Primers, kits and methods for identifying whether a sugar cane material contains chromosome 8 of melinis nudiflora

Abstract

The application discloses primers, kits and methods for identifying whether sugarcane material contains Chromosome 8 of Eremochloa bengalensis. The method of the application can stably detect whether the sugarcane material contains Chromosome 8 of Eremochloa bengalensis by a conventional general PCR reaction procedure through TaChr08-F / R (sequences are shown as SEQ ID NO. 1-2) specific to Eremochloa bengalensis, and has the advantages of high efficiency, good stability, low cost, simple operation and good popularization, and can be applied to improvement of sugarcane germplasm resources or sugarcane breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology technology, and particularly relates to a primer, a kit and a method for identifying whether a sugarcane material contains chromosome 8 of Erianthus arundinaceum. BACKGROUND

[0002] Sugarcane wild relatives are rich in resources, and have the advantages of high biomass, strong tillering ability, good ratooning ability, drought tolerance, waterlogging tolerance, drought tolerance, strong disease and pest resistance, etc. In sugarcane breeding, through hybridization of sugarcane wild germplasm materials with sugarcane, there is potential to obtain high-yield sugarcane varieties. Erianthus arundinaceum is one of the wild relatives of sugarcane that are concerned in genetic improvement and breeding. After more than ten years of hybridization and utilization, a number of high-quality hybrid parents and registered varieties containing Erianthus arundinaceum blood have been obtained. Chromosomes are the carriers of genes. In order to further utilize the excellent characteristics of Erianthus arundinaceum, it is necessary to understand the composition of its offspring chromosomes. At present, the methods for identifying sugarcane chromosomes mainly include genomic in situ hybridization (GISH) and molecular markers. Through GISH, chromosomes can be accurately labeled, and the distribution and changes of alien chromosomes and chromatin can be directly observed. Using GISH, the genetic characteristics of mitosis and meiosis of sugarcane chromosomes and the composition of chromosomes from different sources can be studied. Wang et al. used GISH to analyze and reveal the genomic relationship between Chinese cherry and diploid relatives. In addition to GISH, Oligo-FISH technology has also emerged in recent years and is an important cell method for identifying and accurately recognizing chromosomes. It is a technology that uses oligonucleotide probes to synthesize probes, which are combined with chromosomes in cells, and then the chromosomes are labeled. Compared with GISH, Oligo probes are more specific. Through the construction of a physical map of the chromosome, a specific segment of the chromosome and the translocation of the chromosome can be identified, and the genetic rules of the chromosome can be analyzed. Jiang designed and synthesized Oligo probes using Chorus2 software, and conducted cytological studies on corn, potato, and wheat, etc. It was found that different degrees of chromosome rearrangement occurred during the genetic process. Specific repetitive sequences can be used to prepare probes to identify chromosomes. Huang et al. mined specific centromere repetitive sequences of Erianthus arundinaceum, and prepared probes to label and identify the chromosomes of Erianthus arundinaceum. However, GISH, Oligo-FISH, and repetitive sequence in situ hybridization technology require rich experience in cytogenetics to obtain good experimental results. In addition, GISH uses metaphase chromosome cells in the root tip meristem zone of sugarcane stems for detection, and sugarcane maturity usually takes half a year to a year. Therefore, it is impossible to achieve rapid detection using cytological methods.

[0003] In order to quickly identify and analyze the composition of sugarcane chromosome, Yang et al. used ITS sequence analysis to find multiple SNP sites between different species, and developed specific primers that can identify tropical species and Erianthus. Zhuang et al. isolated Erianthus genomic specific sequences by recovering AFLP amplification products and converted them into SCAR molecular markers, which can be used to track Erianthus chromosomes or fragments in the offspring of sugarcane and Erianthus hybridization. The use of molecular markers such as SSR and gene microsatellite in sugarcane research has been shown to be crucial for disease resistance identification, genetic diversity analysis, and marker-assisted selection in breeding programs. Currently, no molecular markers that can directly identify Erianthus chromosome 8 have been developed, so it is of great significance to develop molecular markers that can identify Erianthus chromosome 8. SUMMARY

[0004] The present application aims to provide a primer, kit and method for identifying whether sugarcane material contains Erianthus chromosome 8, as there is currently no molecular identification method that can directly identify Erianthus chromosome 8. The use of Erianthus-specific sequence PCR primers TaChr08-F / R can quickly identify whether sugarcane material contains Erianthus chromosome 8, and the PCR results can directly reflect whether the detected sugarcane material contains Erianthus chromosome 8, promoting the widespread application of Erianthus germplasm resources in sugarcane genetic improvement.

