSUrRNA) and a recombinant plasmid containing the ND1 gene of Echinococcus granulosus (pEgND1).

[0113] For the convenience of detection, the kit also includes a negative control, wherein the negative control includes a system without the gp60 gene of Cryptosporidium parvum, the COX1 gene of Strongyloides stercoralis, the SAT gene of Trypanosoma cruzi, the SSU rRNA of Theileria fasciola and the ND1 gene of Echinococcus granulosus, and can further be selected as nuclease-free water.

[0114] To facilitate detection, the kit may also include instructions for the five-plex real-time fluorescence quantitative PCR detection method provided in Example 2.

[0115] Example 4: Characteristics of the Quintuple Real-Time Fluorescence Quantitative PCR Detection Method and Kit

[0116] 4.1. Preparation of positive control

[0117] The gp60 gene of Cryptosporidium parvum, the cox1 gene of Strongyloides stercoralis, the SAT gene of Trypanosoma cruzi, the SSU rRNA of Theileria taurus and the nad1 gene of Echinococcus granulosus were synthesized using TaKaRa. The above synthesized gene fragments were connected to the pMD19-T vector and transformed into the JM109 strain. The positive recombinant plasmids obtained were used as their respective positive controls and were named pCpgp60 (Cryptosporidium parvum), pSsCOX1 (Strongyloides stercoralis), pTcSAT (Trypanosoma cruzi), pToSSUrRNA (Theileria taurus) and pEgND1 (Echinococcus granulosus), respectively.

[0118] 4.2. Optimization of conditions for quintuple real-time fluorescence quantitative PCR detection method

[0119] Plasmid DNA (i.e., each positive control) was extracted using the QIAGEN Plasmid Maxi Kit from Qiagen, Germany. The concentration of plasmid DNA was determined using an ultraviolet spectrophotometer. The five positive controls were serially diluted 10-fold and the concentration was 10 5The dilution of 1:1:1:1:1 copies / μL was mixed as a template, and the total system was 20 μL. The forward and reverse primers were mixed with the corresponding probes at different primer final concentrations and probe final concentrations. The forward primer, reverse primer and corresponding probe were added with 0.44 μL, 0.44 μL, 0.12 μL (final concentrations 440 nM, 440 nM, 120 nM), 0.22 μL, 0.22 μL, 0.06 μL (final concentrations 220 nM, 220 nM) and 0.12 μL (final concentrations 220 nM, 220 nM) respectively. , 60nM), 0.11μL, 0.11μL, 0.03μL (final concentration 110nM, 110nM, 30nM), according to the amplification program provided by the present invention: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles, five-fold real-time fluorescence quantitative PCR reaction was performed, and the ratio of primer and probe concentration when the lowest Ct value and higher fluorescence intensity increase value (ΔRn) were obtained was the best. The results are shown in Table 2.

[0120] Table 2: Results of primer and probe concentration grouping experiments

[0121]

[0122] The results in Table 2 show that the optimal reaction system was explored using different combinations of probes and primer concentrations. It was found that when the concentrations of GZQEgND1-F were 440 nM, GZQEgND1-R were 440 nM, GZQEgND1-P were 120 nM, GZQCpgp60-F were 220 nM, GZQCpgp60-R were 220 nM, GZQCpgp60-P were 60 nM, GZQSsCOX1-F were 220 nM, GZQSsCOX1-R were 220 nM, GZQSsCOX1-P were 60 nM, GZQTcSAT When the concentration of -F is 220nM, the concentration of GZQTcSAT-R is 220nM, the concentration of GZQTcSAT-P is 60nM, the concentration of GZQToSSUrRNA-F is 220nM, the concentration of GZQToSSUrRNA-R is 220nM, and the concentration of GZQToSSUrRNA-P is 60nM, the fluorescence intensity of CY5 and VIC in the quintuple real-time fluorescence quantitative PCR reaction is the highest, and the Ct value is also the lowest (because the fluorescence of CY5 and VIC in the quintuple real-time fluorescence quantitative PCR detection method is relatively weak, so the primer probe combination with the highest CY5 and VIC fluorescence intensity is selected as the best combination).

