Primer combinations and applications of KASP markers for identification of *Alopecurus aequalis* germplasm resources

By developing KASP marker primer combinations and competitive allele-specific PCR technology for *Leymus chinensis* germplasm resources, we have achieved efficient, accurate, and low-cost identification of *Leymus chinensis* germplasm resources, solving the problem of cumbersome and time-consuming detection in existing technologies, and providing important applications for gene resources and molecular markers.

CN119372360BActive Publication Date: 2025-10-31SOUTHWEAT UNIV OF SCI & TECH +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411650904.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-19
Publication Date
2025-10-31
Estimated Expiration
2044-11-19

AI Technical Summary

Technical Problem

Existing methods for identifying germplasm resources of *Leymus chinensis* are cumbersome, time-consuming, and costly, making it impossible to accurately detect large batches of samples. There is a lack of efficient and economical molecular marker technology.

Method used

We developed a KASP marker primer combo for identifying *Triticum aestivum* germplasm resources. Using competitive allele-specific PCR technology, we performed high-throughput, automated genotyping by detecting SNP sites with dual-color fluorescence. Combined with a standard *Triticum aestivum* germplasm resource DNA fingerprint database and phylogenetic tree, we achieved efficient identification of germplasm resources.

Benefits of technology

This technology enables high-throughput, accurate, rapid, and low-cost identification of germplasm resources of *Ophiopogon japonicus*, improving detection efficiency and result accuracy. It solves the problems of cumbersome and time-consuming operation in existing technologies, avoids cross-contamination and false positives, and provides important applications for gene resources and molecular markers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119372360B_ABST
    Figure CN119372360B_ABST
Patent Text Reader

Abstract

This invention discloses a primer set of KASP markers for identifying *Alopecurus aequalis* germplasm resources and its application, belonging to the field of biotechnology. The primer set amplifies 31 SNP sites, and the nucleotide sequences of each primer in the KASP-SNP primer set are shown in SEQ ID NO. 1-93. This invention also provides a kit containing the primer set and its application, which can be used to identify *Alopecurus aequalis* germplasm and varieties, and has significant application value in clarifying the genetic background and variety rights of *Alopecurus aequalis* resources in agricultural production and variety breeding. Using the primer set to construct a genetic distance matrix and phylogenetic tree of *Alopecurus aequalis* germplasm, the kinship of individual *Alopecurus aequalis* germplasm resources can be identified, which can be used to screen materials needed for *Alopecurus aequalis* research, such as core germplasm construction, breeding population screening, and genetic diversity research. The method provided by this invention has advantages such as high throughput, accuracy, low cost, simple operation, and saving manpower and resources, and has a very broad application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer combination and application of KASP markers for the identification of germplasm resources of *Ophiopogon japonicus*. Background Technology

[0002] *Elymus sibiricus* L. is the type species of the genus *Elymus* in the tribe Triticeae of the family Poaceae. It is a perennial, allotetraploid grass (2n=4x=28, StStHH), widely distributed across Eurasia, where it can become a dominant and constructive species in meadow-steppe communities. *Elymus sibiricus* not only produces high-quality forage but also exhibits strong adaptability to adverse environments such as high altitude, cold, drought, and salinity, as well as excellent disease resistance. It is widely used for vegetation restoration of degraded grasslands and the establishment of high-yield artificial grasslands in the Qinghai-Tibet Plateau and other high-altitude areas of western China. It is also an important gene pool for improving cereal crops and forage. Due to its high seed production potential, *Elymus sibiricus* is one of the few native grass species in the Qinghai-Tibet Plateau region that has achieved large-scale seed production and commercial utilization.