[0005] The first object of the present application is to provide a primer for identifying whether sugarcane material contains Erianthus chromosome 8, the sequence of which is:

[0006] TaChr08-F: 5'-CCTATTGCTACCTAAGACCTGCTTG-3' (SEQ ID NO. 1);

[0007] TaChr08-R: 5'-ACGCCACATTGAGCCTGATCCATCT-3' (SEQ ID NO. 2).

[0008] The second object of the present application is to provide the use of the above-mentioned primer in the preparation of a kit for identifying whether sugarcane material contains Erianthus chromosome 8.

[0009] The third object of the present application is to provide a kit comprising the above-mentioned primer.

[0010] The fourth object of the present application is to provide the use of the above-mentioned primer or kit in identifying whether sugarcane material contains Erianthus chromosome 8.

[0011] The fourth object of the present application is to provide the use of the above-mentioned primer or kit in the improvement of sugarcane germplasm resources or sugarcane breeding.

[0012] A fifth object of the present application is to provide a method for quickly identifying whether a sugarcane material contains Chromosome 8 of Erianthus arundinaceus, comprising the following steps:

[0013] (1) extracting genomic DNA of the sugarcane material;

[0014] (2) using the extracted genomic DNA as a template, PCR amplification is performed using the above-mentioned TaChr08-F / R primers;

[0015] (3) subjecting the amplification product to gel electrophoresis, and judging whether the sugarcane material contains Chromosome 8 of Erianthus arundinaceus according to the electrophoresis result.

[0016] In step (2), the reaction system of the PCR comprises 2x PCR Mix 12.5 μL, TaChr08-F 2 μL, TaChr08-R 2 μL, 100 ng / μL of template DNA 2 μL, and ddH2O 6.5 μL, with a total of 25 μL.

[0017] In step (2), the reaction program of the PCR is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, cycling for 35 times; 72℃ final extension for 3 min, and 4℃ storage.

[0018] In step (3), the judgment of whether the sugarcane material contains Chromosome 8 of Erianthus arundinaceus according to the electrophoresis result is specifically as follows: if a band with a size of 793 bp is obtained, it is determined that the sugarcane material contains Chromosome 8 of Erianthus arundinaceus, and if a band with a size of 793 bp is not obtained, it is determined that the sugarcane material does not contain Chromosome 8 of Erianthus arundinaceus.

[0019] The present application has the following beneficial effects:

[0020] (1) high efficiency: the present application can quickly detect whether the sugarcane material contains Chromosome 8 of Erianthus arundinaceus, and only needs to extract the leaf DNA of the seedling for detection.

[0021] (2) good stability: as Erianthus is used in sugarcane breeding, no stable molecular marker has been used for detecting the authenticity of the offspring of the cross between the higher generation of sugarcane and Erianthus, but the present application can stably detect whether the sugarcane material contains Chromosome 8 of Erianthus arundinaceus, and has good stability.

[0022] (3) low cost: ordinary PCR technology can be used to detect whether the sugarcane material contains Chromosome 8 of Erianthus arundinaceus.

[0023] (4) simple operation: only genomic DNA needs to be extracted in the early stage, and then ordinary PCR amplification detection can be performed.

[0024] (5) good popularization: the present application has strong practicability and good popularization. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Figure 5 is the result of chromosome identification of 1891-07 by GISH and Oligo-FISH. In the figure, A: red is the chromosome of D. sanguinalis; B: red Chr1 and green Chr2; C: red Chr3 and green Chr4; D: red Chr5 and green Chr6; E: red Chr7 and green Chr8; F: red Chr9 and green Chr10. The arrow points to the labeled chromosome of D. sanguinalis. The scale bar is 5 μm.

[0026] Figure 2 Figure 7 is the result of specific detection of TaChr08-F / R primer. In the figure, M: 2000 bp Marker; 1: 1891-27; 2: 1891-67; 3: 1891-71; 4: 1723-05; 5: 1849-29; 6: Hainan 92-77; 7: Yunnan 82-114; 8: Badila; 9: ROC22; 10: ddH2O.

