A recombinant humanized collagen type III and its encoding gene and application

Recombinant type III humanized collagen expressed in Pichia pastoris using a novel sequence optimized through AI design and molecular dynamics simulations has solved the problems of low expression levels, poor solubility, and easy degradation, achieving high stability and high solubility, and significantly promoting cell proliferation and adhesion.

CN119390820BActive Publication Date: 2025-11-07ZHUHAI JINBAIKANG BIOLOGICAL TECH CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202411847842.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-16
Publication Date
2025-11-07
Estimated Expiration
2044-12-16

AI Technical Summary

Technical Problem

Existing recombinant collagen suffers from problems such as low expression levels, low solubility, low activity, and easy degradation, especially in genetic engineering methods, making it difficult to achieve high stability and resistance to degradation.

Method used

A novel type III humanized collagen sequence was designed using AI technology and molecular dynamics simulation. The recombinant protein was then expressed in Pichia pastoris strains, and the amino acid and nucleotide sequences were optimized to improve stability and expression levels by tandem repeat monomers and tail amino acid sequences. The recombinant protein was then secreted in the yeast expression system.

Benefits of technology

It achieves high stability, anti-degradation and high solubility of recombinant type III humanized collagen, while significantly promoting cell proliferation and adhesion. It has high expression level, solubility up to 100 g/L, and significantly improved cell proliferation rate and adhesion rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119390820B_ABST
    Figure CN119390820B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of bioengineering, and particularly relates to a recombinant humanized collagen III and a coding gene and application thereof. The application adopts advanced AI technology and molecular dynamics simulation to design a new humanized collagen III sequence, so as to ensure that the recombinant humanized collagen III product has high stability and anti-degradation. The new humanized collagen III sequence screened is transferred to a Pichia pastoris strain for recombinant expression, and the prepared recombinant humanized collagen III has the advantages of high stability, high expression and good hydrophilicity. In addition, the recombinant humanized collagen III also has the effects of promoting cell proliferation and cell adhesion.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a recombinant type III humanized collagen, a coding gene thereof and application thereof. BACKGROUND

[0002] Collagen is the most abundant protein in mammals, and exists in various tissues such as skin, bone, tendon, cartilage and blood vessels. Common collagens include type I, type III and type XVII. Type III collagen is a triple helix structure formed by three identical polypeptide alpha chains, has a highly conserved amino acid sequence, and glycine, proline and hydroxyproline repeatedly appear at specific positions to form a unique three-dimensional structure. Type III collagen, together with type I collagen, forms the basement membrane of the skin, providing strength and elastic support. Collagen has inherent biological compatibility, biodegradability and absorbability, promotes new cell formation and epithelial cell formation, and has great application prospects in the medical field, beauty, cosmetics and health care industries.

[0003] The development of recombinant technology enables type III collagen to be produced with high purity and high specificity without using animal sources. Recombinant type III collagen is obtained by optimizing and expressing the original gene sequence of human collagen type III using genetic engineering technology, which overcomes the problems of low biological activity, poor solubility, low bioavailability, easy immune response and allergy of collagen extracted by traditional methods.

[0004] Patent document CN114085284A discloses a recombinant type III humanized collagen, nucleic acid, vector and implant. The recombinant type III humanized collagen is a sequence peptide segment 549-560aa, 597-613aa, 881-902aa, 648-662aa with good stability obtained by long-term screening in the natural human type III collagen alpha 1 chain. The four peptide chains are sequentially spliced to form a monomer, and then the monomer is expressed in series. After fermentation and purification, the obtained recombinant type III humanized collagen has high stability, effectively solves the degradation problem of recombinant type III humanized collagen in the clinical use process, and can be prepared into a liquid preparation for storage and use.

[0005] Patent document CN116987176A discloses a recombinant type III humanized collagen and its application. The recombinant type III humanized collagen is a sequence with good water solubility, a cell adhesion fragment, a non-hydroxyproline-dependent triple helix segment, and a cysteine stability segment as a target sequence, and the target sequence is combined in 1-10 groups. The recombinant type III humanized collagen is 100% identical in structure to the corresponding segment of human type III collagen sequence, and does not produce immune rejection when applied to the human body.

