Molecular marker 03w4 for high wssv resistance of penaeus vannamei and application thereof

Abstract

This invention discloses a molecular marker 03W4 for high WSSV resistance in Litopenaeus vannamei and its applications, belonging to the field of molecular marker-assisted breeding technology for aquatic animals. The nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No. 1, and the genotype TT at the 301st locus of the molecular marker 03W4 is a WSSV resistance genotype. This invention also provides primers for the molecular marker 03W4, including the amplification primers shown in SEQ ID No. 2 and SEQ ID No. 3, and the extension primer shown in SEQ ID No. 4. The molecular marker 03W4 for high WSSV resistance in Litopenaeus vannamei can be used for early selection of Litopenaeus vannamei regardless of growth stage, screening for highly WSSV-resistant individuals in breeding populations with different growth performances, rapidly selecting highly WSSV-resistant parent populations, and promoting the breeding process of new Litopenaeus vannamei varieties with high WSSV resistance.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology for aquatic animals, and particularly relates to a molecular marker 03W4 for high WSSV resistance in Litopenaeus vannamei and its application. Background Technology

[0002] Litopenaeus vannamei, also known as the whiteleg shrimp, is native to the Pacific coastal waters of South America. Due to its rapid growth and strong environmental adaptability, it has been widely cultivated in my country since its introduction in 1988, becoming a pillar industry of the country's aquaculture sector. Growth traits are the most important economic trait for Litopenaeus vannamei. However, with the continuous expansion of Litopenaeus vannamei farming and the deterioration of the farming environment, diseases are frequently occurring during the farming process. Among them, White Spot Syndrome Virus (WSSV) has a strong transmissibility; infected shrimp show reduced feed intake, enlarged hepatopancreas, and white spots on their bodies, with a mortality rate reaching 100% within 3-13 days, causing huge economic losses to the shrimp industry. Currently, there is no effective method to control the spread of the virus, and the development of new varieties with WSSV resistance is an urgent market demand.

[0003] As of 2023, my country had bred 12 new varieties of Litopenaeus vannamei approved at the national level. Of these, 11 varieties exhibited growth-related superior traits, with only the "Zhongxing No. 1" variety showing resistance to WSSV virus. The genetic correlation between growth and WSSV resistance ranged from moderately negative to weakly positive across different Litopenaeus vannamei breeding populations, indicating that the balance mechanism between growth and WSSV resistance is not entirely the same across different breeding populations.

[0004] Single nucleotide polymorphism (SNP) markers, characterized by high abundance, high density, strong stability, and co-dominance, have become the most widely used molecular marker technology in economically important crustaceans such as shrimp and crab. Currently, there are relatively few SNP markers related to WSSV resistance in Litopenaeus vannamei. Developing molecular markers that are significantly associated with WSSV resistance in different growth performance populations is of great significance for fully utilizing existing high-quality germplasm and precisely breeding new WSSV-resistant varieties. Summary of the Invention

[0005] One of the objectives of this invention is to provide a molecular marker 03W4 for high WSSV resistance in Litopenaeus vannamei, the nucleotide sequence of which is shown in SEQ ID No. 1, and the 301st base of which is C or T.

[0006] The second objective of this invention is to provide a reagent for detecting the molecular marker 03W4 in the preparation of WSSV resistance identification products for Litopenaeus vannamei.

[0007] Preferably, the product is a reagent kit.

[0008] More preferably, using the genomic DNA of the Litopenaeus vannamei to be tested as a template, the genotype of the molecular marker 03W4 is determined by PCR amplification and analysis. When the genotype is TT, the Litopenaeus vannamei population is determined to be a parent with high WSSV resistance.

[0009] More preferably, the primers used in the PCR amplification include amplification primers with nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3, and extension primers with nucleotide sequences as shown in SEQ ID No. 4.

[0010] More preferably, the PCR amplification conditions are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 56°C for 25 s, extension at 72°C for 30 s, repeated for a total of 40 cycles; final extension at 72°C for 3 min; and storage at 4°C.