[0027] Figure 3 Figure 8 is the result of stability detection of TaChr08-F / R primer. In the figure, M: 2000 bp Marker; 1: 1723-02; 2: 1723-13; 3: 1723-28; 4: 1723-39; 5: 1723-42; 6: 1849-09; 7: 1849-10; 8: 1849-14; 9: 1849-32; 10: 1849-54; 11: 1891-06; 12: 1891-12; 13: 1891-16; 14: 1891-20; 15: 1891-67; 16: Hainan 92-77; 17: Hainan 92-105; 18: Yunnan 82-114; 19: Yunnan 82-110; 20: Badila; 21:

[0028] Hecheliuben; 22: ROC22; 23: Liucheng 05-136; 24: ddH2O. DETAILED DESCRIPTION

[0029] The following examples are further illustrations of the present application and are not intended to limit the present application.

[0030] Example 1

[0031] Chromosome identification of 1891-07 by GISH and Oligo-FISH was carried out, and different color probes were used to label the chromosome of 1891-07 to determine whether it contained the chromosome 8 of D. sanguinalis, which was convenient for later verification. The results are shown in Figure 1 .

[0032] 1. Test materials

[0033] Materials for detecting the specificity of primers TaChr08-F / R in Erianthus arundinaceus and sugarcane materials, including 9 Erianthus arundinaceus materials, 1 tropical variety, 1 large stem wild variety, 1 slender stem wild variety and 9 sugarcane materials containing sugarcane bloodlines, as shown in Table 1.

[0034] Materials for detecting the stability of primers TaChr08-F / R in Erianthus arundinaceus and sugarcane materials, including 23 Erianthus arundinaceus materials, 1 tropical variety, 1 large stem wild variety, 1 slender stem wild variety and 23 sugarcane materials containing sugarcane bloodlines, as shown in Table 2.

[0035] Table 1 Specificity detection materials

[0036]

[0037]

[0038] Table 2 Stability detection materials

[0039]

[0040] 2. Experimental steps

[0041] (1) DNA extraction: The genomic DNA of the leaf of the sugarcane materials in Table 1 and Table 2 was extracted by the CTAB method. The extracted genomic DNA was detected by a microplate reader, and the OD260 / OD280 ratio should be between 1.8-2.0, and was stored in a -20℃ refrigerator for use.

[0042] (2) Preparation of PCR reaction solution: In a 25μL reaction solution, operate on ice, add 12.5μL 2×PCR Mix, 2μL TaChr08-F, 2μL TaChr08-R, 2μL 100ng / μL gDNA and 6.5μL ddH2O.

[0043] TaChr08-F: 5'-CCTATTGCTACCTAAGACCTGCTTG-3' (SEQ ID NO. 1);

[0044] TaChr08-R: 5'-ACGCCACATTGAGCCTGATCCATCT-3' (SEQ ID NO. 2).

[0045] (3) PCR amplification and detection: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 2min, cycle for 35 times; 72℃ final extension for 3min, 4℃ storage. Use 1.5% agarose gel electrophoresis for detection, and use a gel imager for photographic analysis.

[0046] The results of PCR amplification of 9 sugarcane materials in Table 1 are shown in Figure 2 . Figure 2 It is shown that the specific fragment of 793 bp (TaChr08, sequence as shown in SEQ ID NO. 3) is amplified in the bahia grass, while no fragment is amplified in the sugarcane materials without bahia grass bloodline, which indicates that the specificity of the primer TaChr08-F / R is good, and it can be used as a bahia grass specific molecular marker to identify whether the sugarcane material contains the 8th chromosome of bahia grass.

[0047] The results of PCR amplification of 23 sugarcane materials in Table 2 are shown in Figure 3 . Figure 3 It is shown that the primer TaChr08-F / R can accurately detect the materials containing bahia grass bloodline in 23 materials through the conventional PCR reaction, and stably detect whether the sugarcane material contains the 8th chromosome of bahia grass.