[0006] Patent document CN118773255A discloses a preparation method and application of a recombinant full-length type III humanized collagen. The recombinant full-length type III humanized collagen is synthesized by gene engineering codon sequence optimization and expression vector after the full-length sequence of human type III collagen alpha 1 chain mature peptide amino acid, and then is transferred into HEK293F host cells for recombinant expression to obtain a high expression strain or cell strain. The product is purified to obtain the recombinant full-length type III humanized collagen. The prepared recombinant collagen has wide application potential in repair and regeneration medicine, medical cosmetic filling materials, and functional cosmetic materials.

[0007] However, the recombinant collagen prepared by the current genetic engineering method still has problems such as low expression amount, low solubility, low activity of recombinant collagen, and easy degradation. Therefore, it is still a difficult point to be solved to develop a type III collagen with stable structure, high anti-degradation, good hydrophilicity, and high biological activity. SUMMARY

[0008] In order to solve the defects of the prior art, the present application provides a new recombinant type III humanized collagen. The present application uses advanced AI technology and molecular dynamics simulation to design a new type III humanized collagen sequence, which ensures that the recombinant type III humanized collagen product has high stability and anti-degradation. The present application transfers the screened new type III humanized collagen sequence to a Pichia pastoris strain for recombinant expression, and the prepared recombinant type III humanized collagen has the advantages of strong stability, high expression amount, and good hydrophilicity. At the same time, the recombinant type III humanized collagen also has the effects of significantly promoting cell proliferation and cell adhesion.

[0009] To achieve the above-mentioned purposes, the technical scheme adopted by the present application is as follows:

[0010] The application provides a recombinant type III humanized collagen, which is composed of tandemly repeated monomers and tail splicing amino acid sequences as shown in SEQ ID NO: 4, wherein the monomers are spliced in sequence from an amino acid peptide as shown in SEQ ID NO: 1 and an amino acid peptide as shown in SEQ ID NO: 2, and the number of the tandem monomers is 10.

[0011] Further, the amino acid sequence of the monomer is as shown in SEQ ID NO: 3.

[0012] Further, the amino acid sequence of the recombinant type III humanized collagen is as shown in SEQ ID NO: 5.

[0013] Further, the application provides a coding gene of the recombinant type III humanized collagen, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO: 6.

[0014] Further, the application provides a recombinant vector of the recombinant type III humanized collagen, and the recombinant vector comprises the coding gene of the recombinant type III humanized collagen.

[0015] Further, the application also provides an engineering strain, and the engineering strain comprises the coding gene of the recombinant type III humanized collagen or the recombinant vector of the recombinant type III humanized collagen.

[0016] In addition, the application also provides application of the recombinant type III humanized collagen in preparation of a cosmetic or a medical device product.

[0017] Further, the application also provides application of the recombinant type III humanized collagen in preparation of an anti-aging cosmetic, a repair cosmetic or an antioxidant cosmetic.

[0018] Further, the application also provides application of the recombinant type III humanized collagen in preparation of a collagen dressing with functions of promoting cell proliferation, adhesion and migration.

[0019] In addition, the application also provides a composition, and the composition comprises the recombinant type III humanized collagen and an acceptable excipient.

[0020] The recombinant humanized type III collagen provided by the application is based on human type III collagen alpha 1 chain, a 10-triplet long window is slid along the triple helix region, the stability score of each window is calculated according to the scoring function, a sequence fragment with GPP at both ends is selected in the sequence fragment with high score, and the sequence fragments are spliced in order to obtain a target sequence fragment, then the target sequence fragment is taken as a unit to perform 10 times of series connection, and finally GPPGPCCGGG is added at the tail to obtain the recombinant humanized type III collagen of the application. The recombinant humanized type III collagen prepared by the application has the advantages of high stability, high expression amount and good solubility, and the recombinant humanized type III collagen has significant effects of promoting cell proliferation and promoting cell adhesion.

[0021] In summary, compared with the prior art, the recombinant humanized type III collagen provided by the application has the following advantages:

[0022] (1) The advanced AI technology and molecular dynamics simulation are adopted in the application to design a new type III collagen sequence, which comprehensively improves the structural stability and anti-degradation of type III collagen, and solves the problems of poor stability and easy degradation of type III collagen.

[0023] (2) The amino acid sequence of the new recombinant humanized type III collagen provided by the application can be expressed and secreted in a yeast expression system, and the expression amount is high. The electrophoretic band brightness is 4 times that of the 66.2KD standard after the fermentation supernatant is diluted 10 times, and the band is single and the stability is high during the shaking flask, fermentation and purification process, and no degradation band appears.

