A metal-DNA aptamer self-assembly nanomaterial and its preparation method and application

Abstract

The present invention relates to the technical field of functional materials, and in particular to a metal-DNA aptamer self-assembly nanomaterial, a preparation method and an application thereof. The metal-DNA aptamer self-assembly nanomaterial comprises two DNA aptamers respectively modified with an azide group and an alkynyl group, a copper source and ascorbic acid; copper is coordinated with the five-membered ring formed by the reaction through a copper-catalyzed azide-alkynyl cycloaddition reaction, thereby obtaining a Cu-DNA aptamer self-assembly nanomaterial. The present invention solves the problem that the existing metal-DNA self-assembly nanomaterial cannot exist stably in a physiological environment, and at the same time, by targeting and accurately identifying tumor cells, it realizes its application in chemodynamic therapy of tumors.

Description

Technical Field

[0001] The present invention relates to the technical field of functional materials, and in particular to a metal-DNA aptamer self-assembly nano material and a preparation method and application thereof. Background Art

[0002] Chemodynamic therapy (CDT) is a treatment method that converts hydrogen peroxide into reactive oxygen species through the Fenton / Fenton-like reaction. Most reactive oxygen species are hydroxyl free radicals, which can induce cell apoptosis and necrosis. It has been widely used in tumor treatment.

[0003] At present, nanomaterials based on metal-DNA self-assembly have poor stability and cannot exist stably in a physiological environment. Therefore, metal-DNA self-assembly materials cannot achieve effective treatment during tumor treatment. In order to improve the stability of metal-DNA and achieve good tumor treatment effects, it is usually necessary to coat it to maintain its stability. The coating materials are mostly polyethylene glycol (PEG), cell membranes, etc. However, since the coating process may damage the material or the encapsulation rate is incomplete, it is easy to cause the metal-DNA to disintegrate before reaching the tumor cells, and the expected treatment effect cannot be achieved. Summary of the invention

[0004] The present invention provides a metal-DNA aptamer self-assembled nanomaterial and a preparation method and application thereof, which solves the problem that the existing metal-DNA self-assembled nanomaterial cannot stably exist in PBS (pH=7.2), and at the same time realizes its application in chemodynamic treatment of tumors by targeted and precise identification of tumor cells.

[0005] One of the technical solutions adopted by the present invention is:

[0006] A metal-DNA aptamer self-assembly nanomaterial is provided, including two DNA aptamers modified with an azide group and an alkynyl group respectively, and a copper source and ascorbic acid necessary for a click reaction; copper is coordinated with the five-membered ring formed by the reaction through a copper-catalyzed azide-alkynyl cycloaddition reaction, thereby obtaining a Cu-DNA aptamer self-assembly nanomaterial. The Cu-DNA aptamer after the coordination has strong stability and exists stably before reaching tumor cells. After entering tumor cells, the acidic microenvironment of the tumor induces its degradation, and based on the chemical dynamic effect of copper ions, the therapeutic effect on tumor cells is achieved.

[0007] Furthermore, the copper source is cuprous chloride. Monovalent copper ions are not only catalysts for click reactions, but also coordinating metal elements after click reactions.

[0008] Furthermore, the DNA aptamer sequence is a DNA sequence of mouse breast cancer cells (4T1), as shown in the following SEQ ID No 1:

[0009] 5'-ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCCCTAGTATGAGCGAGCGTTGCG-3';

[0010] The following two DNA aptamer sequences were obtained by modifying the 5' end of the DNA aptamer sequence with an alkynyl group and the 3' end with an azide group:

[0011] CHCH-ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGAT

[0012] GGTCCCTAGTATGAGCGAGCGTTGCG

[0013] ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCCCTAGTATGAGCGAGCGTTGCG-N3.

[0014] Furthermore, the concentration ratio of the alkynyl-modified DNA aptamer to the azide-modified DNA aptamer is 1:1-1:1.5, the molar ratio of cuprous chloride to the DNA aptamer is 1:1-1:1.3; and the molar ratio of cuprous chloride to ascorbic acid is 1:1-1:1.3.

