An SNP locus related to intramuscular fat content in pigs, related molecular markers and their applications

Abstract

The present invention belongs to the fields of molecular biotechnology and molecular marker technology, and particularly relates to an SNP locus related to intramuscular fat content in pigs, a related molecular marker and its application. The SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1. The polymorphism of the bases at this locus affects the intramuscular fat content in pigs. Among them, the relevant indicators of the TT genotype are greater than those of pig individuals with the TG and GG genotypes, and the relevant indicators of the TG genotype are greater than those of pig individuals with the GG genotype. The present invention uses the means of molecular breeding to solve the problem of improving the phenotypic performance of intramuscular fat content in pigs. By preferentially selecting the dominant alleles of the above SNPs, the frequency of dominant alleles can be increased generation by generation, the intramuscular fat content in pigs can be improved, the pork quality can be enhanced, the genetic improvement and breeding of pigs can be accelerated, and the economic benefits of pig farms can be increased.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biotechnology and molecular marker technology. Specifically, the present invention relates to an SNP locus related to intramuscular fat content in pigs, related molecular markers, and their applications. Background Art

[0002] Intramuscular fat in pigs refers to the fat existing between muscle fibers in pork, which is usually called "marbling" or "granularity". It has a significant impact on the flavor, tenderness, and juiciness of meat quality, and thus is one of the important indicators for meat quality evaluation. The intramuscular fat content in pigs has a certain heritability. Through reasonable genetic selection, breeders can retain those individuals with excellent intramuscular fat performance, gradually improve the meat quality of pig breeds, effectively increase the intramuscular fat content in pigs, and ensure economic benefits and market adaptability. Summary of the Invention

[0003] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide an SNP locus related to intramuscular fat content in pigs and an SNP molecular marker related to this locus.

[0004] The object of the present invention also lies in: providing the application of a substance for detecting the polymorphism or genotype of the SNP locus in the pig genome in any one of the following: (1) identifying or assisting in identifying the intramuscular fat content in pigs; (2) screening or improving the intramuscular fat content trait in pigs; (3) pig breeding.

[0005] Another object of the present invention lies in: providing a primer composition and a kit for identifying the above SNP molecular marker.

[0006] The object of the present invention also lies in: providing the application of the above primer pair and kit, and providing a genetic improvement method for performing molecular marker-assisted breeding to improve the intramuscular fat content in pigs.

[0007] The present invention is realized as follows:

[0008] The application of a reagent for detecting an SNP locus related to intramuscular fat content in pigs in identifying the intramuscular fat content in pigs, wherein the SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the base at this locus affects the intramuscular fat content in pigs; the intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; the intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

[0009] Use of a reagent for detecting SNP loci related to pork quality traits in screening pigs with high intramuscular fat content, wherein the SNP locus corresponds to position 151330919 bp on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the bases at this locus affects the intramuscular fat content of pigs;

[0010] The intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; the intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

[0011] Use of a reagent for detecting SNP loci related to pork quality traits in genetic breeding for improving the intramuscular fat content trait of pigs, wherein the SNP locus corresponds to position 151330919 bp on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the bases at this locus affects the intramuscular fat content of pigs;

[0012] The intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; the intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

[0013] Use of a reagent for detecting SNP molecular markers related to pork quality traits in identifying the intramuscular fat content of pigs, characterized in that: the nucleotide sequence of the SNP molecular marker is

[0014] ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0015] This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T or G, and the genotypes can be TT, TG or GG; The intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and pigs with the GG genotype; The intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

[0016] Application of a reagent for detecting an SNP molecular marker related to pork quality traits in screening pigs with high intramuscular fat content, wherein the nucleotide sequence of the SNP molecular marker is

[0017] ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0018] This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T or G, and the genotypes can be TT, TG, or GG; The intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and pigs with the GG genotype; The intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

[0019] Application of a reagent for detecting an SNP molecular marker related to pork quality traits in genetic breeding for improving the intramuscular fat content trait of pigs, wherein the nucleotide sequence of the SNP molecular marker is

[0020] ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0021] This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T or G, and the genotypes can be TT, TG or GG; The intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and pigs with the GG genotype; The intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