[0011] More preferably, the PCR reaction conditions are: pre-denaturation at 94°C for 30 s; denaturation at 94°C for 5 s, annealing at 56°C for 5 s, extension at 80°C for 5 s, repeated for a total of 40 cycles; final extension at 72°C for 3 min; and storage at 4°C.

[0012] The third objective of this invention is to provide a method for identifying WSSV resistance in Litopenaeus vannamei, the method comprising the following steps:

[0013] (1) Extract DNA from Litopenaeus vannamei to be tested;

[0014] (2) Perform PCR amplification using the DNA from step (1) as a template;

[0015] (3) Based on the PCR amplification results, determine the genotype at position 301 of molecular marker 03W4. The nucleotide sequence of molecular marker 03W4 is shown in SEQ ID No.1. If the genotype at position 301 of molecular marker 03W4 is TT, then the Litopenaeus vannamei population is determined to be a parent with high WSSV resistance.

[0016] The fourth objective of this invention is to provide a product for identifying WSSV resistance in Litopenaeus vannamei, the product containing amplification primers with nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3, and extension primers with nucleotide sequences as shown in SEQ ID No. 4.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The molecular marker 03W4 for high WSSV resistance in Litopenaeus vannamei provided by this invention can be used to screen individuals with high WSSV resistance in breeding populations with different growth performance without being limited by growth performance, and to quickly breed parent populations with high WSSV resistance, thereby promoting the breeding process of new varieties of Litopenaeus vannamei with high WSSV resistance.

[0019] (2) The molecular marker O3W4 provided by this invention is used to detect high WSSV resistance in Litopenaeus vannamei. The method is accurate, reliable and simple to operate. It can effectively and quickly screen out high WSSV resistant populations, increase the utilization rate of existing Litopenaeus vannamei germplasm, and increase seedling yield. It is of great significance to the healthy breeding and development of Litopenaeus vannamei and has broad application prospects. Attached Figure Description

[0020] Figures 1a-1c The results of the flight mass spectrometry typing verification of this invention in the validation population are shown below. Figure 1a Corresponding genotype CC, Figure 1b Corresponding genotype CT, Figure 1c Corresponding genotype TT. Detailed Implementation

[0021] Example 1

[0022] The Litopenaeus vannamei used in this embodiment were commercially available shrimp from Bangpu Seed Industry Technology Co., Ltd., a cooperative base of the Yellow Sea Fisheries Research Institute of the Chinese Academy of Fishery Sciences. Fifty-nine full-sib families aged 77-94 days were selected, and all tested negative for WSSV, EHP, AHPND, IHHNV, and DIV1 pathogens. Forty shrimp were randomly selected from each family, totaling 2360 individuals, and transported to the Genetic Breeding Center of the Yellow Sea Fisheries Research Institute (Jimo, Qingdao, Shandong) for growth and WSSV resistance testing.

[0023] Before infection testing, each family was individually reared in a 200L plastic container for 4 days. During this period, the water temperature was maintained at 25±1℃, 150L of seawater with a salinity of 30 was added, oxygen was continuously supplied, the bottom was sipped daily, and 50% of the water was changed. 12% of the body weight of the feed was weighed and divided into three feedings per day at 8:00, 14:00, and 20:00.