[0003] Wild *Mallotus simonii* resources are widely distributed and have diverse habitats, including alpine meadows, forest grasslands, shrublands, high-altitude canyons, and river valley gravel beaches at elevations ranging from 1500 to 4900 meters. Influenced by different habitat and climatic factors, significant phenotypic and genetic differences exist among wild *Mallotus simonii* populations, providing abundant genetic resources and a diverse selection basis for the development and utilization of *Mallotus simonii* germplasm. Identification of wild populations is a prerequisite for the protection and utilization of *Mallotus simonii* resources. Currently, molecular-level research on the assessment of *Mallotus simonii* germplasm resources and genetic diversity relies solely on second-generation molecular markers such as AFLP, ISSR, SSR, and SRAP. These markers are cumbersome to operate, cannot be automated, and are time-consuming and labor-intensive for large-scale sample testing. There is an urgent need to establish an accurate, efficient, and economical method for identifying *Mallotus simonii* germplasm to promote the protection, research, and utilization of *Mallotus simonii* genetic resources.

[0004] Kompetitive allele-specific PCR (KASP) is an automated, high-throughput molecular marker detection technology based on SNPs and indels. It utilizes dual-color fluorescence to detect two genotypes of a single SNP locus based on differences in marker terminal sites, enabling precise bicelestemization of target SNPs in genomic DNA samples. As a next-generation SNP detection technology, KASP genotyping offers advantages such as high accuracy, strong site adaptability, and suitability for large-sample testing. It also boasts advantages in genetic stability, accuracy, specificity, flexibility, experimental cost, and detection efficiency, making it one of the mainstream SNP genotyping tools in international plant and animal genetics breeding. KASP marker libraries for various crops, including wheat and rice, have been established, demonstrating their high application value in crop genetics and breeding research. Currently, there are no reports on the development and application of KASP molecular markers in wheat (Oryza sativa). Summary of the Invention

[0005] The purpose of this invention is to provide a set of KASP marker primer combinations and their applications for the identification of germplasm resources of *Leymus chinensis*, aiming to provide effective gene resources and molecular markers for genetic diversity research, core germplasm construction, breeding population selection, germplasm resource and variety rights protection of *Leymus chinensis*.

[0006] To achieve the above objectives, the first aspect of the present invention provides a primer combination for KASP markers used for the identification of germplasm resources of *Leymus chinensis*, wherein the primer combination is used to amplify 31 SNP sites, and the information of the sites is shown in Table 2.

[0007] The second aspect of this invention provides a KASP-SNP primer set for the identification of germplasm resources of *Eriocaulon buergerianum*. The primer set is shown in Sequence Listing 1 (SEQ ID NO. 1-93). Each KASP-SNP primer set consists of a first forward primer, a second forward primer, and a reverse primer. Genotyping of the corresponding SNP sites is performed by competitive allele-specific PCR. Specific information of the primer set is shown in Table 1.

[0008] Furthermore, the 5' ends of the specific portions of the first and second forward primers in each KASP-SNP primer set are connected to different universal fluorescent tag adapter sequences. Even further, the universal fluorescent tag adapter sequences are selected from FAM and VIC.

[0009] Table 1. 31 KASP-SNAP primer combinations used for identifying *Triticum aestivum* germplasm (SEQ ID NO. 1-93)

[0010]

[0011]

[0012]

[0013] A third aspect of the present invention provides a kit comprising the KASP-SNP primer combination described in the second aspect of the present invention.

[0014] As an option, each primer in the above kit is packaged separately.

[0015] As an option, the kit may also include reagents for competitive allele-specific PCR.

[0016] The fourth aspect of the present invention also provides the application of the KASP-SNP primer combination described in the second aspect of the present invention in any of the following aspects:

[0017] (1) Construct a standard DNA fingerprint database of old wheat germplasm resources;

[0018] (2) Constructing a phylogenetic tree of *Ophiopogon japonicus* germplasm resources;

[0019] (3) High-throughput identification of the germplasm of *Leymus chinensis* to be tested and its phylogenetic relationship with the standard *Leymus chinensis* germplasm.

