Bionic MOFs (Metal-Organic Frameworks) based on erythrocytes as well as preparation method and application thereof

Abstract

The invention discloses bionic MOFs of red blood cells as well as a preparation method and application of the bionic MOFs, and belongs to the technical field of biological materials. Comprising drug-loaded MOFs and an erythrocyte membrane layer coated outside the MOFs, the MOFs is selected from the group consisting of UiO-66-NH2; the UiO-66-NH2 is a particle formed by connecting an amino functional group to UiO-66; a dual epigenetic drug is loaded in the drug-loaded MOFs; and the dual epigenetic drugs are CM272 and MA. By targeting three epigenetic modifications and simultaneously regulating and controlling DNA methylation, histone methylation and RNA methylation in leukemia cells, the immune response aiming at acute myelogenous leukemia is enhanced, the hypoxia microenvironment of leukemia is overcome by using the bionic MOFs particles, the therapeutic activity of the loaded medicine is enhanced, and the application prospect is broad. And inducing death of leukemia cells and leukemia cell mesenchymal stem cells.

Description

Technical Field

[0001] The present application relates to a bionic MOFs of red blood cells and a preparation method and application thereof, belonging to the technical field of biomaterials. Background Art

[0002] Acute myeloid leukemia (AML) is the most common hematological malignancy in pediatric patients. Standard chemotherapy often has limited efficacy, especially in elderly or high-risk patients, and is also accompanied by significant toxicity. There are few effective salvage options for relapsed or refractory cases, and the genetic heterogeneity of the disease complicates the development of targeted therapies. New treatment strategies, including targeted and immunotherapies, are urgently needed to improve efficacy and reduce treatment-related complications.

[0003] Epigenetic modifications affect gene expression patterns without changing the underlying DNA sequence. Dysregulation of epigenetic mechanisms, including DNA methylation, histone modifications, and RNA methylation, can lead to leukemia by repressing tumor suppressor genes and activating oncogenes that are critical for leukemic transformation and disease progression. Aberrant DNA methylation and histone modifications are frequently observed in acute myeloid leukemia cells. Increased methylation of histone H3 lysine 9 (H3K9) or DNA methylation (5-methylcytosine, 5mC) within the promoter region of tumor suppressor genes leads to transcriptional silencing, thereby enhancing the survival and proliferation of leukemic cells. In addition, altered N6-methyladenosine (m6A) modifications of mRNA transcripts encoding oncogenes, tumor suppressors, transcription factors, and signaling molecules disrupt normal RNA processing, leading to the malignant phenotype of acute myeloid leukemia cells. Abnormal gene expression patterns are further exacerbated by dysregulated expression or activity of m6A regulators, especially writers and erasers. In conclusion, dysregulated m6A methylation in AML disrupts normal hematopoietic differentiation and promotes the expansion of LSCs, leading to increased malignancy and therapeutic resistance.

[0004] Therapies targeting epigenetic alterations, also called “epigenetic therapies” (or epitherapies), can reverse abnormal gene expression patterns and restore normal cellular function. 6Drugs targeting A-RNA methylation have shown promising results in preclinical and clinical studies, improving treatment outcomes and patient survival, either as a single agent or in combination with standard chemotherapy. ORY-1001 is an inhibitor of the lysine-specific histone demethylase KDM1A, which induces H3K4me2 accumulation on KDM1A target genes, leading to blast differentiation and a reduction in LSCs. CM272 is a dual inhibitor of histone methyltransferases G9a and DNMT1, which inhibits cancer cell proliferation and promotes apoptosis in AML and other hematological tumors. In addition, CM272 can induce immune cell death (ICD), thereby releasing damage-associated molecular patterns (DAMPs) including ATP, HMGB-1, and CRT, leading to dendritic cell (DC) maturation and increasing antigen processing and presentation by CD8+ T cells. In addition, the complex interactions between epigenetic changes in acute myeloid leukemia and other molecular abnormalities need to be elucidated to identify new therapeutic targets and overcome drug resistance.

[0005] Nanoparticles have significant advantages in cancer therapy, such as targeted drug delivery to tumor cells, improved drug solubility and controlled release, improved drug accessibility across biological barriers, precise imaging and diagnosis, personalized treatment strategies, the ability to support combination therapy approaches, and good biocompatibility and biodegradability. Autonomous therapeutic nanomaterials or nanocarriers loaded with epigenetic drugs such as enzyme inhibitors, siRNA, and microRNA can target factors and signaling pathways associated with epigenetic signals, thereby achieving multifunctional cancer therapy. For example, MA-loaded glutathione (GSH)-imprinted nanoparticles (GNCIPP8MA) were designed and synthesized, which can specifically target LSCs and deplete intracellular GSH. GNCIPP8MA can induce iron allergy and m 6 A-RNA methylation enhances the anti-leukemia immune response driven by PD-L1 blockade. Gold nanocomplexes loaded with anti-leukemia nucleotides AS1411 and miR-221 were synthesized, which selectively targeted AML cells and inhibited leukemia progression by inhibiting the DNMT1-mediated DNA methylation signaling pathway in the nucleus.

[0006] Cell membrane biomimetic nanoparticles provide a versatile platform for various biomedical applications such as personalized medicine, cancer treatment, vaccination, and regenerative medicine. These nanoparticles are composed of lipid bilayer membranes or membrane-derived vesicles and thus mimic the properties of cell membranes as well as the composition of surface proteins and lipids. Such biomimetic designs can not only improve biocompatibility and reduce immunogenicity but also enable efficient and targeted drug delivery, immune evasion, and regulation of biological interactions. Our research group previously developed a nanocomposite by hybridizing CuS / carbon dots with macrophage membranes (CuSCDB@MMT7) and added proteasome inhibitors to the particles. CuSCDB@MMT7 showed tumor selectivity while evading immune detection and could induce hyperthermia under near-infrared light, leading to the accumulation of thermostable polyubiquitinated tumor suppressor proteins. CuSCDB@MMT7-induced photothermal therapy enhanced tumor cell apoptosis and reduced metastasis. Recently, Mn-based 2+ / Fe 3+ A LSC biomimetic bimetallic nanoplatform was developed from metal-organic frameworks (MOFs) to target DNA methylation and RNA methylation in acute myeloid leukemia cells. These AFMMB particles enhanced the antigenicity of AML cells by upregulating MHC-I and downregulating PD-L1, leading to recognition and elimination of these cells by cytotoxic T cells. In addition, AFMMB inhibited metastasis in a mouse model of breast cancer, thus establishing its broad antitumor activity.