[0123] 4.3. Preparation of standard curve

[0124] After 10-fold serial dilutions of the five positive controls, 10 8 , 10 7, 10 6 , 10 5 , 10 4 , 10 3 , 10 2 The plasmid standard with gradient concentration of 1000 copies / μL was used as a template to draw the standard curve. A five-fold real-time fluorescence quantitative PCR reaction system was used: TaqMan Mix 10μL, nuclease-free water 2μL, primer and TaqMan probe Mix 3μL, DNA template 5μL. Amplification program: 50℃2min, 1 cycle; 95℃10min, 1 cycle; 95℃15s, 60℃1min, 40 cycles, collect fluorescence signals, and analyze their standard curve.

[0125] The results are as follows Figures 1 to 10 As shown in FIG. 1 , the amplification curves and standard curves of the target detection genes of five parasites were respectively obtained by using the five-fold real-time fluorescence quantitative PCR detection method of the present invention, wherein Figure 1 , Figure 3 , Figure 5 , Figure 7 and Fig. 9 In the amplification curve shown, the 7 curves from left to right represent 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 The results showed that the method of the present invention has a high amplification efficiency (E) for the target detection genes of 5 parasites (Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus), and the E were 97.015%, 97.406%, 98.654%, 102.734% and 107.726%, respectively. The correlation coefficient R 2 The correlation coefficient and amplification efficiency showed that the template amount and the corresponding Ct value had a good linear relationship within the current concentration range of dilution.

[0126] Specificity analysis

[0127] Using DNA from Aspiculuris tetraptera, Syphacia obvelata, Syphacia muris, and Balantidium coli as templates and nuclease-free water as a negative control, fluorescent quantitative PCR amplification was performed using the method and kit of the present invention. The results are shown in FIG. Fig.11 As shown, the test results of this method for the above parasites were all negative, while the test results for Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus were positive, indicating that this method has strong specificity and no cross-reaction with other parasites.

[0128] Sensitivity analysis

[0129] Plasmid standards of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciolae, and Echinococcus granulosus at different dilutions were used to evaluate the analytical sensitivity of the method. Plasmid standards of each dilution concentration were used as templates, and the reaction was carried out according to the reaction system and amplification procedure of the five-fold real-time fluorescence quantitative PCR detection method provided. In the case of higher concentration plasmid standards, 8 replicates were made for each dilution; in the case of lower concentration plasmid standards, 20 replicates were made for each dilution. The results are shown in Table 3.

[0130] Table 3: Detection limit determination of the five-plex real-time fluorescence quantitative PCR detection method

[0131]

[0132] The results in Table 3 show that the detection limits of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus are 1.7 copies / μL, 1.2 copies / μL, 1.5 copies / μL, 1.4 copies / μL and 1.4 copies / μL, respectively, indicating that the method of the present invention has high sensitivity.

[0133] Stability analysis

[0134] Five concentrations of 10-fold serial dilutions of plasmid standard were used as templates, followed by 10 7 , 10 6 , 10 5 , 10 4 , 10 3 The reaction was carried out according to the reaction system and amplification procedure of the five-fold real-time fluorescence quantitative PCR detection method provided. In the same experiment, three replicates were made for each dilution of the plasmid standard to analyze the intra-batch differences of the method; then, the same plasmid standard was used as a template, and an independent repeated experiment was carried out for 3 consecutive days within a week. In the same experiment, three replicates were made for each dilution of the plasmid standard to analyze the inter-batch differences of the method. The coefficient of variation (CV) of the Ct value was statistically calculated to verify the repeatability and stability of the method. The results are shown in Table 4.