[0020] The standard *Lysimachia foetida* germplasm was selected from 60 *Lysimachia foetida* germplasms from the Qinghai-Tibet Plateau, Northeast, Northwest and North China, as well as Russia and Mongolia, representing the main distribution areas of wild *Lysimachia foetida*. The information on the standard *Lysimachia foetida* germplasm is shown in Table 3.

[0021] The fifth aspect of this invention provides a standard *Triticum aestivum* germplasm resource DNA fingerprint database, which includes the genotypes (Table 7) obtained by precise biallelic typing of each standard *Triticum aestivum* germplasm resource at 31 SNP loci (Table 2) as described in the first aspect, based on the KASP marker primer combination used for *Triticum aestivum* germplasm resource identification as described in the second aspect. The standard *Triticum aestivum* germplasm is selected from 60 *Triticum aestivum* germplasm accessions from the Qinghai-Tibet Plateau, Northeast, Northwest, and North China regions of China, as well as Russia and Mongolia, representing the main distribution areas of wild *Triticum aestivum*. Information on the standard *Triticum aestivum* germplasm is shown in Table 3.

[0022] The genotype determination method for each standard old wheat germplasm based on the above 31 SNP loci is as follows:

[0023] (1) Extract genomic DNA from each standard old wheat germplasm;

[0024] (2) Using the genomic DNA of each standard old wheat germplasm from step (1) as a template, competitive allele-specific PCR was performed using the KASP-SNP primer combination described in the second aspect or the kit described in the third aspect to obtain the amplification products.

[0025] (3) Analyze the fluorescence signal of the amplification product and determine the genotyping of 31 SNP sites in a standard old wheat germplasm genome based on the fluorescence signal of the amplification product obtained by each KASP-SNP primer set.

[0026] The method for determining the genotype of 31 SNP loci in the genome of a standard *Triticum aestivum* germplasm is as follows:

[0027] If the fluorescence signal of a standard *Triticum aestivum* germplasm at a certain SNP site is the same color as the fluorescent tag adapter sequence of the first forward primer of the primer set amplifying that SNP site, then the genotype of that standard *Triticum aestivum* germplasm at that SNP site is homozygous, matching the bases at the corresponding position in the reference genome of *Triticum aestivum 'Chuancao 2'*. If the fluorescence signal of a standard *Triticum aestivum* germplasm at a certain SNP site is the same color as the fluorescent tag adapter sequence of the second forward primer of the primer set amplifying that SNP site, then the genotype of that standard *Triticum aestivum* germplasm at that SNP site is homozygous, matching the bases at the corresponding position in the reference genome. The genotype of *Chuancao 2* Lao Mangmai is homozygous for the bases at the corresponding positions of the mutant bases. If the fluorescence signal of a standard *Chuancao 2* Lao Mangmai germplasm based on a certain SNP site is a mixture of the fluorescent tag adapter sequence color of the first forward primer and the fluorescent tag adapter sequence color of the second forward primer in the primer set for amplifying that SNP site, then the genotype of that standard *Chuancao 2* Lao Mangmai germplasm based on that SNP site is heterozygous, with one base being the same as the base at the corresponding position in the reference genome of *Chuancao 2* Lao Mangmai, and the other base being a mutant base different from the base at the corresponding position in the reference genome of *Chuancao 2* Lao Mangmai.

[0028] The sixth aspect of this invention provides a high-throughput method for identifying a testable *Triticum aestivum* germplasm or its phylogenetic relationship with standard *Triticum aestivum* germplasm, comprising the following steps:

[0029] (1) Extract genomic DNA from the wheat species to be tested;

[0030] (2) Using the genomic DNA from step (1) as a template, competitive allele-specific PCR is performed using the KASP-SNP primer combination described in the second aspect or the kit described in the third aspect to obtain the amplification product;

[0031] (3) Analyze the fluorescence signal of the amplification product and determine the genotype of the first SNP site to the thirty-first SNP site in the genome of the test wheat based on the fluorescence signal of the amplification product obtained by each KASP-SNP primer set.