[0007] Although therapeutic strategies targeting epigenetic dysregulation hold promise for the treatment of leukemia, epigenetic drugs face several limitations, including low utilization, emergence of drug resistance, and off-target effects. In addition, the hypoxic microenvironment of leukemia further affects drug sensitivity. Summary of the invention

[0008] In order to solve the problems of low utilization rate, drug resistance and off-target effects in the existing technologies of epigenetic disorder treatment strategies for treating leukemia, and the hypoxic microenvironment of leukemia further affecting the sensitivity of drugs. The present application provides a bionic MOFs based on red blood cells and its preparation method and application, which targets three epigenetic modifications and simultaneously regulates DNA methylation, histone methylation and RNA methylation in leukemia cells to enhance the immune response against acute myeloid leukemia, and utilizes bionic MOFs particles to overcome the hypoxic microenvironment of leukemia, enhance the therapeutic activity of loaded drugs, and induce the death of leukemia cells and leukemia cell mesenchymal stem cells. In addition, it can not only stimulate T cell-mediated responses, but also stimulate lasting immune memory to prevent leukemia recurrence.

[0009] This application adopts the following technical solutions:

[0010] A bionic MOF based on red blood cells, including drug-loaded MOFs and a red blood cell membrane layer coated on the outside of the MOFs;

[0011] The MOFs are selected from UiO-66-NH2;

[0012] The UiO-66-NH2 is a particle with amino functional groups connected to UiO-66;

[0013] The drug-loaded MOFs are loaded with dual epigenetic drugs;

[0014] The dual epigenetic drugs are CM272 and MA.

[0015] Optionally, the particle size of the drug-loaded MOFs is 140 to 160 nm.

[0016] According to another aspect of the present application, a method for preparing the above-mentioned red blood cell-based bionic MOFs is provided, comprising the following steps:

[0017] S1, obtaining UiO-66-NH2, and then stirring, separating, washing, and drying a mixed solution of UiO-66-NH2, a dual epigenetic drug, and a solvent to obtain drug-loaded MOFs;

[0018] The dual epigenetic drugs are CM272 and MA;

[0019] S2, obtaining a PBS solution of red blood cells;

[0020] S3. Adding the drug-loaded MOFs to the PBS solution of red blood cells to obtain a mixed solution, and using an extruder to cyclically extrude the mixed solution to obtain the red blood cell-based bionic MOFs.

[0021] Optionally, in step S1, the method for obtaining UiO-66-NH2 includes: adding a zirconium n-propoxide solution to a mixture containing acetic acid and DMF, placing the mixture in a sealed container, heating the reaction, then adding a linker to the product, stirring, separating, washing, and drying to obtain UiO-66-NH2.

[0022] Optionally, the concentration of the zirconium n-propoxide solution is 70 wt %, and the solvent is 1-propanol.

[0023] Optionally, the usage ratio of zirconium n-propoxide solution to acetic acid is 1 μL:53-55 mL.

[0024] Optionally, the usage ratio of zirconium n-propoxide solution to DMF is 1 μL:93-95 mL.

[0025] Optionally, the usage ratio of zirconium n-propoxide solution to the linker is 1 μL: 1.1-1.3 mg.

[0026] Optionally, the linking agent is selected from 1,4-phthalate esters.

[0027] Optionally, the conditions of the heating reaction include: reaction temperature of 120 to 140° C., reaction time of 1 to 3 h;

[0028] Preferably, the stirring conditions include: ultrasonic treatment for 20 to 40 seconds, and then stirring at a rotation speed of 150 to 300 rpm for 16 to 24 hours.

[0029] Optionally, in step S1, in step S1, the weight ratio of UiO-66-NH2 to CM272 is 1:0.025-0.15.

[0030] Optionally, in step S1, the weight ratio of UiO-66-NH2 to MA is 1:0.025-0.15.

[0031] Optionally, in step S1, the solvent is selected from methanol.

[0032] Optionally, in step S2, the method for obtaining the PBS solution of red blood cells includes: placing a mouse blood sample in a container containing an anticoagulant, centrifuging to obtain upper plasma, mixing the upper plasma with a PBS solution, and centrifuging to obtain the PBS solution of red blood cells.

[0033] Optionally, the dosage ratio of drug-loaded MOFs to red blood cells is 1 mg: 0.15×10 7 ~0.25×10 7 indivual.

[0034] According to another aspect of the present application, there is also provided a use of the above-mentioned red blood cell-based bionic MOFs or the red blood cell-based bionic MOFs obtained according to the above-mentioned preparation method as a triple epigenetic regulator in the preparation of drugs for enhancing anti-leukemia immunity.

[0035] Optionally, the triple epigenetic regulator is directed against 5mC DNA methylation, m 6 A-Epigenetic regulators that regulate RNA methylation and histone H3K9 methylation.

[0036] The beneficial effects of this application include:

[0037] The red blood cell-based bionic MOFs (MA272@MOF@RBC) provided in this application enhance leukemia immunotherapy by adding CM272, MA and oxygen-enriched red blood cells to MOFs, have good biocompatibility, can prolong blood circulation, escape clearance by the immune system, relieve hypoxia, inhibit the downstream oncogenes of HIF-1α, and thus improve the efficacy of epigenetic drugs, which inhibit DNA and histone methylation and enhance m6 A-RNA methylation limits the growth of leukemia. In addition, MA272@MOF@RBC can also induce ICD and increase the antigenicity of AML cells by upregulating MHC-I and downregulating PD-L1, so that the activated cytotoxic T cells can recognize and eliminate LSCs in the bone marrow niche. MA272@MOF@RBC can also stimulate long-term immune memory and prevent leukemia recurrence. Finally, MA272@MOF@RBC is also effective against liver tumors. This application reports for the first time the synthesis of a triple epigenetic regulation biomimetic nanoplatform for tumor immunotherapy, which has great clinical potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Preparation and characterization of MA272@MOF@RBC of this application: (A) is a schematic diagram of the synthesis of MA272@MOF; (B) is a TEM image of MA272@MOF; (C) is the hydration particle size of MA272@MOF; (D) is the X-ray diffraction (XRD) analysis of MA272@MOF; (E) is the X-ray photoelectron spectroscopy (XPS) analysis of MA272@MOF; (F) is the C1s peak in the XPS high-resolution spectrum, (G) is the N1s peak, (H) is the O1s peak, and (I) is the Zr 3d peak; (J) is the elemental map of MA272@MOF; (K) is the morphological characteristics of mouse red blood cells shown by Giemsa staining; (L) is a schematic diagram of the preparation of MA272@MOF@RBC; (M) is a photo of the solution containing MA272@MOF and MA272@MOF@RBC; (N) is the Zeta potential of MA272@MOF and MA272@MOF@RBC; (O) is an SDS-PA gel image showing the total protein in MA272@MOF@RBC; (P) is a flow cytometer histogram showing the expression of cell membrane protein CD47 on MA272@MOF@RBC; (Q) is a quantitative analysis of CD47 in (K).