[0135] Table 4: Results of repeatability and stability test of quintuple real-time fluorescence quantitative PCR detection method

[0136]

[0137] The results in Table 4 show that the intra-batch coefficients of variation of the five-fold real-time fluorescence quantitative PCR detection method for Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus are 0.11% to 0.60%, 0.09% to 1.18%, 0.77% to 1.34%, 0.22% to 0.77% and 0.15% to 0.72%, respectively. The inter-batch coefficients of variation of the five-fold real-time fluorescence quantitative PCR detection method for Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus are 0.24% to 0.76%, 1.04% to 2.73%, 0.33% to 0.71%, 0.29% to 0.79 and 0.15% to 0.71%, respectively. It can be seen that the coefficients of variation (CV values) of the intra-batch and inter-batch repeatability tests are both less than 3%, indicating that the repeatability and stability of the method of the present invention are good.

[0138] Example 5: Clinical diagnostic performance of the five-plex real-time fluorescence quantitative PCR detection method

[0139] DNA extracted from 600 Huyang clinical specimens (including blood, serum and rectal swabs) collected in Yanji, Yanbian Prefecture, Jilin Province in September 2023 was used to detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus in these clinical samples using the five-fold real-time fluorescence quantitative PCR detection method and kit established by the present invention, and the epidemiological survey data were analyzed. When testing clinical samples, positive controls (Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus DNA) and nuclease-free water (as a negative control) were set to exclude false negative and false positive reactions.

[0140] The test results show that among 600 clinical samples, 2 samples were positive for Cryptosporidium parvum, 0 samples were positive for Strongyloides stercoralis, 0 samples were positive for Trypanosoma cruzi, 39 samples were positive for Theileria spp., and 0 samples were positive for Echinococcus granulosus. Among them, in a closed test tube, 2 samples that were positive for both Cryptosporidium parvum and Theileria spp. were detected using a five-fold real-time fluorescence quantitative PCR detection method, that is, these two clinical samples contained Cryptosporidium parvum and Theileria spp. The above results show that the five-fold real-time fluorescence quantitative PCR detection method and kit provided by the present invention can be used to detect whether Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp., and Echinococcus granulosus are present in clinical samples, and can identify whether clinical samples are infected with a mixture of multiple parasites.

[0141] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus in the same system, characterized in that: The five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination includes: Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Cryptosporidium parvum, comprising: a forward primer GZQCpgp60-F having a nucleotide sequence as shown in SEQ ID NO: 1, a reverse primer GZQCpgp60-R having a nucleotide sequence as shown in SEQ ID NO: 2, and a TaqMan probe GZQCpgp60-P having a nucleotide sequence as shown in SEQ ID NO: 3; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Strongyloides stercoralis, comprising: a forward primer GZQSsCOX1-F having a nucleotide sequence as shown in SEQ ID NO:4, a reverse primer GZQSsCOX1-R having a nucleotide sequence as shown in SEQ ID NO:5, and a TaqMan probe GZQSsCOX1-P having a nucleotide sequence as shown in SEQ ID NO:6; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Trypanosoma cruzi, comprising: a forward primer GZQTcSAT-F with a nucleotide sequence as shown in SEQ ID NO:7, a reverse primer GZQTcSAT-R with a nucleotide sequence as shown in SEQ ID NO:8, and a TaqMan probe GZQTcSAT-P with a nucleotide sequence as shown in SEQ ID NO:9; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Theileria, comprising: a forward primer GZQToSSUrRNA-F whose nucleotide sequence is shown in SEQ ID NO: 10, a reverse primer GZQToSSUrRNA-R whose nucleotide sequence is shown in SEQ ID NO: 11, and a TaqMan probe GZQToSSUrRNA-P whose nucleotide sequence is shown in SEQ ID NO: 12; Real-time fluorescent quantitative PCR primers and TaqMan probes for detecting Echinococcus granulosus, comprising: a forward primer GZQEgND1-F having a nucleotide sequence as shown in SEQ ID NO: 13, a reverse primer GZQEgND1-R having a nucleotide sequence as shown in SEQ ID NO: 14, and a TaqMan probe GZQEgND1-P having a nucleotide sequence as shown in SEQ ID NO: 15; The TaqMan probe is fluorescently labeled, with a fluorescent emission group labeled at its 5' end and a fluorescent quenching group labeled at its 3' end.