[0015] Furthermore, the concentration ratio of the alkynyl-modified DNA aptamer to the azide-modified DNA aptamer is 1:1.2; the molar ratio of cuprous chloride to the DNA aptamer is 1:1; and the molar ratio of cuprous chloride to ascorbic acid is 1:1.2.

[0016] Furthermore, the particle size of the Cu-DNA aptamer self-assembled nanomaterial is 150-220 nm, preferably 180 nm.

[0017] The second technical solution adopted by the present invention is:

[0018] Provided is a method for preparing the Cu-DNA aptamer self-assembly nanomaterial, comprising the steps of mixing and stirring azide-modified and alkynyl-modified DNA aptamers, cuprous chloride and ascorbic acid, and incubating the mixture.

[0019] Furthermore, the reaction temperature is 20-30° C., the reaction time is 10-14 h, and the stirring speed is 600-700 rpm.

[0020] Furthermore, the reaction temperature is 25° C., the reaction time is 12 h, and the stirring speed is 650 rpm.

[0021] Furthermore, during the preparation process, the two modified DNA aptamer solutions are first mixed, and then the cuprous chloride solution and the ascorbic acid solution are mixed, and then the two mixed solutions are mixed.

[0022] Furthermore, the preparation method further comprises the step of solid-liquid separation of the obtained product system, specifically, washing the obtained solid product with deionized water and centrifuging to obtain the product.

[0023] Furthermore, the above preparation method adopts the following steps:

[0024] S1. Prepare the modified 4T1 sequence DNA solution, cuprous chloride solution and ascorbic acid solution according to the required amount and set aside;

[0025] S2. Add the ascorbic acid solution to the cuprous chloride solution, mix well, then add the mixture to the prepared mixed DNA solution, put in a magnetic bar, stir at a speed of 650 rpm for 12 hours, and centrifuge and wash to obtain the Cu-DNA self-assembled nanomaterial.

[0026] The third technical solution adopted by the present invention is:

[0027] Provided is the use of the aforementioned metal-DNA aptamer self-assembled nanomaterial in the preparation of anti-tumor drugs, wherein the tumor includes but is not limited to breast cancer.

[0028] Furthermore, the metal-DNA aptamer self-assembled nanomaterial has the characteristics of pH response, exists stably before reaching tumor cells, and degrades after entering tumor cells. Copper ions use excess H2O2 in tumor cells to produce hydroxyl radicals that are toxic to tumor cells, induce tumor cell apoptosis and kill tumor cells.

[0029] Beneficial effects of the present invention:

[0030] The Cu-DNA aptamer self-assembly nanomaterial of the present invention combines two segments of 4T1 aptamer DNA by a click reaction, and then combines with metal by coordination, so that the obtained product has strong stability. Since the DNA sequence and materials used are rich in copper ions, the Cu-DNA aptamer self-assembly nanomaterial has a targeting effect after synthesis, and can accurately identify tumor cells. The copper ions in the above process are not only a catalyst for the click reaction, but also a metal element provider for the coordination reaction, so that the reaction process is simplified, and the stability problem of the existing metal-DNA self-assembly nanomaterial can be improved.

[0031] Due to the Fenton-like effect of copper ions themselves, after Cu-DNA reaches tumor cells, copper ions can use the excess H2O2 in tumor cells to produce hydroxyl radicals that are toxic to tumor cells. Therefore, the Cu-DNA aptamer self-assembled nanomaterial provided by the present invention can not only improve the stability of the original material, simplify the reaction process, and give the material targeting and magnetic resonance capabilities, but also has a good anti-tumor effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 TEM image of Cu-DNA obtained in Example 2 (click reaction involved);

[0033] Figure 2 TEM image of Cu-DNA obtained in Example 3 (without click reaction);

[0034] Figure 3 TEM images of Cu-DNA obtained in Example 3 (Cu-DNA without click reaction in PBS (pH=7.2) at different time periods);

[0035] Figure 4 TEM images of Cu-DNA obtained in Example 2 (Cu-DNA involved in click reaction in PBS (pH=7.2) at different time periods);