[0039] Figure 2For the present application, MA272@MOF@RBC can selectively target acute myeloid leukemia and leukemia stem cell testing: (A) is a schematic diagram of the synthesis of fluorescently labeled MA272@MOF@RBC; (B) is a confocal image showing the absorption of MA272@MOF@RBC by AML or normal cells, scale bar = 50μm; (C) is a quantitative evaluation of cellular uptake of MA272@MOF@RBC or MA272@MOF by ICP; (D) is a schematic diagram of the establishment of a mouse acute myeloid leukemia model and the in vivo distribution evaluation; (E) is a schematic diagram of MA272@MOF@RBC Distribution in leukemia mice; (F) Fluorescence enrichment detection of MA272@MOF@RBC in the tibia of leukemia mice; (G) Flow cytometry diagram showing the fluorescence signal of MA272@MOF@RBC in LSCs in the mouse bone marrow; (H) Detection of AML cell apoptosis induced by MA272@MOF@RBC; (I) CCK-8 cell proliferation assay to evaluate the effect of MA272@MOF@RBC on AML cell viability, one-way ANOVA and Tukey test, *P<0.05, **P<0.01, ***P<0.001.

[0040] Figure 3 The present invention discloses that MA272@MOF@RBC regulates epigenetic modification of AML cells; (A) is a dot blot or immunoblot showing DNA methylation, histone methylation and RNA methylation in C1498 cells of the specified group; (B) is the transcriptional activity of STING in the specified group; (C) is the IFN-β level in the culture supernatant of the indicated group; (D) is the MHC-I expression of the specified group analyzed by flow cytometry; (E) is the HMGB-1 protein level in the culture supernatant of the indicated group; (F) is the m6A-PD-L1 transcription level in the specified group; (G) is the PD-L1mR in the specified group (H) Flow cytometric quantification of cell surface PD-L1 expression; (I) Immunoblotting showing the expression of HIF-1α in C1498 cells treated with MA272@MOF@RBC or MA272@MOF@LM under CoCl2-induced hypoxia; (J) Transcription level of DNMT3a in the indicated groups; (K) Cell viability of the indicated groups; (L) Schematic diagram of the triple epigenetic regulatory mechanism of MA272@MOF@RBC on AML, one-way ANOVA and Tukey test, *P<0.05, **P<0.01.

[0041] Figure 4In this application, MA272@MOF@RBC inhibits leukemia growth, induces T cell activation and immune memory in vivo; (A) is an acute myeloid leukemia mouse model; (B) is the white blood cell count of each group within 24 days; (C) is the survival curve of mice in the specified group; (D) is the leukemia inhibition rate of the specified group; (E) is Giemsa staining of bone marrow cells, scale bar = 50μm; (F) is the quantitative analysis of leukemia cells in bone marrow cells in E; (G) is a representative image of the spleen (scale bar = 0.5 cm) and HE-stained tissue sections (scale bar = 50μm) of mice in the specified group; (H) is the spleen weight of the specified group; (I) is the LSCs (CD34 + CD38 + ) percentage; (J) is the quantitative detection of MHC-I and (K) PD-L1 expression in leukemia cells by flow cytometry; (L) is the serum HMGB-1 level of the specified group; (M) is the percentage of mature DCs (CD80+CD86+) in the spleen of the specified group; (N) is the percentage of CD8+T cells in the bone marrow of the specified group; (O) is the percentage of effector memory T cells (CD44+CD62L-) in the spleen of the specified group; (P) is the establishment of the leukemia re-challenge model; (Q) is the white blood cell count of the specified group after re-challenge; (R) is the survival curve of leukemia mice after re-challenge; (S) is a schematic diagram of the mechanism of MA272@MOF@RBC activating T cells; one-way analysis of variance and Tukey test, *P<0.05, **P<0.01.

[0042] Figure 5 The immunotherapeutic effect of MA272@MOF@RBC on liver tumors in this application; (A) The mouse H22 liver tumor model and re-challenge model were established; (B) The tumor growth curve of each group; (C) The survival time of the specified group; (D) The tumor inhibition rate of the specified group; (E) The photo of mice with tumors; (F) The representative images of PCNA immunostaining and HE staining of tumor tissues, scale bar = 50μm; (G) The quantification of PCNA expression in tumor tissues of the specified group; (H) The body weight of mice in the specified group; (I) The tumor growth curve after re-challenge; (J) The survival period of mice after re-challenge; One-way ANOVA and Tukey test, *P<0.05, **P<0.01.

[0043] Figure 6 This is the pore size test of UiO-66-NH2 in this application. (A) is the N2 adsorption-desorption isotherm; (B) is the pore size distribution.

[0044] Figure 7 The loading efficiency and loading capacity of MA and CM272 in MA272@MOF of this application.

[0045] Figure 8 Cell viability of LO2 or primary normal bone marrow (NBM) cells after 48 h of treatment with different concentrations of MA272@MOF@RBC for this application.

[0046] Fig. 9 The data are the body weights of mice with acute myeloid leukemia in different groups of the present application. The data are expressed as mean±SD (n=6).

[0047] Fig.10 The IFN-γ levels of acute myeloid leukemia mice in different groups in this application. Data are expressed as mean ± SD (n = 6), one-way ANOVA and Tukey test, *P < 0.05.