[0032] (4) Compare the genotyping results of the first SNP sites to the thirty-first SNP sites in the genome of the wheat germplasm to be tested obtained in step (3) with the genotyping results of the first SNP sites to the thirty-first SNP sites in the genome of each standard wheat germplasm in the DNA fingerprint database described in the fifth aspect. If the number of different SNP sites between the wheat germplasm to be tested and a certain standard wheat germplasm is 2 or more, it is determined that the wheat germplasm to be tested does not belong to the standard wheat germplasm. If the number of different SNP sites between the wheat germplasm to be tested and a certain standard wheat germplasm is 0 or 1, it is determined that the wheat germplasm to be tested belongs to the standard wheat germplasm or is suspected to be the standard wheat germplasm.

[0033] (5) If the tested *Lysimachia foetida* germplasm is not any of the standard *Lysimachia foetida* germplasm in the DNA fingerprint database, the phylogenetic relationship between the tested *Lysimachia foetida* germplasm and the standard *Lysimachia foetida* germplasm is determined. Specifically, a genetic distance matrix and a phylogenetic tree are constructed based on the genotyping results of the tested *Lysimachia foetida* germplasm and the standard *Lysimachia foetida* germplasm in the DNA fingerprint database. The phylogenetic relationship between the tested *Lysimachia foetida* germplasm and the standard *Lysimachia foetida* germplasm is determined based on the genetic distance and the clustering results in the phylogenetic tree. The smaller the genetic distance between the tested *Lysimachia foetida* germplasm and a certain standard *Lysimachia foetida* germplasm, the closer the phylogenetic relationship, and they will clearly cluster together in the phylogenetic tree; conversely, the greater the genetic distance, the more distant the phylogenetic relationship.

[0034] In this invention, the reaction program for competitive allele-specific PCR is as follows: pre-denaturation at 95℃ for 10 min; denaturation at 95℃ for 20 s, annealing and extension at 61–55℃ for 1 min, 10 cycles, decreasing the temperature by 0.6℃ per cycle; denaturation at 95℃ for 20 s, annealing at 55℃ for 60 s, 27 cycles. After the PCR reaction, data is read. If genotyping is insufficient, amplification continues with the following program: denaturation at 95℃ for 20 s, annealing at 55℃ for 60 s. Genotyping is checked every 3 cycles until genotyping is clear.

[0035] The beneficial effects of this invention compared to the prior art are as follows:

[0036] This invention provides a set of KASP-SNP molecular markers and their application methods that can be used for the identification of old wheat germplasm resources, enabling high-throughput, accurate, stable, rapid, and low-cost identification of old wheat germplasm resources.

[0037] This invention utilizes the reference genome and variant genome big data of *Triticum aestivum* to develop polymorphic KASP-SNP primer combinations in *Triticum aestivum*. The KASP-SNP primer combinations provided by this invention can be used to identify *Triticum aestivum* germplasm resources and varieties, and have significant application value in clarifying the genetic background and variety rights of *Triticum aestivum* resources during agricultural production and variety breeding. Simultaneously, they can be used for identifying the kinship of individual *Triticum aestivum* germplasm resources, providing effective gene resources and molecular markers for *Triticum aestivum* genetic diversity research, core germplasm construction, and breeding population selection. This invention overcomes the gap in molecular research on *Triticum aestivum* lacking KASP-SNP molecular markers, and solves the problems of cumbersome and time-consuming operations, limited number of markers, difficulty in data integration, and inability to achieve accurate large-scale detection using current markers such as AFLP, ISSR, SSR, and SRAP. It achieves fully automated data reading in the identification of *Triticum aestivum* resources, improving the accuracy and efficiency of results, and avoiding cross-contamination and false positives. The method provided by this invention has advantages such as high throughput, accuracy, low cost, simple operation, and saving manpower and resources, and has a very broad application prospect. Attached Figure Description

[0038] Figure 1 This is a genotyping diagram of 60 *Eriocheir sinensis* germplasm populations detected by the KASP molecular markers of this invention.