[0048] >TaChr08 (SEQ ID NO. 3)

[0049] CCTATTGCTACCTAAGACCTGCTTGGCCAACATATCGGCAACTCGGTTATAGGACCTAGGGGAATACACAATAATGAATTCAGTAAAGCAAAGACTAATATCTTGACACTCCCTGATAATTCCCGCAATCCTCAATCTTTGGTTGGGCCCTGCCTTCCAGAGTTTCACAAACTCCTGGCTATCGGATTCAAGCTGTAGTTTCTGTCGTCCCAACTCTCGTGCGAATGCCAAGCCATCACGGCACGCCAAGGCTTCCATCATCATAGGATCTAGACCATATTGGTACCATTATGCTCGACCTCCCTGAAAATTGCCCAAGGCATCTTGGAGAACAACTCCAGTCATACCATGGCCTTGCTCAAGATAAAAACCTCTATCAGTGTTACATTTGGTCCAGCCCTCTTGCGGTGGTTTCCATTGCTCCTTTTTGATAGCTCACACCTTCTCCTACTTTGGTCAAGACAGCTGCCACAGGTCAAATGCAGTATCAGTCAACCATTTCACCGCCAAGCCAAGAGGTGTCTGCAGTCCTCCATGCCATCGGTTGTTTCGCTGCAGCCACAAAGAGTACATACCAGTGATGAAAATGCTTCTATCCTTGTCAGAGCACACACTGGTTTGCAGAATATCACTTGCCCAGGTGGTGGGGTGGAGAGTAGGAAGCTTAGCTCCTAAAAGTTCTTTGATCTCCCGCCAAAAAGCTCTTGCGACCATGCATTCGATGAGGATATGCTTGATAGATTCAGAACCAGCGCCATACACTTCACAAGATGGATCAGGCTCAATGTGGCGT.

[0050] In summary, the primer TaChr08-F / R has good specificity and stability, and using the primer can quickly identify whether the sugarcane material contains the 8th chromosome of Eremochloa ophiuroides.

[0051] The above merely describes the preferred embodiments of the present application, and it should be pointed out that the above preferred embodiments should not be regarded as a limitation to the present application, and the protection scope of the present application should be defined by the scope of the claims. For those skilled in the art, several improvements and refinements can be made without departing from the spirit and scope of the present application, and these improvements and refinements should also be regarded as the protection scope of the present application.

Claims

1. A primer for identifying whether a sugar cane material contains Chromosome 8 of Miscanthus sinensis, characterized by, The sequence of the primer is: TaChr08-F: 5'-CCTATTGCTACCTAAGACCTGCTTG-3'; TaChr08-R: 5'-ACGCCACATTGAGCCTGATCCATCT-3'.

2. Use of the primer of claim 1 in the preparation of a kit for identifying whether a sugarcane material contains the 8th chromosome of Erianthus arundinaceus.

3. A kit characterized in that, The kit comprises the primer of claim 1.

4. Use of the primer of claim 1 or the kit of claim 3 in identifying whether a sugarcane material contains the 8th chromosome of Erianthus arundinaceus.

5. A method for rapidly identifying whether a sugarcane material contains Chromosome 8 of Broomsedge, characterized in that, The method comprises the following steps: (1) extracting genomic DNA of the sugarcane material; (2) using the extracted genomic DNA as a template, performing PCR amplification using the TaChr08-F / R primer of claim 1; (3) performing gel electrophoresis on the amplification product, and determining whether the sugarcane material contains the 8th chromosome of Erianthus arundinaceus according to the electrophoresis result.

6. The method of claim 5, wherein, The reaction system of the PCR comprises 2x PCR Mix 12.5 μL, TaChr08-F 2 μL, TaChr08-R 2 μL, 100 ng / μL template DNA 2 μL, and ddH2O 6.5 μL, with a total volume of 25 μL.

7. The method of claim 5, wherein, The reaction procedure of the PCR is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, 35 cycles; 72℃ final extension for 3 min, 4℃ storage.

8. The method of claim 5, wherein, The determination of whether the sugarcane material contains the 8th chromosome of Erianthus arundinaceus according to the electrophoresis result is as follows: if a band with a size of 793 bp is obtained, it is determined that the sugarcane material contains the 8th chromosome of Erianthus arundinaceus, and if no band with a size of 793 bp is obtained, it is determined that the sugarcane material does not contain the 8th chromosome of Erianthus arundinaceus.

Images