[0048] Fig.11 In this application, flow cytometry was used to analyze the LSCs (CD34 + CD38 - ), leukemic blastocysts, CD3+CD8+T cells, effector memory T cells, and gating strategies based on MHC-I and PD-L1 expression.

[0049] Fig.12 Schematic diagram of red blood cell-inspired MOFs as triple epigenetic regulators to enhance anti-leukemia immunity in this application. DETAILED DESCRIPTION

[0050] The present application is described in detail below with reference to embodiments, but the present application is not limited to these embodiments.

[0051] Unless otherwise specified, the raw materials in the examples of this application were purchased through commercial channels.

[0052] The zirconium n-propoxide solution was obtained from Aladdin (concentration 70 wt %, solvent 1-propanol).

[0053] Unless otherwise specified, conventional methods were used for testing and instrument settings were those recommended by the manufacturer.

[0054] Obtaining the loading capacity (LC) and encapsulation efficiency (EE) The loading capacity (LC) and encapsulation efficiency (EE) of MA and CM272 in MA272@MOF@RBC were evaluated by C18 column high performance liquid chromatography (HPLC). The calculation method is as follows:

[0055]

[0056] Material Characterization:

[0057] The morphology of the nanoparticles was evaluated using a JEOL JSM-6700F scanning electron microscope (SEM) and a transmission electron microscope (TEM, Philips-FEITecnai G2S-Twin microscope equipped with a 200 kV field emission gun); the nitrogen adsorption-desorption isotherms at 77 K were calculated using a Micromeritics 2020 analyzer; and the powder X-ray diffraction (PXRD) patterns were obtained using a Rigaku D-Max 2550 diffractometer with Cu Kα radiation. The Fourier transform infrared spectra in the region of 400–4000 cm-1 were obtained using a Bruker IFS66V / S Fourier transform infrared spectrometer and a KBr pellet; X-ray photoelectron spectroscopy (XPS) data were collected using an ESCALAB250 spectrometer.

[0058] In the experiment in this application, the PBS solution of biomimetic MOFs based on red blood cells was prepared at a concentration of 50ug / ml for the treatment of cells.

[0059] Cell culture:

[0060] C1498 cells were purchased from the American Tissue Culture Collection and cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum at 37°C and 5% carbon dioxide. H22 cell line was purchased from Wuhan Presella Biotechnology Co., Ltd.

[0061] Cell absorption test of MA272@MOF@RBC:

[0062] 1×10 per well 5 The cells were seeded into 24-well plates at a density of 10 cells and cultured overnight. After replacing the culture medium with fresh culture medium containing Cy3-labeled MA272@MOF@RBC nanoparticles, the cells were cultured for 30 minutes, harvested, and sliced ​​into thin slices using a cell slicer. The cells were rinsed with PBS and fixed with 4% paraformaldehyde (PFA) for 15 minutes, and then the nuclei were stained with DAPI. The cells were observed using a confocal laser scanning microscope (Nikon). The intracellular uptake of MA272@MOF@RBC nanoparticles was also quantified by measuring the Zr content in the cells using a Perkin-Elmer NEXION 300× ICP mass spectrometer.

[0063] In vitro cytotoxicity assay:

[0064] Cytotoxicity was assessed using the Cell Counting Kit-8 (CCK8; Dojindo Molecular Technologies). Briefly, cells were seeded into 96-well plates and treated with different nanoparticles for 48 hours. CCK-8 assays were performed according to the kit instructions, and the absorbance at a wavelength of 450 nm was measured using a BioTekEpoch microplate reader. Cell apoptosis was detected by Annexin V and PE staining, and the number of apoptotic cells was determined by flow cytometry.

[0065] Western blotting:

[0066] Appropriately treated cells were lysed with cold protein lysis buffer and supplemented with 1% phosphatase inhibitor (CellSignaling Technology). Protein samples from each group were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, USA). After blocking with 5% skim milk for 1 hour, the PVDF membranes were incubated with anti-β-actin (sc-47778, Santa Cruz Biotechnology) and anti-HIF-1α (14179, Cell Signaling Technology) antibodies at 4°C overnight. The membranes were then probed with horseradish peroxidase-conjugated secondary antibodies. Bands were visualized using an ECL kit and imaged using a gel imaging system. The density of bands relative to β-actin was quantified using ImageJ software.

[0067] 5mC or mA dot blot detection:

[0068] 5mC or m6A dot blot detection was performed according to the established protocol described previously. 5,6 Briefly, DNA or mRNA samples were denatured in NaOH at 100°C for 10 min and then mixed with an equal volume of cold ammonium acetate. Dot blot analysis was performed using the Bio-Dot instrument (Bio-Rad) system with anti-5mC antibody (AHP1826Z, Bio-Rad) or anti-m6A antibody (202003, Synaptic Systems) and horseradish peroxidase-conjugated secondary antibody. Signals were detected by enhanced chemiluminescence.

[0069] qPCR of methylated RNA transcripts:

[0070] Using MagnaMeRIP TMThe m6A kit (17-10499, Millipore) was used for qPCR analysis of m6A methylated RNA transcripts according to the manufacturer's instructions. Briefly, RNA samples were fragmented and immunoprecipitated with 5 μl of anti-m6A antibody, and then the RNA-protein complex was captured with magnetic beads. The bound RNA was eluted from the magnetic beads with N6-methyladenosine, and then quantitative RT-PCR was performed. The primer sequences were: mouse PD-L1 (3'UTR), SEQ ID NO.1: 5'-CCT GAGGGAGAGAACCAAGA (forward), SEQ ID NO.2: 5'-GGCACTGAGC AGAGGAAAAG (reverse).

[0071] mRNA stability testing:

[0072] Appropriately treated cells were seeded into 12-well plates and treated with actinomycin D (5 μg / mL, Sigma) for different times. RNA was extracted at designated time intervals and analyzed by qPCR. The half-life of mRNA was determined using linear regression analysis. The primer sequences were: mouse GAPDH, SEQ ID NO.3: 5'-GCAAAGTGGAGATTGTTG (forward), SEQ ID NO.4: 5'-AGTGGAGTCATACTGGAA (reverse); mouse PD-L1 (CDS), SEQ ID NO.5: ATCCATCCTGTTGTTCCT (forward), SEQ ID NO.6: CACATCTAGCATTCTCACTT (reverse).