[0024] (3) The recombinant humanized type III collagen provided by the application has strong solubility, and the solubility in a salt solution can reach 100g / L.

[0025] (4) The recombinant humanized type III collagen provided by the application has a significant effect of promoting the proliferation of human embryonic skin fibroblasts (ESF), and the cell proliferation rate of 0.03125mg / mL of the recombinant humanized type III collagen is 132.13%, which is 1.24 times that of 1mg / mL of bovine type I collagen standard.

[0026] (5) The recombinant humanized type III collagen provided by the application has a significant effect of promoting the adhesion of L929 cells, and the cell adhesion rate of 1mg / mL of the recombinant humanized type III collagen is 78.66%, which is 2.69 times that of 2mg / ml of bovine type I collagen standard. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1The schematic diagram for constructing the recombinant humanized collagen type III plasmid pPICZαA-hcc6.

[0028] Figure 2 The SDS-PAGE electrophoretogram of the recombinant humanized collagen type III expressed in a shake flask, (M: Marker; 1: negative control, 2-7: the recombinant humanized collagen type III Pichia pastoris genetic engineering bacteria shake flask expression verification).

[0029] Figure 3 The SDS-PAGE electrophoretogram of the recombinant humanized collagen type III fermentation supernatant, (M: Marker; 1-5: the SDS-PAGE electrophoretogram of the sample diluted by 10 times after induction for 0h, 24h, 48h, 72h and 88h, respectively).

[0030] Figure 4 The SDS-PAGE electrophoretogram of the purified recombinant humanized collagen type III, (1: the recombinant humanized collagen type III; M: Marker).

[0031] Figure 5 The HPLC detection result diagram of the purified recombinant humanized collagen type III.

[0032] Figure 6 The ESF cell proliferation rate result diagram of the recombinant humanized collagen type III, (NC: blank control, PC: bovine collagen type I standard).

[0033] Figure 7 The ESF cell proliferation rate and cell state observation result diagram of the recombinant humanized collagen type III.

[0034] Figure 8 The L929 cell adhesion rate result diagram of the recombinant humanized collagen type III, (NC: blank control, reference: bovine collagen type I standard).

[0035] Figure 9 The L929 cell relative adhesion result diagram of the recombinant humanized collagen type III, (NC: blank control, reference: bovine collagen type I standard).

[0036] Figure 10 The L929 cell adhesion result diagram of the recombinant humanized collagen type III, (NC: blank control, reference: bovine collagen type I standard, PC: 0.1% gelatin). DETAILED DESCRIPTION

[0037] The application is further described below by the description of specific embodiments, but this is not a limitation to the application, and those skilled in the art can make various modifications or improvements according to the basic idea of the application, as long as the modifications or improvements do not deviate from the basic idea of the application, and are within the scope of the application. In the following examples, the experimental methods are conventional methods unless otherwise specified; and the materials, reagents, etc. used are commercially available reagents and materials unless otherwise specified.

[0038] Example 1, design and synthesis of recombinant humanized collagen type III gene

[0039] 1. Amino acid sequence of recombinant humanized collagen type III:

[0040] The application is based on human collagen type III alpha 1 chain, a 10-triplet long window is slid along the triple helix region, and the stability score of each window is calculated according to the scoring function; SEQ ID NO. 1 and SEQ ID NO. 2, which are sequence fragments with GPP at both ends, are selected from the sequence fragments with high scores, and are spliced in order to obtain the target sequence fragment SEQ ID NO. 3 monomer; the target sequence fragment SEQ ID NO. 3 monomer is used as a unit to perform 10 times of tandem repeats, and finally the amino acid peptide shown as SEQ ID NO. 4 is spliced at the tail to obtain the recombinant humanized collagen type III amino acid sequence shown as SEQ ID NO. 5.

[0041] (1) The amino acid sequence of the amino acid peptide with GPP at both ends is (SEQ ID NO: 1):

[0042] GPPGKNGETGPQGPPGPTGPGGDKGDTGPP.

[0043] (2) The amino acid sequence of the amino acid peptide with GPP at both ends is (SEQ ID NO: 2):

[0044] GPPGPRGNRGERGSEGSPGHPGQPGPPGPP.

[0045] (3) The amino acid of the monomer is (SEQ ID NO: 3):

[0046] GPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPP.