[0024] Feeding was stopped the day before the infection test to empty the intestines. For the formal test, 30 shrimp were randomly selected from each family of temporarily held individuals, totaling 1770 experimental group individuals. Following the method of feeding poisoned bait described in Meng Xianhong et al.'s patent (patent number: ZL201210107377.8), each shrimp was fed 10mg of poisoned bait with a virus content of 10... 6Copy / mg. After feeding, each family was divided into three parallel groups of 10 shrimp per group, placed in 70cm×40cm×40cm acrylic boxes. These boxes were placed in three separate water tanks with identical environmental conditions. During the rearing period, shrimp were fed and had their water changed daily to ensure consistent rearing conditions. Five shrimp from each family served as a control group in another facility, with the same rearing conditions as the experimental groups. No deaths occurred in the control group during the infection test. After feeding the experimental groups with poisoned bait, they were observed every 2 hours. Dead juvenile shrimp were removed, and the WSSV content in the tissue was detected using a probe-based quantitative reagent kit to determine the cause of death as WSSV infection. Individual family number, time of death, and body length at death (from the end of the eyestalk to the end of the telson) were recorded. The experiment was stopped after three consecutive days without any deaths following the peak mortality period. Muscle samples were taken from all experimental groups, flash-frozen in liquid nitrogen, and stored at -80℃.

[0025] The variance components and genetic parameters of body length and WSSV resistance survival time were estimated using individual animal models. The breeding values ​​of body length and WSSV resistance survival time for all individuals were estimated using the best linear unbiased prediction method. Based on the growth breeding values, fast-growing and slow-growing groups were selected. Within the growth difference groups, high-resistance and low-resistance groups were selected based on the individual WSSV resistance survival time breeding values. This resulted in four extreme groups: A: slow-growing and weak-resistance group; B: slow-growing and strong-resistance group; C: fast-growing and weak-resistance group; and D: fast-growing and strong-resistance group. Each group consisted of 30 individuals, with no overlap between groups and significant differences in growth and WSSV resistance survival time breeding values ​​(P<0.05). The range of body length and WSSV resistance survival time for the four extreme mixed-breed individuals is shown in Table 1.

[0026] Table 1. Body length and WSSV resistance survival time range of four extreme mixed-breed individuals.

[0027]

[0028] Example 2

[0029] I. Screening of candidate molecular markers related to WSSV resistance

[0030] 1. High-throughput sequencing and sequence alignment

[0031] DNA was extracted from the muscle tissue of Litopenaeus vannamei tail by tail using the CTAB (Cetyltrimethylammonium Bromide) method. 1 ml of 1×CTAB was added to a 1.5 ml sterile enzyme centrifuge tube; approximately 20 mg of sample was added to the tube and homogenized at 60 Hz for 4 min; incubated in a 65°C water bath for 60 min; centrifuged at 8000 g for 5 min at room temperature; 900 μL of the supernatant was transferred to a new 2 mL sterile enzyme centrifuge tube; 450 μL of chloroform was added to the supernatant; the tube was capped tightly and the sample was inverted to mix for 30 s until the solution was completely emulsified and white; centrifuged at 13000 g for 10 min at room temperature; 800 μL of the supernatant was transferred to a new 1.5 mL sterile enzyme-free centrifuge tube. (Beckman AgencourtAMPure) Incubate XP beads at room temperature in the dark for 30 minutes to equilibrate. Add 0.6 times the volume of the supernatant to the thoroughly mixed beads, gently pipette to mix at least 10 times, and let stand at room temperature for 5 minutes. Place on a magnetic rack for 5 minutes until the solution is clear, carefully aspirate and discard the supernatant. Keep the 1.5 mL centrifuge tube fixed on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, let stand at room temperature for 30 seconds, then discard the supernatant, being careful not to disturb the magnetic beads. Wash once more with 80% ethanol. Keep the 1.5 mL centrifuge tube fixed on the magnetic rack and let the magnetic beads dry at room temperature for 2–5 minutes. Remove the 1.5 mL centrifuge tube from the magnetic rack and add 50 μL of 10 mM Tris. Elute with HCl, gently pipette to mix, and let stand at room temperature for 5 minutes. Place a 1.5 mL centrifuge tube on a magnetic rack and let stand at room temperature for 5 minutes until the solution is clear. Carefully transfer approximately 50 μL of the supernatant to a new sample storage tube to obtain the purified DNA. Analyze the purity and integrity of the DNA by agarose gel electrophoresis; use Nanodrop to detect the DNA purity (OD260 / 280 ratio); and use Qubit to accurately quantify the DNA concentration.