[0073] Establishment of mouse acute myeloid leukemia model:

[0074] Male C57BL / 6N or Balb / c mice aged 4-6 weeks were purchased from Charles River and kept in a pathogen-free environment. The research protocol was approved by the Ethics Committee of Jilin University, and all animal experimental procedures were carried out in accordance with the guidelines established by the Animal Care and Use Committee of Jilin University. The AML model was established as described previously. C57BL / 6N mice were intravenously injected with 0.5×106 C1498 cells, and their white blood cell (WBC) counts were routinely monitored. Blood was drawn from the tail vein, and 2 μL of the blood sample was diluted with 38 μL Turk blood diluent (Ricca Chemical). The number of white blood cells was counted under a microscope. After leukemia was confirmed based on the white blood cell count, the mice were intraperitoneally injected with 50 μg / mL of nanoparticles three times a week for 2 weeks. Mice were randomly divided into PBS group, CM272+MA group (60 μM MA and 1 μM CM272, equivalent to the dose in MA272@MOF@RBC), and MA272@MOF@RBC group (n=6 in each group). As described above, white blood cell counts were monitored to evaluate the treatment response. Mice were euthanized as soon as they showed symptoms such as dyspnea, weight loss, or difficulty in movement. Spleen weight and number of metastatic nodules were assessed at the end of each experiment. In the C1498 re-challenge experiment, surviving mice were challenged again with 10×106 C1498 cells on day 24, and all mice were euthanized once the first mouse reached the endpoint.

[0075] Establishment of mouse liver tumor model:

[0076] H22 cells (1×106) were injected subcutaneously into the right abdomen of male Balb / c mice. When the tumor volume reached approximately 200 mm3, the mice were randomly divided into PBS group, CM272+MA group (60 μM MA and 1 μM CM272, equivalent to the dose in MA272@MOF@RBC) and MA272@MOF@RBC group (n=6 each). Nanoparticles were injected intraperitoneally at a dose of 50 μg / mL three times a week for 2 consecutive weeks. Tumor size and body weight were measured every 3 days, and tumor volume was calculated using the formula: 1 / 2×(length×width2). The survival of the mice was monitored until 80 days after the first injection, and euthanasia was performed once the tumor volume exceeded 2000 cubic millimeters. Complete response (CR) or 100% tumor growth inhibition refers to a tumor volume less than 20 cubic millimeters (minimum detection limit). On day 20, 1×106 H22 cells were induced again in the left abdomen of each mouse to evaluate immune memory. Tumor-related parameters were evaluated 20 and 80 days after transplantation.

[0077] Immunohistochemistry and H&E staining:

[0078] Tumor tissues were fixed with 10% neutral buffered formalin, embedded in paraffin, and cut into 5 μm thick sections. Immunohistochemistry (IHC) and hematoxylin and eosin (H&E) staining were performed according to standard protocols. For immunohistochemical staining, tissue sections were deparaffinized, rehydrated, and antigen retrieved, and then incubated overnight with anti-PCNA antibody (#12727, Cell Signaling Technology). Sections were imaged under a Nikon confocal fluorescence microscope.

[0079] In vivo immune response analysis:

[0080] After mice were euthanized, tumor-draining lymph nodes, spleen, and bone marrow were harvested and homogenized to obtain single-cell suspensions. Cells were stained with anti-CD45 (FITC), anti-CD3 (Brilliant Violet 785), and anti-CD8 (Alexa Fluor 700) antibodies (Bio Legend) to identify CD8 + T cells; mature dendritic cells (DCs) were detected using anti-CD11c (PerCP / Cy5.5), anti-CD80 (APC), and anti-CD86 (Brilliant Violet 421) antibodies (BioLegend). T cells from lymph nodes were stained with anti-CD62L (Brilliant Violet 605) and anti-CD44 (APC / Cy7) antibodies (Bio Legend) to distinguish central memory T cells from effector memory T cells. Anti-PD-L1 (BV711, BioLegend) and anti-MHCI (BV510, Bio Legend) were used to detect the expression of cell membrane proteins. The expression of HMGB-1 in bone marrow cells was quantified by ELISA. Serum samples were also collected and the levels of IFN-γ were detected using a specific ELISA kit (Thermo Fisher Scientific) according to the manufacturer's instructions.

[0081] Biodistribution in vivo:

[0082] Euthanasia was performed 12 hours after administration (3 mice at each time point). Bone marrow, heart, liver, spleen, lungs, and kidneys were harvested, weighed, and digested in aqua regia at 80°C for 3 days. The silicon content in the samples was analyzed by ICP-AES (Perkin-Elmer Optima 3300DVICP spectrometer). For flow cytometric analysis, bone marrow cells were collected and filtered with a 40-μm nylon mesh filter (Corning). Leukemic stem cells (CD34 + CD38 + ).

[0083] Statistical analysis:

[0084] Kaplan-Meier survival curves were generated and analyzed using the log-rank test. The sample size for each study was determined from previous literature and well-characterized experiments to ensure adequate statistical power to compare experimental results with control results. In vitro experiments were performed at least three times unless otherwise stated. Multiple group comparisons were performed using one-way analysis of variance (ANOVA) with Tukey post-test. All analyses were performed using GraphPad Prism 9 software. All P values ​​were two-tailed, and P < 0.05 was considered statistically significant.

[0085] Example 1 Preparation of MA272@MOF@RBC

[0086] (1) Synthesis of MA272@MOF

[0087] The synthesis process is shown in the figure Figure 1 As shown in A, a mixture of 75 μL of zirconium n-propoxide solution, 4 mL of acetic acid and 7 mL of DMF was placed in a scintillation vial with an aluminum block, heated at 130 °C for 2 h, and cooled to room temperature to obtain a hexanuclear zirconium oxide cluster; then 82 mg of 1,4-phthalate (BDC) linker was added, and after ultrasonication for 30 s, the mixture was stirred at 200 rpm at 25 °C for 18 h to synthesize the product UiO-66-NH2, and the product was centrifuged at 6000 rpm for 15 min, washed twice with DMF and ethanol, and dried in a vacuum oven at 30 °C to obtain UiO-66-NH2 nanoparticles;

[0088] 100 mg UiO-66-NH2 nanoparticles were mixed with 10 mg MA and 10 mg CM272 in 5 mL methanol solvent and stirred at 500 rpm for 6 h to obtain the product MA272@MOF solution. The product was centrifuged at 6000 rpm for 15 min, washed twice with DMF and ethanol, and dried in a vacuum oven at 30 °C to obtain MA272@MOF nanoparticles.