[0039] In the figure, the markings are as follows: ■ indicates that the proportion of FAM fluorescence on the horizontal axis is relatively high, which is homozygous type 1; ▲ indicates that the proportion of VIC fluorescence on the vertical axis is relatively high, which is homozygous type 2; ● indicates that the proportions of the two fluorescence types in the middle area are equal, which is heterozygous type; ★ indicates negative control (NTC); × indicates undetectable sample.

[0040] Figure 2 Phylogenetic trees were constructed for 60 *Ophiopogon japonicus* germplasms based on KASP marker genotyping results. Detailed Implementation

[0041] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0043] Example 1: SNP sites and KASP primer combinations used to identify *Eriocheir sinensis* resources.

[0044] This invention is based on whole-genome resequencing data from 90 *Aegilops spp.* germplasm from the Qinghai-Tibet Plateau, Northeast, Northwest, and North China, as well as Russia and Mongolia. These 90 *Aegilops spp.* resources cover the main distribution areas of wild *Aegilops spp.* and represent broad genetic diversity. The genomes were compared with the *Aegilops spp.* reference genome, Chuancao 2 (assembled by the inventor's research group: https: / / www.biorxiv.org / content / 10.1101 / 2024.04.17.589894v1). A total of 80,148,422 high-quality SNPs were identified; after screening, 31 SNP sites suitable for KASP primer design were obtained, resulting in 31 SNP sites (Table 2).

[0045] Table 2. Basic information of 31 SNP sites

[0046]

[0047]

[0048] The specific method is as follows:

[0049] 1. Screening of core SNP sites

[0050] Based on whole-genome resequencing data from 90 *Aegilops spp.* germplasm from the Qinghai-Tibet Plateau, Northeast, Northwest, and North China, as well as Russia and Mongolia, these 90 *Aegilops spp.* resources cover the main distribution areas of wild *Aegilops spp.* and represent broad genetic diversity. A total of 80,148,422 high-quality SNPs were identified. These were aligned to the reference genome of *Aegilops spp.* var. *Chuancao 2* using the BWA (Burrows-Wheeler Aligner) software, and high-quality SNPs were further identified using the GATK (Genome Analysis Toolkit). The selection criteria were as follows:

[0051] (1) Specificity: To ensure that the selected SNP markers have high specificity, 200 bp of the sequence upstream and downstream of each SNP were extracted, for a total of 401 bp. Then, BLAST (Basic Local Alignment Search Tool) alignment was performed, and only those SNPs that could be uniquely aligned to the reference genome were retained.

[0052] (2) Uniform distribution and high quality: Based on the premise that SNP markers are uniformly distributed on the 14 chromosomes of *Leymus chinensis*, SNPs without missing genotype data were retained, and SNPs with minor allele frequency (MAF) of less than 20% were removed.

[0053] (3) Polymorphism Information Content (PIC): The PIC value of SNP sites was calculated using a Perl script, and sites with a PIC value less than 0.35 were removed.

[0054] (4) Hardy-Weinberg equilibrium: Using VCFtools software, set the parameters --max-missing 1--maf0.2--hwe 0.01 to retain sites with p-values ​​greater than 0.01 in the Hardy-Weinberg test.

[0055] (5) Uniqueness: Perl scripts were used to screen for SNP sites that had no other site mutations within 100 bp before and after the marker. 52 core SNP sites were screened out.

[0056] 4. KASP-SNP primer design

[0057] For the 52 selected core SNP sites, 200 bp sequences upstream and downstream of the SNPs were extracted to design and develop KASP primers. Two allele-specific primers and one universal primer were designed for each KASP target site. Competitive allele-specific PCR (KASP) was performed using the Bio-Rad CFXConnect™ real-time system, and 31 core SNP sites were successfully converted into KASP markers (Table 1). Each KASP marker primer consists of two forward primers F1 and F2 with different terminal bases and one reverse primer R. The 5' end of the forward primer F1 was fitted with the universal fluorescent tag sequence FAM-tail: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 94), and the 5' end of the forward primer F2 was fitted with the universal fluorescent tag sequence VIC-tail: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 95).