[0032] Each pool contained 30 individuals, providing an equal amount of DNA sample to construct four DNA pools: A (slow growth, weak resistance), B (slow growth, strong resistance), C (fast growth, weak resistance), and D (fast growth, strong resistance). The mixed DNA samples were randomly fragmented into 500bp fragments using a Covaris S2 / E210 shredder. The DNA fragments underwent end repair, PloyA tailing, sequencing adapter addition, purification, and PCR amplification to prepare the library. The constructed libraries were sequenced using an Illumina Novaseq 6000 sequencing platform, and the sequencing data underwent quality control to obtain CleanData. This CleanData was compared with the reference genome GCF_003789085.1 to complete site detection and annotation. The quality statistics of the sequencing data from the four pools are shown in Table 2. Filtered valid data were aligned using the Burrows-Wheeler alignment tool (BWA) software, and the alignment results were then processed using SAMTOOLS software to remove PCR duplicates. The average sequencing depth was above 30×, suitable for subsequent analysis.

[0033] Table 2 Overview of Sequencing Quality Control

[0034]

[0035]

[0036] 2. Screening for differentially expressed regions in the genome

[0037] Different genomic regions were selected using a sliding window strategy: 50kb windows were used with a sliding step size of 25kb. For each selected genomic region, the fold change in nucleotide diversity (π-Ratio) and the fixation index (Fst) were calculated between groups A and B, and between groups C and D. Based on the results of π-Ratio and Fst, significant regions were selected according to the inter-population difference P < 0.05.

[0038] 3. Marker Detection and Annotation

[0039] SNPs and InDels of candidate regions were detected using the Unified Genotyper module in the Genome Analysis Toolkit (GATK) software. The filtering parameters were set to: -Window 4, -filter "QD<2.0||FS>60.0||MQ<40.0", -G_filter "GQ<20". 697 selected genomic regions containing 510,524 SNPs were located between groups A and B; 842 selected genomic regions containing 585,675 SNPs were located between groups C and D.

[0040] 4. SNP frequency difference analysis

[0041] Calculate the SNP-index at each site for the mixed pool of populations AB and CD, and calculate the frequency difference distribution of SNPs in the following direction: △(index) = index(high WSSV resistance) - index(low WSSV resistance).

[0042] 5. Mark and Filter

[0043] Candidate SNPs were screened, and sites with a Δindex close to 1 or -1 in both populations were selected as priority sites for further validation. The screening criteria are as follows:

[0044] (1) Based on the annotation information of SNP sites, and sorted from high to low according to │△index│, sites in synonymous, non-synonymous mutations or upstream and downstream regions are selected first.

[0045] Ultimately, 69 markers with significant frequency differences between groups AB and CD were selected.

[0046] Table 3. Statistical results of SNP detection and annotation among groups with different resistance levels.

[0047]

[0048] II. Validation of WSSV resistance-related molecular markers

[0049] Another batch of Litopenaeus vannamei shrimp was selected, and time-of-flight mass spectrometry was used to validate candidate molecular markers related to WSSV resistance in four populations: slow-growing and weakly resistant, slow-growing and strongly resistant, fast-growing and weakly resistant, and fast-growing and strongly resistant. Each group consisted of 30 individuals. The specific operational steps are as follows:

[0050] (1) PCR amplification: Primers are designed on the flanking sequences of the marker site to amplify the DNA sequence containing the detection target;

[0051] (2) Single-base extension: SNP sequence-specific extension primers are added to the PCR amplification product, and single-base extension is performed using iPLEX technology. For the detection target, different genotypes differ only in the terminal target base of the extension;

[0052] (3) Mass spectrometry detection: The products after single-base extension are purified and transferred to a SpectroCHIP chip for mass spectrometry detection. The DNA is positively charged by laser irradiation and flies in the detection vacuum tube. The flight speed is inversely proportional to the mass of each extension product. Finally, the base type is determined by the position of the peak, thereby realizing genotyping.