[0036] Figure 5 The UV-visible absorption results of Cu-DNA obtained in Example 2;

[0037] Figure 6 This is a fluorescence image of active oxygen detection of Cu-DNA of the present invention;

[0038] Figure 7 is the cell survival rate of the Cu-DNA of the present invention;

[0039] Figure 8 The targeted killing effect of the Cu-DNA of the present invention on tumor cells is detected by laser confocal microscopy on live and dead cell staining imaging. DETAILED DESCRIPTION

[0040] In order to clearly illustrate the technical features of the present invention, the present invention is described in detail below through specific implementation methods in conjunction with the accompanying drawings.

[0041] In the present invention, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are all conventional methods in the art unless otherwise specified.

[0042] Example 1

[0043] A Cu-DNA aptamer self-assembly nanomaterial includes two DNA sequences (such as SEQ ID No. 1) with mouse breast cancer cells (4T1), an azide group and an alkynyl group are modified on each DNA chain, and cuprous chloride and ascorbic acid are necessary for click reaction. The copper element is coordinated with the five-membered ring formed by the click reaction through the click reaction, and the coordinated Cu-DNA has strong stability and pH response characteristics, and is stable before reaching tumor cells and degraded after entering tumor cells.

[0044] The particle size of the Cu-DNA aptamer self-assembled nanomaterial is 180 nm.

[0045] SEQ ID No1:

[0046] 5'-ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCCCTAGTATGAGCGAGCGTTGCG-3'.

[0047] Example 2

[0048] The method for preparing the Cu-DNA aptamer self-assembly nanomaterial as described in Example 1 comprises the following steps:

[0049] 540 μL 25 μM modified 4T1 sequence (SEQ ID No1) DNA solution, 20 mM 30 μL cuprous chloride solution and 20 mM 30 μL ascorbic acid solution were prepared separately for use, and the solvent was deionized water. The ascorbic acid solution was added to the cuprous chloride solution, and after mixing evenly, the mixture was added to the prepared DNA solution, and a magnetic device was placed in the mixture at a rotation speed of 650 rpm for 12 hours, and the mixture was centrifuged and washed to obtain a Cu-DNA self-assembled nanocomposite material.

[0050] Example 3

[0051] Refer to the preparation process of Example 2, except that the modified 4T1 sequence DNA solution is replaced with an unmodified 4T1 sequence DNA solution, and the above experimental steps are repeated to prepare a Cu-DNA self-assembled nanocomposite material without click reaction.

[0052] Take an appropriate amount of the Cu-DNA aptamer self-assembled nanomaterial with click reaction in Example 2 and disperse it in water, and completely disperse it by ultrasound to obtain a Cu-DNA aqueous dispersion; take a small amount of the Cu-DNA aqueous dispersion and drop it on a copper mesh, and characterize the morphology and size of the Cu-DNA by transmission electron microscopy (TEM). The obtained TEM image is as follows: Figure 1 As shown. Figure 1 It can be seen that the particle size of Cu-DNA is around 180 nm.

[0053] Repeat the above steps and observe the morphology and size of the Cu-DNA self-assembled nanocomposite material without click reaction in Example 3 by TEM. Figure 2 As shown. Figure 2 It can be seen that the particle size of Cu-DNA is around 180 nm.

[0054] At the same time, the stability of the Cu-DNA self-assembled nanocomposites with and without click reaction was verified by TEM, such as Figure 3 As shown. The Cu-DNA self-assembled nanocomposite without the participation of click reaction was cleaved in two hours, indicating that the Cu-DNA self-assembled nanocomposite without the participation of click reaction had poor stability in PBS (pH = 7.2); Figure 4 As shown, the Cu-DNA self-assembled nanocomposite material with click reaction has good stability in PBS (pH=7.2) and still has a stable morphology after 4 hours.