[0058] Example 2: Validation of the KASP-SNP primer combination developed in Example 1, and construction of a DNA fingerprint database of *Triticum aestivum* germplasm based on 31 SNP sites.

[0059] The basic information of the 60 tested *Triticum aestivum* germplasm in this embodiment is shown in Table 3. The 60 tested *Triticum aestivum* germplasm were selected from the Qinghai-Tibet Plateau, Northeast, Northwest and North China, as well as Russia and Mongolia, representing the main distribution areas of wild *Triticum aestivum*.

[0060] Table 3. Basic information of 60 tested *Triticum aestivum* germplasm samples

[0061]

[0062]

[0063]

[0064] Note: QTP Qinghai-Tibet Plateau population, NE Northeast population, NW Northwest population, NC North China population, XJ Xinjiang, GS Gansu, SC Sichuan, QH Qinghai, XZ Tibet, NM Inner Mongolia Autonomous Region, HB Hebei.

[0065] 1. Genomic DNA extraction from the tested *Triticum aestivum* germplasm

[0066] Genomic DNA was extracted from the tested *Leymus chinensis* germplasm using a plant DNA extraction kit (DP350, Tiangen Biotech (Beijing) Co., Ltd.), and the DNA concentration and purity were detected using a NanoDrop2000 UV spectrophotometer (Thermo Fisher Scientific, MA, USA).

[0067] 2. KASP tag verification

[0068] (1) The newly synthesized primers were diluted to 10 μM with TE (pH 8.0), and then mixed in a ratio of forward typing primer F1: forward typing primer F2: downstream universal primer = 1:1:3 before being loaded into the instrument. 1.25 μL of primer mixture was added to every 5 μL of reaction system.

[0069] (2) DNA sample dilution and addition: The genomic DNA samples of the tested Old Mango germplasm were diluted in batches according to the lowest concentration sample dilution ratio to single digits, with each 5 μL reaction system containing 1.25 μL of diluted DNA sample.

[0070] (3) Construction of PCR reaction system (96-well plate) is shown in Table 4;

[0071] Table 4 PCR reaction system

[0072] reagents 5μL reaction system 2*KASPmastermix 2.5μL Mixed primers 1.25μL DNA template 1.25μL water 0μL total 5μL

[0073] (4) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is mixed evenly.

[0074] (5) After centrifugation, PCR amplification was performed. The amplification program is shown in Table 5.

[0075] Table 5 PCR amplification program

[0076]

[0077] (6) If the typing results are not ideal, continue amplification. The amplification procedure is shown in Table 6. Check the typing status every 3 cycles until the typing is obvious.

[0078] Table 6 PCR reaction conditions

[0079] step temperature time Cycle number 1 95℃ 20 seconds 3 55℃ 60 seconds

[0080] (7) After completing the above steps, when the temperature of each PCR amplification product drops below 25°C, the fluorescence value is read by scanning the FAM and VIC beams of an ELISA reader. This invention uses an Omega Fluorostar scanner (BMG Labtech, Ortenberg, Germany) to detect the signals of the two fluorescent groups, FAM and VIC, and uses Kluster Caller software (LGC Genomics, Beverly, MA, USA) to analyze the genotyping data.

[0081] The genotypes of each of the 60 tested *Malus baccata* germplasms at each of the 31 SNP loci constitute the standard *Malus baccata* germplasm resource DNA fingerprint database based on the 31 SNP loci of this invention (Table 7). This database can be used to identify whether a *Malus baccata* germplasm with an unknown genetic background belongs to the above 60 tested *Malus baccata* germplasms or to which specific germplasm it belongs.