2. The five-plex real-time fluorescence quantitative PCR primer and TaqMan probe combination according to claim 1, characterized in that: The 5′ end of the TaqMan probe GZQCpgp60-P is labeled with a FAM fluorescence emission group, and the 3′ end is labeled with a MGB-NFQ fluorescence quenching group; The 5′ end of the TaqMan probe GZQSsCOX1-P is labeled with a VIC fluorescent emission group, and the 3′ end is labeled with a MGB-NFQ fluorescent quenching group; The 5′ end of the TaqMan probe GZQTcSAT-P is labeled with an ABY fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; The 5′ end of the TaqMan probe GZQToSSUrRNA-P is labeled with a JUN fluorescent emission group, and the 3′ end is labeled with a QSY fluorescent quenching group; The 5′ end of the TaqMan probe GZQEgND1-P is labeled with a CY5 fluorescent emission group, and the 3′ end is labeled with a MGB-NFQ fluorescent quenching group.

3. A five-fold real-time fluorescence quantitative PCR detection kit for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus, characterized in that: The kit comprises the five-plex real-time fluorescent quantitative PCR primer and TaqMan probe combination according to claim 1 or 2.

4. The five-fold real-time fluorescence quantitative PCR detection kit according to claim 3, characterized in that: The kit also includes a positive control, wherein the positive control includes a recombinant plasmid containing the gp60 gene of Cryptosporidium parvum, a recombinant plasmid containing the COX1 gene of Strongyloides stercoralis, a recombinant plasmid containing the SAT gene of Trypanosoma cruzi, a recombinant plasmid containing the SSU rRNA gene of Theileria fasciola and a recombinant plasmid containing the ND1 gene of Echinococcus granulosus.

5. The five-fold real-time fluorescence quantitative PCR detection kit according to claim 4, characterized in that: The kit also includes a negative control, wherein the negative control includes a system without the gp60 gene of Cryptosporidium parvum, the COX1 gene of Strongyloides stercoralis, the SAT gene of Trypanosoma cruzi, the SSU rRNA gene of Theileria fasciola and the ND1 gene of Echinococcus granulosus.

6. Use of the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination according to claim 1 or 2 or the quintuple real-time fluorescence quantitative PCR detection kit according to any one of claims 3 to 5 for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus in the same system for non-disease diagnosis and treatment purposes.

7. A five-fold real-time fluorescence quantitative PCR detection method for simultaneously detecting Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciolae and Echinococcus granulosus for non-disease diagnosis and treatment purposes, characterized in that: The method comprises using the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination described in claim 1 or 2 or the quintuple real-time fluorescence quantitative PCR detection kit described in claim 3 or 4 to perform quintuple real-time fluorescence quantitative PCR amplification on genomic DNA extracted from the sample to be tested, and collecting fluorescence signals to perform qualitative detection of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria fasciola and Echinococcus granulosus, and / or to perform quantitative detection of parasite nucleic acids determined to be contained.

8. The five-fold real-time fluorescence quantitative PCR detection method according to claim 7, wherein the method comprises the following steps: 1) Establishing a standard curve: using positive controls of Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus to prepare plasmid standards with gradient concentrations; using plasmid standards of different concentrations as templates, using the five-fold real-time fluorescence quantitative PCR primer and TaqMan probe combination of claim 1 or 2 to perform five-fold real-time fluorescence quantitative PCR detection, after the detection, plotting the concentration Log10 value of each plasmid standard as the X-axis and the corresponding Ct value thereof as the Y-axis, and drawing a standard curve; 2) extracting genomic nucleic acid from the sample to be tested, using the extracted genomic nucleic acid as a template, and performing quintuple real-time fluorescence quantitative PCR detection using the quintuple real-time fluorescence quantitative PCR primer and TaqMan probe combination of claim 1 or 2; 3) Use the specific amplification curve and the obtained Ct value to qualitatively detect Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp. and Echinococcus granulosus, and / or use the standard curve obtained in step 1) to quantitatively detect the parasite nucleic acid contained.