[0055] The Cu-DNA aptamer self-assembled nanomaterial of Example 2 was subjected to an ultraviolet absorption test, and the obtained ultraviolet absorption results are as follows: Figure 5 As shown. Figure 5 It can be seen that Cu-DNA has ultraviolet absorption at 263nm. After the reaction, the ultraviolet absorption value of the DNA solution decreased significantly, and the absorption peaks of the DNA solution and Cu-DNA were both around 260nm. The presence of Cu caused the peak of Cu-DNA to slightly red-shift, indicating that Cu and DNA were successfully coordinated.

[0056] 1. Detection of reactive oxygen species produced by self-assembled nanomaterials of Cu-DNA aptamers

[0057] Since the DCFH-DA dye itself does not have fluorescence, it will be oxidized into 2',7'-dichlorofluorescein (DCF) with green fluorescence when it reacts with reactive oxygen species (ROS). Therefore, the DCFH-DA dye is used to detect the reactive oxygen generation performance of the Cu-DNA aptamer self-assembled nanomaterial of Example 2 of the present invention.

[0058] The DCFH-DA aqueous solution, the material (Cu-DNA aptamer self-assembled nanomaterial) aqueous dispersion and the H2O2 solution were added to 1 mL of water according to the grouping conditions, so that the final concentrations of DCFH, material and H2O2 were 10 mM, 20 μg / mL and 2 mM respectively, and the fluorescence spectrophotometer was used for detection after 5 minutes (Ex = 488 nm, Em = 525 nm). The grouping conditions are: DCFH + H2O2, DCFH + H2O2 + Cu-DNA, DCFH + Cu-DNA, H2O2 + Cu-DNA.

[0059] The results of active oxygen detection are as follows Figure 6As shown, only DCFH+H2O2+Cu-DNA produces a strong fluorescence intensity, which is Cu + The active oxygen generated by catalyzing H2O2 reacts with the DCFH-DA dye, so the Cu-DNA aptamer self-assembled nanomaterial of the present invention has good performance of generating active oxygen.

[0060] 2. Cu-DNA aptamer self-assembled nanomaterials kill tumor cells and cell imaging

[0061] 2.1. The chemical name of CCK-8 is 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid benzene)-2H-tetrazole monosodium salt. The amount of formazan generated by the reaction with substances in living cells is proportional to the number of living cells. The light absorption value is measured at a wavelength of 450nm using an enzyme-linked immunosorbent assay, which can indirectly reflect the number of living cells.

[0062] The cytotoxicity of the Cu-DNA aptamer self-assembled nanomaterials prepared in the embodiment of the present invention to normal human liver cells (LO2) and mouse breast cancer cells (4T1 cells) was studied by CCK-8. The cell experiments were all carried out in a clean bench after ultraviolet light illumination and alcohol wiping, and the cells were cultured in a fully sterilized incubator. Specifically, the cells were incubated in a complete culture medium (containing 10% fetal bovine serum FBS, 1% double-resistance penicillin-streptomycin, DMEM culture medium), and when the cells grew to 70% of the culture dish, they were digested with trypsin, and the cells were inoculated in 96-well cell culture plates for incubation, with about 10,000 cells per well; after incubation for 4 hours, they were washed twice with PBS, 10 μL CCK-8 solution and 90 μL complete culture medium solution were added, and the absorbance value of the solution at 450nm was detected with an ELISA instrument to calculate the cell survival rate.

[0063] Cell survival rate (%) = (A test -A0 / A control -A0)×100%. In the formula, “A test , A0, A control ” represent the absorbance of the experimental wells containing cells and nanoparticles, the blank wells without nanoparticles and cells, and the control wells containing cells but without nanoparticles, respectively.

[0064] The cell survival rate of Cu-DNA group was Figure 7 As shown. Figure 7It can be seen that the survival rate of LO2 cells incubated with Cu-DNA aptamer self-assembled nanomaterials is relatively high, at about 80%, while the survival rate of 4T1 cells is only about 20%. Due to the nanometer size of Cu-DNA and its unique targeting properties, it cannot enter LO2 cells but can specifically enter 4T1 cells. Therefore, the survival rate of LO2 cells is much greater than that of 4T1 cells. The main reason for cell death is that the Cu-DNA aptamer self-assembled nanomaterials and hydrogen peroxide in the tumor undergo a Fenton-like reaction to induce cell apoptosis.