[0082] The SNP typing results of some primer sets for the tested *Triticum aestivum* germplasm are shown below. Figure 1 .

[0083] The results showed that all 31 primer sets achieved good genotyping results in 60 tested *Triticum aestivum* germplasm accessions. The 60 accessions were classified into three genotypes: those clustered near the X-axis (genotypes linked to the FAM fluorescent tag sequence) and those clustered near the Y-axis (genotypes linked to the VIC fluorescent tag sequence), both homozygous; the two fluorescent groups in the middle region were evenly distributed, indicating heterozygous genotypes; the squares near the origin represented the negative control NTC, which remained clustered together near the base and did not produce fluorescence. Therefore, the primer sets developed in Example 1 can be applied to the identification of *Triticum aestivum* germplasm.

[0084]

[0085]

[0086]

[0087] Example 3: Identification of the germplasm of *Strombus haematocephala* to be tested and its phylogenetic relationship with standard *Strombus haematocephala* germplasm.

[0088] This embodiment provides a method for detecting whether the tested *Laomangmai* germplasm belongs to one of the 60 tested *Laomangmai* germplasms and for identifying its phylogenetic relationship with the standard *Laomangmai* germplasm.

[0089] 1. Genomic DNA extraction from the germplasm of *Triticum aestivum* to be tested

[0090] Following the method in step 1 of Example 2, replace "leaves of the tested old wheat germplasm" with "leaves of the old wheat germplasm to be tested", and keep all other steps unchanged to obtain the genomic DNA of the old wheat germplasm to be tested.

[0091] 2. Preparation of SNP primers and PCR reaction system

[0092] Following the method in step 2 of Example 2, replace "genomic DNA of the tested *Malus baccata* germplasm" with "genomic DNA of the *Malus baccata* germplasm to be tested," while keeping all other steps unchanged, to obtain the PCR product of the *Malus baccata* germplasm to be tested.

[0093] 3. Fluorescence signal detection

[0094] The PCR products of the tested *Eriocheir sinensis* germplasm were analyzed for fluorescence signals, and the genotypes of 31 SNP sites were obtained.

[0095] The genotypes of 31 SNP loci in the tested *Brassica rapa* germplasm were compared with the genotypes of 31 SNP loci in 60 tested *Brassica rapa* germplasm accessions (Table 7). The number of differentially expressed SNP loci between the tested *Brassica rapa* germplasm and the 60 standard *Brassica rapa* germplasm accessions was counted, and then the following judgments were made:

[0096] If the number of different loci between the tested *Lycium barbarum* germplasm and a certain standard *Lycium barbarum* germplasm is two or more, then the tested *Lycium barbarum* germplasm and the standard *Lycium barbarum* germplasm belong to different *Lycium barbarum* germplasms; the more different loci, the more distant the genetic relationship.

[0097] If the number of differentiating sites between the tested *Agrostis stenoptera* germplasm and a certain standard *Agrostis stenoptera* germplasm is 1 or 0, then the tested *Agrostis stenoptera* germplasm and the standard *Agrostis stenoptera* germplasm are or are suspected to be the same *Agrostis stenoptera* germplasm.

[0098] Furthermore, if the tested *Lao Mang Mai* germplasm is not any of the standard *Lao Mang Mai* germplasm in the aforementioned DNA fingerprint database, the phylogenetic relationship between the tested *Lao Mang Mai* germplasm and the standard *Lao Mang Mai* germplasm can be identified. The specific method is as follows: Based on the genotyping results of the tested *Lao Mang Mai* germplasm and the standard *Lao Mang Mai* germplasm in the DNA fingerprint database, the distance matrix between individuals is calculated using MEGAX software based on SNPs, and a phylogenetic tree is constructed using the neighbor-joining method. Figure 2 The population was subjected to 1000 bootstrap replicates. The population structure was analyzed using Admixture software (v1.3.0). The phylogenetic relationship between the tested *Lactuca indica* germplasm and the standard *Lactuca indica* germplasm was determined based on genetic distance and clustering results in the phylogenetic tree. The smaller the genetic distance between the tested *Lactuca indica* germplasm and a given standard *Lactuca indica*, the closer the phylogenetic relationship, and the more clearly they cluster together in the phylogenetic tree; conversely, the greater the genetic distance, the more distant the phylogenetic relationship.