[0022] A method for detecting the intramuscular fat content of pigs, comprising the following steps: detecting the SNP locus of pigs located at position 151330919 bp on chromosome 6 of the international pig reference genome version 11.1 and within the NFIA gene; identifying whether the single nucleotide of the said SNP locus is T or G; determining the genotype of the pig to be tested; analyzing and judging that the intramuscular fat content of pigs with the TT genotype at the said SNP locus is higher than that of pigs with the TG genotype and pigs with the GG genotype; The intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

[0023] A primer composition for identifying an SNP locus related to the intramuscular fat content of pigs, comprising an upstream primer and a downstream primer, and their nucleotide sequences are as follows:

[0024] Forward primer: 5’-ATCTTTAACCCACCGAGCTAGG-3’;

[0025] Reverse primer: 5’-AATGGGGCTCTGTGCCACT-3’;

[0026] The SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1, located within the NFIA gene. The intramuscular fat content of pigs with the TT genotype at this SNP locus is higher than that of pigs with the TG genotype and GG genotype; the intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

[0027] Use of the foregoing primer composition in identifying the intramuscular fat content of pigs.

[0028] Use of the foregoing primer composition in screening pigs with high intramuscular fat content.

[0029] Use of the foregoing primer composition in the genetic breeding for improving the intramuscular fat content trait of pigs.

[0030] A kit for identifying SNP loci related to the intramuscular fat content of pigs, wherein the kit comprises the foregoing primer composition.

[0031] Preferably, the foregoing kit further comprises at least one of PCR reaction buffer, Taq DNA polymerase and dNTPs.

[0032] We found through experiments that the T / G locus at position 151330919 on chromosome 6 of pigs has a significant effect on the intramuscular fat content of pigs, and the nucleotide sequence at this locus is:

[0033] ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0034] This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T or G, and the genotype can be GG, TT or TG. The GG genotype is a homozygote with the nucleotide at the (T\G) locus being G. The TT genotype is a homozygote with the nucleotide at the (T\G) locus being T. The TG genotype is a heterozygote with the nucleotides at the (T\G) locus being T and G.

[0035] Based on this SNP locus, the present invention provides a method for identifying or assisting in the identification of intramuscular fat content in pigs, and the present invention provides a method for screening intramuscular fat content in pigs.

[0036] Identifying or assisting in the identification of, and screening the intramuscular fat content of pigs according to the genotype includes at least one of the following:

[0037] (1) The intramuscular fat content of pigs with the genotype TT at the SNP locus is greater than the intramuscular fat content of the pigs to be tested with the genotype TG or GG at the SNP locus.

[0038] (2) The intramuscular fat content of pigs with the genotype TG at the SNP locus is greater than the intramuscular fat content of pigs with the genotype GG at the SNP locus.

[0039] The present invention can be used in pig breeding to select breeding pigs with a relatively high intramuscular fat content. By PCR amplifying gene fragments and sequencing the type of deoxyribonucleotide at position 151330919 on chromosome 6, the genotype of the SNP locus in the genome of the pig to be tested is detected. Selecting pigs with the genotype TT at the SNP locus of the pig genome as parents for breeding can obtain piglets with a high intramuscular fat content.

[0040] The present invention provides a primer composition for detecting the polymorphism or genotype of the SNP locus located at position 151330919 on chromosome 6 in the pig genome, and also provides a kit including the foregoing primer composition. The primer composition can be used for:

[0041] (1) Products for identifying or assisting in identifying the intramuscular fat content of pigs;

[0042] (2) Products for improving the intramuscular fat content trait of pigs;

[0043] (3) Products for pig breeding.

[0044] The present invention solves the problem of increasing the intramuscular fat content of pigs by means of molecular breeding. By preferentially selecting the advantageous allele of the above SNP, the frequency of the advantageous allele can be increased generation by generation, the intramuscular fat content of pigs can be improved, the genetic improvement and breeding of pigs can be accelerated, and the economic benefits of pig farms can be increased. Detailed implementation manners

[0045] The following further describes the present invention in detail in combination with specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0046] The experimental methods in the examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the examples can be obtained from commercial channels unless otherwise specified.

[0047] In the example, 661 Beijing Black pigs are from the laboratory Beijing Black pig meat quality trait determination population.

[0048] The intramuscular fat content of pigs in the example is the intramuscular fat content of pigs at 210 days of age.