[0053] (4) Based on the mass spectrometry detection results, the mutation markers of each individual were counted, and SPSS software was used to analyze whether the markers were related to WSSV resistance.

[0054] The specific steps are as follows:

[0055] 1. Primer design

[0056] Primer design software, including Sequenom's Genotyping Tools and MassarrayAssay Design, was used to design PCR amplification primers and single-base extension primers for specific sites. Primer length was 18-30 bp, and the PCR product was 80-200 bp. m The temperature range is 55-65℃, with an annealing temperature of around 60℃; the GC content is 40-70%.

[0057] 2. PCR amplification

[0058] Each amplification reaction system had a total volume of 5 μL. The PCR amplification reaction systems are shown in Table 4, and the reaction procedures are shown in Table 5. Primer synthesis and sequencing were performed by Shanghai Sangon Biotech Co., Ltd.

[0059] Table 4 Components of the PCR amplification reaction system

[0060]

[0061] Table 5 PCR amplification reaction procedure

[0062]

[0063] 3. Alkaline phosphatase treatment of PCR products

[0064] (1) After the PCR reaction, the multiplex PCR amplification products were purified using SAP (shrimp alkaline phosphatase) to remove dNTPs from the reaction. The SAP reaction solution formula is as follows (taking a single sample as an example): SAP Buffer 0.17 μl, SAP Enzyme (1.7 U / μl) 0.3 μl, ddH2O 1.53 μl.

[0065] (2) Add SAP reaction solution to PCR reaction plate using a pipette, 2 μl per well, seal and centrifuge.

[0066] (3) Place the PCR reaction plate containing the SAP reaction solution into the PCR instrument and run the following reaction program: 37℃, 40min; 85℃, 5min; store at 4℃.

[0067] (4) After the reaction is complete, remove the PCR reaction plate and centrifuge it briefly for later use.

[0068] 4. Single base extension reaction

[0069] Adding ddSNPs caused the PCR to extend by only one base. The single-base extension reaction system is shown in Table 6, and the total reaction volume is 2 μL. The reaction procedure is shown in Table 7.

[0070] Table 6. Monobase Extension Reaction System

[0071]

[0072] Table 7. Procedure for Monobasic Extension Reactions

[0073]

[0074] 5. Product purification

[0075] (1) Cover the resin evenly on the resin scraper and let it stand for 20 minutes.

[0076] (2) Centrifuge the PCR reaction plate at 1000 rpm for 1 min after the reaction is complete, add 25 μl of deionized water to each well, invert it on the resin plate (make sure it is fixed and does not move), then invert it and place the resin plate on the PCR reaction plate, tap it to make the resin fall into the PCR reaction plate, and seal it.

[0077] (3) Using the long axis of the PCR reaction plate as the center, flip the PCR reaction plate for 20 min, centrifuge at 3500 rpm for 5 min and set aside.

[0078] 6. Mass spectrometry detection

[0079] (1) Spotting the sample onto the Nanodispenser SpectroCHIP chip: Transfer the detection sample from the PCR reaction plate to the MassARRAY SpectroCHIP chip with a matrix covering its surface.

[0080] (2) Mass spectrometry detection using MassARRAY Analyzer Compac;

[0081] (3) TYPER software was used to analyze the experimental results and obtain the typing data.

[0082] 7. Statistical Analysis

[0083] As shown in Table 8, the TT genotype in 03W4 accounted for 0.87% and 0.87% of the slow-growing, high-resistance group and the fast-growing, high-resistance group, respectively, both being the dominant genotypes. The difference between these two groups was statistically significant (P = 0.001). Therefore, the TT genotype at site 301 of the 03W4 molecular marker is considered to be the WSSV resistance genotype. The nucleotide sequence of the 03W4 molecular marker is shown in SEQ ID No. 1, and the amplification primers for developing this molecular marker are shown in SEQ ID No. 2 and SEQ ID No. 3, while the extension primers are shown in SEQ ID No. 4 (Table 9).