[0099] Furthermore, materials needed for germplasm research on *Agrostis stenoptera* can be screened based on the aforementioned kinship relationships, such as: core germplasm construction, breeding population selection, and genetic diversity research.

[0100] The above detailed description of the present invention is for illustrative purposes only and is not intended to limit the technical solutions described in the embodiments of the present invention. Those skilled in the art should understand that modifications or equivalent substitutions can still be made to the present invention to achieve the same technical effect; as long as the usage needs are met, they are all within the protection scope of the present invention.

Claims

1. A primer combination of KASP markers for the identification of *Triticum aestivum* germplasm resources, characterized in that, The primer combination was used to amplify 31 SNP sites, the basic information of which is shown in the table below: Basic information of 31 SNP loci ; The primer combination is a KASP-SNP primer combination, and the nucleotide sequence of the primers in the primer combination is shown in SEQ ID NO. 1-93. It is used to amplify the 31 SNP sites, wherein each KASP-SNP primer combination consists of a first forward primer, a second forward primer and a reverse primer.

2. The primer combination according to claim 1, characterized in that, The 5' ends of the specific portions of the first and second forward primers in each primer set are connected to different universal fluorescent tag adapter sequences.

3. The primer combination according to claim 2, characterized in that, The universal fluorescent tag connector sequence is shown in SEQ ID NO. 94-95.

4. A reagent kit, characterized in that, It includes the primer combination as described in any one of claims 1 to 3.

5. The reagent kit according to claim 4, characterized in that, The kit also includes reagents for competitive allele-specific PCR.

6. The application of the primer combination according to any one of claims 1-3, characterized in that, Application of the primer combination according to any one of claims 1-3 in any of the following aspects: (1) Construct a standard DNA fingerprint database of old wheat germplasm resources; (2) Constructing a phylogenetic tree of *Ophiopogon japonicus* germplasm resources; (3) Construct a standard old mango germplasm resource DNA fingerprint database and identify the old mango germplasm to be tested and its phylogenetic relationship with the standard old mango germplasm in high throughput.

7. A high-throughput method for identifying germplasm of *Triticum aestivum*, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the wheat species to be tested; (2) Using the genomic DNA from step (1) as a template, competitive allele-specific PCR is performed using the primer combination described in claim 1 or the kit described in claim 4 to obtain the amplification product; (3) Analyze the fluorescence signal of the amplification product, and determine the genotype of the 1st to 31st SNP sites in the genome of the test wheat based on the fluorescence signal of the amplification product obtained by each KASP-SNP primer set. (4) Compare the genotyping results of the 1st to 31st SNP sites in the genome of the wheat germplasm to be tested obtained in step (3) with the genotyping results of the 1st to 31st SNP sites in the genome of each standard wheat germplasm in the DNA fingerprint database. If the number of different SNP sites between the wheat germplasm to be tested and a certain standard wheat germplasm is 2 or more, it is determined that the wheat germplasm to be tested does not belong to the standard wheat germplasm. If the number of different SNP sites between the wheat germplasm to be tested and a certain standard wheat germplasm is 0 or 1, it is determined that the wheat germplasm to be tested belongs to the standard wheat germplasm or is suspected to be the standard wheat germplasm.

Citation Information

Patent Citations

  • E.sibiricus seed authenticity identification specific molecular marker kit and detection method for same

    CN103789423A

  • Single-site SSR primer group developed on basis of genomic sequence of elymus sibiricus L. and application of primer group

    CN110106279A