[0089] (2) Separation of red blood cells

[0090] Collect blood samples from mice, place them in sterile tubes containing EDTA, and centrifuge them at 1500×g for 10 min at room temperature. Carefully aspirate the upper plasma layer, resuspend the red blood cell pellet in PBS and centrifuge once. Determine the red blood cell count using a flow cytometer, and store the cells in PBS at 4°C.

[0091] (3) Synthesis of MA272@MOF@RBC

[0092] The synthesis process is shown in the figure Figure 1 As shown in Figure 1, 5 mg of MA272@MOF nanoparticles were mixed with 200 uL of 1×10 7The PBS solution of red blood cells was mixed, extruded using an Avanti mini extruder (AvantiPolarLipids) for 20 cycles, and then rinsed twice with PBS at 4000g for 20 min each. To confirm the coating of red blood cells, the total protein profile of MA272@MOF@RBC particles was analyzed by SDS-PAGE, and the surface expression of CD47 was detected by flow cytometry.

[0093] Test Example 1 Preparation and Characterization of MA272@MOF@RBC

[0094] In Example 1, a representative MOF UiO-66 was prepared as a drug carrier by room temperature synthesis, which can avoid the loss of activity of encapsulated bimolecular drugs. UiO-66 has a persistent structure composed of zirconium (Zr) ions connected by 1,4-phthalic acid, with high specific surface area, large porosity, customizable properties and good biocompatibility. Figure 6 The N2 adsorption / desorption isotherms and pore size distribution of UiO-66 are shown. The specific surface area and total pore volume of UiO-66 are 855.6896 m 2 / g and 0.256683cm 3 g -1 The dual epigenetic drugs CM-272 and MA were loaded into the UiO-66 core to obtain MA272@MOF particles. The method of Example 1 was used to adjust the weight ratio of MA, CM272 and MA272@MOF, and the loading amount was tested. When the mass ratio of MA272@MOF was 0.1:0.1:1, the maximum loading efficiency of CM272 and MA was 98.5%; when the mass ratio was 1:1:1, the maximum loading efficiency of CM272 and MA was 37.5% ( Figure 7 ), the relatively high dual drug loading capacity can be attributed to the macroporous structure of UiO-66, and the size of MA272@MOF was determined by transmission electron microscopy (TEM) test, with a diameter of 150 ± 9.4 nm ( Figure 1 B, C). X-ray diffraction (XRD) patterns of UiO-66 and MA272@MOF confirm that the structure of MOF remains unchanged after loading the bimolecular drug ( Figure 1 D). Element distribution by X-ray photoelectron spectroscopy ( Figure 1 EI) and TEM elemental spectra ( Figure 1 J) was evaluated. To prepare MA272@MOF@RBC particles, red blood cells were isolated from mouse peripheral blood. The unique biconcave disc shape of red blood cells ( Figure 1 K) is conducive to the effective binding of oxygen and the exchange of carbon dioxide, and maximizes the surface area for gas diffusion. After coating red blood cells, the color of the MA272@MOF@RBC solution changes from milky white to light red ( Figure 1 M). In addition, the potential reversal of MA272@MOF@RBC was -14.4±2.7mV ( Figure 1 N), which may be due to the negative potential of the red blood cell membrane maintaining the ion balance inside and outside the cell.

[0095] The protein profile of MA272@MOF@RBC is comparable to that of erythrocytes, which clearly indicates that erythrocyte membrane proteins are retained in MA272@MOF@RBC ( Figure 1 O). In addition, MA272@MOF@RBC also expressed high levels of CD47, a characteristic marker of red blood cells ( Figure 1 P, Q). In summary, it is demonstrated that a red blood cell-based biomimetic MOFs carrying two epigenetic drugs was successfully synthesized.

[0096] Test Example 2 Targeting ability of MA272@MOF@RBC

[0097] To evaluate the ability of MA272@MOF@RBC to specifically target leukemia cells, its uptake in normal bone marrow cells and C1498 cells was tracked: MA272@MOF@RBC was mixed with Cy3 or Cy7, and cells were fused and encapsulated with MA272@MOF@RBC nanoparticles ( Figure 2 A). C1498 or LSCs incubated with Cy3-labeled MA272@MOF@RBCs emit strong red fluorescence signals, while normal bone marrow cells show very little fluorescence ( Figure 2 B), indicating that MA272@MOF@RBC nanoparticles have a higher selectivity for leukemic blasts. In addition, C1498 cells treated with MA272@MOF@RBC showed significantly higher zirconium content than C1498 cells treated with MA272@MOF, confirming that RBC coating promotes cellular uptake of MA272@MOF@RBC nanoparticles ( Figure 2 C). The in vivo biodistribution of MA272@MOF@RBC nanoparticles was analyzed in a C1498-induced acute myeloid leukemia mouse model ( Figure 2 D). In addition, the Zr content in peripheral blood mononuclear cells and bone marrow of mice in the MA272@MOF@RBC group was significantly increased compared with that in the MA272@MOF group, indicating that targeted delivery ( Figure 2 E). To achieve sustained remission and improve the prognosis of leukemia patients, selective ablation of hematopoietic stem cells is imperative. To this end, we analyzed the in vivo biodistribution of MA272@MOF@RBC by in vivo and in vitro fluorescence imaging and flow cytometry. Flow cytometry analysis of LSCs (CD34 + CD38 -), leukemic blastocysts, CD3+CD8+T cells, effector memory T cells, and gating strategies for MHC-I and PD-L1 expression, such as Fig.11 In bone marrow cells ( Figure 2 F) and CD34 + CD38 - LSCs( Figure 2 G), the increased Cy7 fluorescence signal was observed, confirming the precise targeting ability of MA272@MOF@RBC to leukemia. MA272@MOF@RBC can also induce apoptosis of AML cells in a dose-dependent manner, with an IC50 of 33.4±5.6μg / mL ( Figure 2 H, I), but the cytotoxicity to LO2 cells and normal monocytes at the same concentration was negligible ( Figure 8 ). In summary, MA272@MOF@RBC can selectively inhibit AML cells at a relatively low dose.