[0065] 2.2. The targeted killing effect of the Cu-DNA aptamer self-assembled nanomaterial on tumor cells was further detected by laser confocal microscopy. In order to increase the contrast effect, a human lung adenocarcinoma cell line (A549) was added. 2 mL of complete culture medium containing 4T1, A549, and LO2 cells was inoculated into different 6-well cell culture plates, with 2×10 cells per well. 5 cells and incubated them in a cell culture incubator for 24 hours. Wash each well three times with PBS, and then add complete culture medium containing Cu-DNA for incubation. After 4 hours of co-incubation, collect the complete culture medium in each well, and wash the 6-well cell culture plate with PBS and collect for later use. Use trypsin to digest the cells, collect the complete culture medium, PBS and trypsin-digested cells, wash them 3 times with PBS buffer, and then add Calcein-AM / PI double staining solution for live and dead cell staining. After incubation in a cell culture incubator for 20 minutes, use a laser confocal microscope to image the cells. The entire process is carried out under light-proof conditions. Live cells appear green and dead cells appear red, which further evaluates the toxicity of the material. The results of laser confocal imaging of live and dead cell staining are shown in the figure. Figure 8 As shown by Figure 8 It can be seen that the killing effect of the Cu-DNA aptamer self-assembled nanomaterial on tumors is similar to the results of the cytotoxicity test, which further verifies that it can effectively inhibit the growth of breast cancer tumor cells.

[0066] The above is a detailed introduction to the Cu-DNA aptamer self-assembly nanomaterial provided by the present invention, its preparation method and application. The above specific implementation cannot be used as a limitation to the protection scope of the present invention. For those skilled in the art, any replacement, improvement or change made to the implementation of the present invention falls within the protection scope of the present invention.

[0067] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

Claims

1. A metal-DNA aptamer self-assembled nanomaterial, characterized in that: The method comprises two DNA aptamers modified with an azide group and an alkynyl group, a copper source and ascorbic acid respectively; copper is coordinated with the five-membered ring formed by the reaction through a copper-catalyzed azide-alkynyl cycloaddition reaction, thereby obtaining a Cu-DNA aptamer self-assembled nanomaterial; The copper source is cuprous chloride; The DNA aptamer sequence is shown in SEQ ID No 1: 5'-ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCCCT AGTATGAGCGAGCGTTGCG-3'; The following two DNA aptamer sequences were obtained by modifying the 5' end of the aptamer sequence with an alkynyl group and the 3' end with an azide group: CHCH-ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCCCTAGTATGAGCGAGCGTTGCG ACCGACCGTGCTGGACTCTACATAGTCCTCACTCTAAACGATGGTCC CTAGTATGAGCGAGCGTTGCG-N3; The preparation of the Cu-DNA aptamer self-assembly nanomaterial comprises: preparing 540 μL of a 25 μM modified DNA aptamer solution, 20 mM 30 μL of a cuprous chloride solution and 20 mM 30 μL of an ascorbic acid solution respectively, wherein the solvent is deionized water; adding the ascorbic acid solution to the cuprous chloride solution, mixing well, and then adding the mixed solution to the prepared DNA solution.

2. The metal-DNA aptamer self-assembled nanomaterial according to claim 1, characterized in that: The particle size of the Cu-DNA aptamer self-assembled nanomaterial is 150-200nm.

3. A method for preparing the metal-DNA aptamer self-assembled nanomaterial as claimed in claim 1 or 2, characterized in that: The method comprises the steps of mixing and stirring azide-modified and alkyne-modified DNA aptamers, a copper source and ascorbic acid, and then incubating the mixture.

4. The preparation method according to claim 3, characterized in that: The reaction temperature is 20-30°C, the reaction time is 10-14h, and the stirring speed is 600-700rpm.

5. Use of the metal-DNA aptamer self-assembled nanomaterial as claimed in claim 1 or 2 in the preparation of anti-breast cancer drugs.

Images