[0049] In order to establish a method for assisting in identifying the intramuscular fat content of pigs, we carried out the following experiments.

[0050] I. Screening of the SNP locus of T / G at position 151330919 on chromosome 6 of pigs

[0051] Muscle tissues were collected from 661 Beijing Black pigs respectively, and genomic DNA was extracted. Using

[0052] Forward primer: 5’-ATCTTTAACCCACCGAGCTAGG-3’

[0053] Reverse primer: 5’-AATGGGGCTCTGTGCCACT-3’;

[0054] as amplification primers, PCR amplification was performed using the genomic DNA of the pigs to be tested as template DNA to obtain PCR products, and sequencing was carried out. Alignment was performed using Seqman software to obtain a polymorphic site, named the (T\G) site, located at nucleotide position 151330919 on porcine chromosome 6. The nucleotide type of the (T\G) site is T or G, and the genotypes are TT, TG or GG. The TT genotype is a homozygote with nucleotide T at the (T\G) site. The GG genotype is a homozygote with nucleotide G at the (T\G) site. The TG genotype is a heterozygote with nucleotides T and G at the (T\G) site.

[0055] II. Correlation analysis between the (T\G) site at nucleotide position 151330919 on porcine chromosome 6 and intramuscular fat content in pigs

[0056] To determine whether the T\G site at nucleotide position 151330919 on porcine chromosome 6 is related to intramuscular fat content in pigs, 661 Beijing Black pigs were used as experimental materials. According to the above experimental method, the genomic DNA of pigs was amplified using the forward primer and reverse primer, and then sequencing was carried out to determine whether the (T\G) site of each individual was of TT genotype, TG genotype or GG genotype. The intramuscular fat content of each individual was measured, and correlation analysis was performed.

[0057] 1. Genotype

[0058] The TT genotype is a homozygote with nucleotide T at nucleotide position 151330919 on porcine chromosome 6;

[0059] The GG genotype is a homozygote with nucleotide G at nucleotide position 151330919 on porcine chromosome 6;

[0060] The TG genotype is a heterozygote with nucleotides T and G at nucleotide position 151330919 on porcine chromosome 6.

[0061] Containing the nucleotide sequence at nucleotide position 151330919 on porcine chromosome 6 as

[0062] ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0063] This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T (see Sequence 1) or G (see Sequence 2), and the genotypes can be TT, TG, or GG. The TT genotype is a homozygote with the nucleotide at the (T\G) locus being T. The GG genotype is a homozygote with the nucleotide at the (T\G) locus being G. The TG genotype is a heterozygote with the nucleotides at the (T\G) locus being T and G.

[0064] The genotyping results of the (T\G) locus for 661 Beijing Black pig individuals showed that: 5 were of the TT genotype, 69 were of the TG genotype, and 452 were of the GG genotype. The genotype frequencies and allele frequencies of the pig (T\G) locus in the tested pig population are shown in Table 1:

[0065]

[0066] As can be seen from Table 1, the genotype frequency of the GG homozygous type is significantly higher than that of the TT homozygous type and the TG heterozygous type, and the G allele is the dominant allele.

[0067] 2. Association analysis between pig genotypes and intramuscular fat content in pigs

[0068] Collect samples of the longissimus dorsi muscle and measure the intramuscular fat content using the Soxhlet extraction method.

[0069] Use SAS software for the association analysis of genotype and phenotype, and perform significance tests using Duncan's multiple test (P<0.05). The data are expressed as mean ± standard error, and a P<0.05 is considered significantly different. The results are shown in Table 2. The SNP (T\G) locus has a significant effect on the intramuscular fat content of pigs. The intramuscular fat content of pigs with the TT genotype is significantly greater than that of pigs with the TG genotype, and the intramuscular fat content of pigs with the TG genotype is greater than that of pigs with the GG genotype. Therefore, in actual pig breeding, pigs with the TT genotype have a higher intramuscular fat content.

[0070]

[0071] Note: Different lowercase letters in the table indicate significant differences (P<0.05), and the same letters indicate no significant differences (P>0.05). The values are expressed as mean ± standard error.