[0098] Test case 3 Triple epigenetic regulation mechanism of MA272@MOF@RBC

[0099] In order to clarify the epigenetic regulation of MA272@MOF@RBC, the 5mC DNA methylation, m 6 A-RNA methylation and histone H3K9 methylation were assessed: Figure 3 As shown in A, MA272@MOF@RBC significantly reduced 5mC DNA methylation and H3K9me histone methylation, and increased m 6 A-RNA methylation. Epigenetic silencing of STING in cancer cells by DNMT1 plays a key role in tumor immune evasion and resistance to immunotherapy. In addition, H3K9me2-mediated epigenetic regulation can activate type I IFN response and promote ICD. In addition, MA272@MOF@RBC also induced C1498 cells to express MHC-I ( Figure 3 D) and releases the ICD marker HMGB-1 into the serum ( Figure 3 E) Various oncogenes, such as PD-L1 and cMYC, can be expressed through m 6 A-RNA modification is regulated. PD-L1 is often upregulated in acute myeloid leukemia cells and inhibits T cell activity by binding to the PD1 receptor on T cells. In fact, MA272@MOF@RBC increased the abundance of mA residues in C1498 cells ( Figure 3 F), which corresponds to a significant downregulation of PD-L1 transcripts ( Figure 3 G). Accelerated decay of PD-L1 mRNA leads to reduced surface expression of PD-L1 protein ( Figure 3 H).

[0100] Test Example 4: MA272@MOF@RBC inhibits HIF-1α signaling pathway to relieve hypoxia symptoms

[0101] Hypoxia is a characteristic of the leukemic niche and triggers the activation of HIF-1α and other genes, which play a key role in regulating the cellular response to low oxygen levels. In addition, hypoxia-induced gene expression is a key factor determining the drug resistance of leukemic cells. To verify that MA272@MOF@RBC can improve the hypoxic microenvironment of leukemia through oxygen transport by red blood cells, acute myeloid cells were exposed to hypoxia in vitro using CoCl2. CoCl2-induced hypoxia stabilizes HIF1-α protein in AML cells. Although the combination of MA and CM272 failed to downregulate HIF-1α, even MA272@MOF particles loaded with leukemic cell membranes (MA272@MOF@LM) had no effect. On the other hand, MA272@MOF@RBC significantly reduced CoCl2-mediated HIF1-α stabilization ( Figure 3 I). like Figure 3 As shown in Figure 1, compared with MA272@MOF@LM, MA272@MOF@RBC can significantly reduce the survival rate of AML cells under hypoxic conditions, which can be attributed to its ability to alleviate hypoxia. In conclusion, MA272@MOF@RBC can overcome the hypoxic environment of acute myeloid leukemia and improve the efficacy by inhibiting the HIF1-α signaling pathway. Moreover, the triple epigenetic regulatory activity of MA272@MOF@RBC can induce apoptosis of acute myeloid leukemia cells and enhance the recognition ability of immune cells. Figure 3 L).

[0102] Test Example 5: Inhibition of leukemia growth in vivo by MA272@MOF@RBC

[0103] To verify the in vitro experimental results, the anti-leukemia effect of MA272@MOF@RBC was tested in a C1498-induced acute myeloid leukemia mouse model ( Figure 4 A): When the mouse white blood cell (WBC) count reaches 250x10 9 / L, they were randomly divided into PBS group, MOF@RBC group, MA272@MOF@LM group, CM272+MA group and MA272@MOF@RBC group, and treated with the corresponding preparations for 80 days. The changes of white blood cell count, survival rate and leukemia growth inhibition rate in different treatment groups over time are shown in Figure 2. Figure 4BD. We observed that the number of white blood cells in the PBS-treated mice increased rapidly within 24 days, and all mice died within 33 days. Similarly, MOF@RBC did not inhibit the progression of leukemia, indicating that MOF and red blood cells had no therapeutic effect. The combination of CM272 and MA only achieved an LGI of 21.6% and extended the survival of leukemic mice by 15 days. This suggests that small molecule drugs have limited utilization in vivo even when used in combination and highlights the need for suitable drug carriers. The LGI rate and survival time of the MA272@MOF@LM group were 33.5% and 51 days, respectively. Therefore, consistent with the aforementioned in vitro findings, MA272@MOF@LM failed to overcome the leukemic hypoxic microenvironment, thereby limiting the efficacy of epigenetic drugs. On the other hand, MA272@MOF@RBC achieved a 93.8% inhibition rate on leukemic growth and a 100% survival rate within 90 days. In addition, MA272@MOF@RBC also significantly inhibited the pathological indicators of leukemia, such as leukemia cell proliferation and splenomegaly ( Figure 4 EH). Hematopoietic stem cells are the main cause of leukemia relapse and are difficult to target with traditional drugs because they reside in oxygen-deprived bone marrow niches. Figure 4 As shown in Figure 1, MA272@MOF@RBC eliminated 90.2% of leukemia stem cells, which was attributed to the efficient delivery of drugs to the bone marrow using red blood cell-based MOF nanocarriers and precise targeting of stem cells. No significant weight loss was observed in any group, reflecting the good biocompatibility of different MA272@MOF@RBC nanoparticles ( Fig. 9 ).

[0104] Test Example 6: Enhancement of T cell activation and immune memory response by MA272@MOF@RBC

[0105] The potential immune mechanism of MA272@MOF@RBC was further studied in vivo. Consistent with the in vitro results, MA272@MOF@RBC could significantly upregulate MHC-I( Figure 4 J), downregulation of PD-L1( Figure 4 K), thereby enhancing immunogenicity. The increased levels of HMGB-1 in the serum of these mice further confirmed the activation of ICD ( Figure 4 L). The increase in leukemic cell antigenicity directly triggers the maturation of DCs, which is manifested by the upregulation of co-stimulatory molecules CD80 and CD86 ( Figure 4 M), leading to cytotoxic CD8 + T cell expansion ( Figure 4 N) and IFN-γ production increased ( Fig.10 ). Memory T cells play a key role in adaptive immunity, providing long-lasting protection against previously encountered pathogens. Figure 4 As shown in Figure 2, the number of central memory T cells (CD8+CD44+CD62L-) in the spleen cells of mice treated with MA272@MOF@RBC was significantly increased compared with other groups, indicating that MA272@MOF@RBC treatment can stimulate strong immune memory. To determine whether MA272@MOF@RBC can provide long-term anti-leukemia immunity, mice were treated again with C1498 cells ( Figure 4 P). When untreated mice were challenged with 10×106 C1498 cells, the white blood cell count increased rapidly, and all mice died within 20 days after C1498 re-challenge. In contrast, no leukemia growth was found in mice treated with MA272@MOF@RBC after re-challenge, and all mice survived until day 90 after C1498 re-challenge ( Figure 4 Q, R). In conclusion, MA272@MOF@RBC improves the efficacy of immunotherapy against leukemia by promoting T cell activation and enhancing immune memory response.