9. The five-fold real-time fluorescence quantitative PCR detection method according to claim 7, characterized in that: The reaction system for quintuple real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: GZQCpgp60-F, GZQCpgp60-R, GZQSsCOX1-F, GZQSsCOX1-R, GZQTcSAT-F, GZQTcSAT-R, GZQToSSUrRNA-F and GZQToSSUrRNA-R with a final concentration of 200-300 nM, GZQEgND1-F and GZQEgND1-R with a final concentration of 400-500 nM, GZQCpgp60-P, GZQSsCOX1-P, GZQTcSAT-P and GZQToSSUrRNA-P with a final concentration of 50-100 nM, and GZQEgND1-P with a final concentration of 100-200 nM.

10. The five-fold real-time fluorescence quantitative PCR detection method according to any one of claims 7 to 9, characterized in that: The reaction program for the five-plex real-time fluorescence quantitative PCR detection in step 1) and step 2) includes: 50°C for 2 min, 1 cycle; 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 40 cycles.

11. The five-fold real-time fluorescence quantitative PCR detection method according to any one of claims 7 to 9, characterized in that: The judgment criteria for the qualitative test are: In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQCpgp60-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Cryptosporidium parvum nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Cryptosporidium parvum nucleic acid; if 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Cryptosporidium parvum nucleic acid, and the suspicious sample needs to be resampled to extract DNA for re-testing. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative; In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQSsCOX1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as Strongyloides stercoralis nucleic acid positive; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as Strongyloides stercoralis nucleic acid negative; If 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Strongyloides stercoralis nucleic acid. The suspicious sample needs to be resampled to extract DNA and retested. If the retest Ct value is <38, it is judged as positive, otherwise it is judged as negative. In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQTcSAT-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Trypanosoma cruzi nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Trypanosoma cruzi nucleic acid; If 35 < Ct value < 38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Trypanosoma cruzi nucleic acid. The suspicious sample needs to be resampled to extract DNA and retested. If the retest Ct value is < 38, it is judged as positive, otherwise it is judged as negative. In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQToSSUrRNA-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Theileria nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Theileria nucleic acid; If 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Theileria nucleic acid. The suspicious sample needs to be resampled to extract DNA and retested. If the retest Ct value is <38, it is judged as positive, otherwise it is judged as negative. In the channel corresponding to the fluorescent emission group labeled at the 5′ end of GZQEgND1-P, if a specific S-shaped curve appears and the Ct value is ≤35, the result is judged as positive for Echinococcus granulosus nucleic acid; if there is no Ct value and no specific fluorescence amplification curve, the result is judged as negative for Echinococcus granulosus nucleic acid; If 35<Ct value<38, and a specific fluorescence amplification curve appears, the result is judged as suspicious for Echinococcus granulosus nucleic acid. The suspicious sample needs to be resampled to extract DNA and retested. If the re-test Ct value is <38, it is judged as positive, otherwise it is judged as negative.

12. The five-fold real-time fluorescence quantitative PCR detection method according to any one of claims 7 to 9, characterized in that: The detection limits of the method for Cryptosporidium parvum, Strongyloides stercoralis, Trypanosoma cruzi, Theileria spp., and Echinococcus granulosus were 1.7 copies / µL, 1.2 copies / µL, 1.5 copies / µL, 1.4 copies / µL, and 1.4 copies / µL, respectively.

Images