[0072] In summary, by determining the genotype of the (T\G) locus at position 151330919 on chromosome 6 of pigs, we can assist in identifying the intramuscular fat content of pigs: the intramuscular fat content of pigs with the TT genotype is greater than that of pigs with the TG genotype or GG genotype, and the intramuscular fat content of pigs with the TG genotype is greater than that of pigs with the GG genotype.

[0073] III. A method for assisting in identifying the intramuscular fat content of pigs

[0074] Collect muscle tissue from the pigs to be tested and extract genomic DNA. Using the genomic DNA of the pigs to be tested as a template, perform PCR amplification with the upstream primer of Sequence 3: 5’-ATCTTTAACCCACCGAGCTAGG-3’ and the downstream primer of Sequence 4: 5’-AATGGGGCTCTGTGCCACT-3’ to obtain a PCR product, and sequence the PCR product to obtain the genotype of the SNP (T\G) locus of the pigs to be tested.

[0075] The intramuscular fat content of the pigs to be tested with the TT genotype is greater than that of the pigs to be tested with the TG or GG genotype. The intramuscular fat content of the pigs to be tested with the TG genotype is greater than or assist in being greater than that of the pigs to be tested with the GG genotype.

[0076] IV. The present invention provides an SNP molecular marker that can effectively increase the intramuscular fat content of pigs. Using this SNP molecular marker for marker-assisted selection can accelerate the breeding process of related excellent traits. If all individuals with the TG genotype and GG genotype of pigs are selected and bred into TT-type individuals, the intramuscular fat content of pigs will be increased. Among the SNP molecular marker individuals, through the dominant allele TT of this SNP in the pig population, the intramuscular fat content of pigs can be increased, thereby increasing the benefits of enterprises.

[0077] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be regarded as equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. Use of a reagent for detecting SNP loci related to pork quality traits in identifying intramuscular fat content of pigs, characterized in that: The SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the bases at this locus affects the intramuscular fat content of pigs; The intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; The intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

2. Use of a reagent for detecting SNP loci related to pork quality traits in screening pigs with high intramuscular fat content, characterized in that: The SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the bases at this locus affects the intramuscular fat content of pigs; The intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; The intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

3. Use of a reagent for detecting SNP loci related to pork quality traits in the genetic breeding for improving the intramuscular fat content trait of pigs, characterized in that: The SNP locus corresponds to the 151330919bp position on chromosome 6 of the international pig reference genome version 11.1 and is located within the NFIA gene; the polymorphism of the bases at this locus affects the intramuscular fat content of pigs; The intramuscular fat content of pigs with the TT genotype at the SNP locus is higher than that of pigs with the TG genotype and the GG genotype; The intramuscular fat content of pigs with the TG genotype at the SNP locus is higher than that of pigs with the GG genotype.

4. Use of a reagent for detecting SNP molecular markers related to pork quality traits in identifying intramuscular fat content of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP locus is named the (T\G) locus, the nucleotide type of the (T\G) locus can be T or G, and the genotype can be TT, TG or GG; the intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and the GG genotype; the intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

5. Use of a reagent for detecting SNP molecular markers related to pork quality traits in screening pigs with high intramuscular fat content, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP locus is named the (T\G) locus, the nucleotide type of the (T\G) locus can be T or G, and the genotype can be TT, TG or GG; the intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and the GG genotype; the intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

6. Use of a reagent for detecting SNP molecular markers related to pork quality traits in the genetic breeding for improving the intramuscular fat content trait of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP locus is named the (T\G) locus. The nucleotide type of the (T\G) locus can be T or G, and the genotypes can be TT, TG, or GG. The intramuscular fat content of pigs with the TT genotype is higher than that of pigs with the TG genotype and pigs with the GG genotype. The intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

7. A method for detecting the intramuscular fat content of pigs, characterized in that, It includes the following steps: detecting the SNP locus of pigs located at position 151,330,919 bp on chromosome 6 of the international pig reference genome version 11.1, within the NFIA gene; identifying whether the single nucleotide of the said SNP locus is T or G; determining the genotype of the pigs to be tested; analyzing and judging that the intramuscular fat content of pigs with the TT genotype at the said SNP locus is higher than that of pigs with the TG genotype and pigs with the GG genotype; the intramuscular fat content of pigs with the TG genotype is higher than that of pigs with the GG genotype.

Images