[0084] SEQ ID No.1Penaeus vannamei:

[0085] ATCCCCCAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTTGTCCACCCCCCAAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTGTCCATCCCCAAACATCAAGAAACACAGCAACACCCTCCACTCTCCCACTGACCTGTGTCCACCCCCAAACATCAAGAAACACAGCAACACTCTCCACTCTCCCACTGACCTGTGTCCATCCCCAAAACATCA AGAAGACAGCAACACACTCC ACTCCTCCCACTGACCTGTGTCCATGCAAG[T / C]CTCGTAGAAGCG GTTCACCATATGCAGGGGTT CCGCAGCACCTGGCG AGACGGGGCTCTCCAAGATCAGTTTAAGACGTTTGGTCAAGATGTCACCTGCTTCGTAGAATGTGCCGGTGCTTGGGGAAGAGAGGGAGGTCAGAAACAATGTTTTGGGGGTATTTACAAAAATGTAGGGAGGTGAGACACAATGTTTTTTTTTTGGGGGGGGGTATTTACAAAAATGTAATATGACATAAACAAGTATAAACACACACGGATAAACTTATAAAAGCGAAAAGACAGACACAAATGTGCACAC

[0086] Table 8. Classification results of 03W4

[0087]

[0088] Table 9 Primers for Molecular Markers

[0089]

[0090]

[0091] The molecular marker 03W4 obtained by this invention can be used to assist in the selection of high WSSV-resistant varieties of Litopenaeus vannamei. The specific application steps are as follows: extract DNA from Litopenaeus vannamei test samples and use it as a template; perform flight mass spectrometry typing using amplification primers 03W4-F, 03W4-R and extension primer 03W4-E of molecular marker 03W4; if the genotype of nucleotide 301 of 03W4 in the typing results is TT, then the test sample can be selected as a parent for breeding high WSSV-resistant varieties of Litopenaeus vannamei.

[0092] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular marker O3W4 for resistance to white spot syndrome virus in Litopenaeus vannamei, characterized in that, The nucleotide sequence of the molecular marker 03W4 is shown in SEQ ID No.

1. The 301st base of the molecular marker 03W4 is C or T. When the genotype is TT, the Litopenaeus vannamei population is identified as a parent with high resistance to white spot syndrome virus.

2. The application of a reagent for detecting the molecular marker O3W4 as described in claim 1 in the preparation of a product for identifying resistance to white spot syndrome virus in Litopenaeus vannamei, characterized in that, Using the genomic DNA of Litopenaeus vannamei as a template, the genotype of the molecular marker 03W4 was determined by PCR amplification and analysis. When the genotype was TT, the Litopenaeus vannamei population was determined to be a parent with high resistance to white spot syndrome virus.

3. The application according to claim 2, characterized in that, The product in question is a reagent kit.

4. The application according to claim 3, characterized in that, The primers used in the PCR amplification are the amplification primers with nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3, and the extension primers with nucleotide sequences as shown in SEQ ID No.

4.

5. A method for identifying resistance to white spot syndrome virus in Litopenaeus vannamei, characterized in that, The identification method includes the following steps: (1) Extract DNA from Litopenaeus vannamei to be tested; (2) Perform PCR amplification using the DNA from step (1) as a template; (3) Based on the PCR amplification results, determine the genotype at position 301 of molecular marker 03W4. The nucleotide sequence of molecular marker 03W4 is shown in SEQ ID No.

1. The base at position 301 of molecular marker 03W4 is C or T. If the genotype at position 301 of molecular marker 03W4 is TT, then the Litopenaeus vannamei population is determined to be a parent with high resistance to white spot syndrome virus.

6. A product for identifying resistance to white spot syndrome virus in Litopenaeus vannamei, characterized in that, The product contains amplification primers with nucleotide sequences as shown in SEQ ID No. 2 and SEQ ID No. 3, and extension primers with nucleotide sequences as shown in SEQ ID No. 4.

Images