[0106] Test Example 7: Inhibition of liver tumor growth in vivo by MA272@MOF@RBC

[0107] Since epigenetic mechanisms regulate immune responses in various cancers including liver tumors, to investigate the efficacy of MA272@MOF@RBC on liver cancer, a mouse liver tumor model was established by orthotopic injection of H22 cells, and tumor-bearing mice were treated with PBS, CM272+MA, and MA272@MOF@RBC for 80 days ( Figure 5 A). Figure 5 BE shows the tumor growth curve, survival period, and tumor growth inhibition rate (TGI), respectively. CM272 and MA inhibited the growth of hepatocellular carcinoma. In addition, the survival period of mice in the CM272+MA group was 53 days, while that of the control group was only 41 days. MA272@MOF@RBC almost ablated the tumor, with a TGI rate of 92.9% and an overall survival rate of 100% on day 80. These results were further confirmed by the in situ expression of proliferating cell nuclear antigen in the tumor tissues of each group ( Figure 5 F). In addition, the histological changes of the tumors were consistent with the growth of the different treatment groups ( Figure 5 G). No significant weight loss was found in any group, indicating that the different treatments have good biocompatibility ( Figure 5H). Tumor recurrence is one of the main causes of death in patients with liver cancer. Therefore, to verify whether MA272@MOF@RBC can also induce immune memory effects against liver tumors, mice were re-challenged after surgical resection of the primary tumor. Secondary tumors in both the control and CM272+MA groups were not significantly suppressed, and all mice died within 43 days. In contrast, no tumors were found in mice treated with MA272@MOF@RBC after re-challenge ( Figure 5 All mice survived until day 80 ( Figure 5 J). In summary, MA272@MOF@RBC can effectively inhibit liver tumors and induce long-term protective immune responses. The schematic diagram of the present application of biomimetic MOFs based on red blood cells (MA272@MOF@RBC) as triple epigenetic regulators to enhance anti-leukemia immunity is shown in the figure Fig.12 shown.

[0108] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A bionic MOFs based on red blood cells, characterized in that: It includes drug-loaded MOFs and a red blood cell membrane layer coated on the outside of the MOFs; The MOFs are selected from UiO-66-NH2; The UiO-66-NH2 is a particle with amino functional groups connected to UiO-66; The drug-loaded MOFs are loaded with dual epigenetic drugs; The dual epigenetic drugs are CM272 and MA.

2. The red blood cell-based biomimetic MOFs according to claim 1, characterized in that: The particle size of the drug-loaded MOFs is 140-160 nm.

3. The method for preparing the bionic MOFs based on red blood cells according to claim 1 or 2, characterized in that: The steps include: S1, obtaining UiO-66-NH2, and then stirring, separating, washing, and drying a mixed solution of UiO-66-NH2, a dual epigenetic drug, and a solvent to obtain drug-loaded MOFs; The dual epigenetic drugs are CM272 and MA; S2, obtaining a PBS solution of red blood cells; S3. Adding the drug-loaded MOFs to the PBS solution of red blood cells to obtain a mixed solution, and using an extruder to cyclically extrude the mixed solution to obtain the red blood cell-based bionic MOFs.

4. The preparation method according to claim 3, characterized in that: In step S1, the method for obtaining UiO-66-NH2 includes: adding a zirconium n-propoxide solution to a mixture containing acetic acid and DMF, placing the mixture in a sealed container, heating the reaction, then adding a linker to the product, stirring, separating, washing, and drying to obtain UiO-66-NH2.

5. The preparation method according to claim 4, characterized in that: The concentration of the zirconium n-propoxide solution is 70wt%, and the solvent is 1-propanol; Preferably, the ratio of zirconium n-propoxide solution to acetic acid is 1 μL:53-55 mL; Preferably, the ratio of zirconium n-propoxide solution to DMF is 1 μL:93-95 mL; Preferably, the ratio of the zirconium n-propoxide solution to the linker is 1 μL: 1.1-1.3 mg; Preferably, the linking agent is selected from 1,4-phthalate esters; Preferably, the conditions of the heating reaction include: reaction temperature of 120-140° C., reaction time of 1-3 h; Preferably, the stirring conditions include: ultrasonic treatment for 20 to 40 seconds, and then stirring at a rotation speed of 150 to 300 rpm for 16 to 24 hours.

6. The preparation method according to claim 3, characterized in that: In step S1, the weight ratio of UiO-66-NH2 to CM272 is 1:0.025-0.15; Preferably, in step S1, the weight ratio of UiO-66-NH2 to MA is 1:0.025-0.15; Preferably, in step S1, the solvent is selected from methanol.

7. The preparation method according to claim 3, characterized in that: In step S2, the method for obtaining the PBS solution of red blood cells includes: placing a mouse blood sample in a container containing an anticoagulant, centrifuging to obtain upper plasma, mixing the upper plasma with a PBS solution and centrifuging to obtain the PBS solution of red blood cells.

8. The preparation method according to claim 3, characterized in that: In step S3, the dosage ratio of drug-loaded MOFs to red blood cells is 1 mg: 0.15×10 7 ~0.25×10 7 indivual.

9. Use of the erythrocyte-based bionic MOFs according to claim 1 or 2 or the erythrocyte-based bionic MOFs obtained according to the preparation method according to any one of claims 3 to 8 as triple epigenetic regulators in the preparation of drugs for enhancing anti-leukemia immunity.

10. The use according to claim 9, characterized in that: The triple epigenetic regulator is directed against 5mC DNA methylation, m 6 A-Epigenetic regulators that regulate RNA methylation and histone H3K9 methylation.

Images