[0047] (4) The amino acid sequence of the amino acid peptide spliced at the tail is (SEQ ID NO: 4):

[0048] GPPGPCCGGG.

[0049] (5) the amino acid sequence of the recombinant humanized collagen type III is (SEQ ID NO: 5):

[0050] GPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGPCCGGG.

[0051] 2. the nucleotide sequence of the recombinant humanized collagen type III is:

[0052] The amino acid sequence of the above-mentioned recombinant humanized collagen type III is designed according to the codon bias of Pichia pastoris to obtain the corresponding nucleotide sequence, and the nucleotide sequence of the recombinant humanized collagen type III is optimized according to the codon bias of Pichia pastoris to obtain the nucleotide sequence of the recombinant humanized collagen type III as shown in SEQ ID NO. 6. Nanjing Kingsrui Biological Technology Co., Ltd. is entrusted to synthesize.

[0053] The nucleotide sequence of the recombinant humanized collagen type III is (SEQ ID NO: 6):

[0054] ggaccacccggcaaaaatggagagaccggtccacaaggtcctccgggcccgactggcccgggtggggacaagggagatactggcc

[0055] caccggggcctagagggaaccgtggggaacggggttcggagggatctcccggacatcctggccagccgggtccccccggaccgcccg

[0056] gtaagaatggcgaaacgggacctcaagggcccccaggtccgactggtcccggcggcgataaaggtgacacaggtccgcccggtccacg

[0057] gggaaaccgcggcgagcgcggctcggaaggttctcctggtcatcctgggcaaccaggcccaccgggcccgcccggaaagaatggtgag

[0058] acaggtccgcagggccctccagggcccacggggcctggtggggacaagggggacacaggacctcctggtccccgtggaaaccggggt

[0059] gaaagaggatccgagggttctcccgggcacccaggtcaaccgggtccccctgggcccccaggaaagaatggcgagaccggacctcaag

[0060] gtcccccgggacccactggtcctggcggggataagggggatacaggacccccgggtcctaggggaaaccgaggtgagaggggatccg

[0061] aagggtcgcccggccatccaggccagcctgggccgcccggcccaccgggcaagaatggagaaactgggcctcaaggcccaccgggac

[0062] caaccgggcctggtggcgacaaaggtgatactggaccgccgggtccaaggggtaatcgcggtgaacgaggaagtgagggaagtccagg

[0063] ccacccagggcagcccggaccccctggccctcctgggaagaatggggagacgggtccccaagggccaccaggtccaaccggccctgg

[0064] aggtgacaaaggggatacgggcccaccagggccccgaggcaaccgaggcgagagaggttccgaggggagccccgggcaccctggac

[0065] aacccgggcctcccggaccccctgggaaaaatggggaaacaggcccgcagggcccccctggaccgacgggtccagggggcgacaag

[0066] ggtgacacagggccccccggcccaagaggaaaccgcggggaaagaggatcagaaggtagcccggggcatccaggacagccgggacc

[0067] accaggacctcccggtaaaaacggggaaacgggcccacaggggcccccgggccctaccgggccaggcggcgacaaaggtgatacag

[0068] gtcccccaggcccgagggggaacagaggagagcggggcagcgaagggtcccctggtcacccagggcaacctggtccgcctggaccac

[0069] cagggaaaaatggggaaactgggccgcaaggcccaccggggcctaccggacccgggggagataaaggtgacaccggccctcctgggc

[0070] cgcgtggcaatcgtggagaacgtggaagtgagggctcaccgggccacccgggacagcctggtcccccgggaccacccggaaagaacg

[0071] gtgaaactggcccacagggccccccgggtccgacgggcccggggggggataaaggagatacgggacctccaggaccgcggggcaaccgcggagagaggggatctgagggatcaccgggccatcctggccagcccggacctccggggccacccggtccttgttgcggtggcggt.

[0072] 3. Construction of recombinant plasmid:

[0073] The nucleotide sequence of the synthesized recombinant humanized collagen type III was constructed into the pPICZαA vector to obtain a recombinant humanized collagen type III plasmid, named pPICZαA-hcc6. The schematic diagram of the recombinant humanized collagen type III plasmid pPICZαA-hcc6 constructed by the present application is shown in Figure 1 .

[0074] Example 2, Preparation of recombinant humanized collagen type III genetically engineered bacterial strain

[0075] 1. Preparation of linearized plasmid:

[0076] The recombinant humanized collagen type III plasmid pPICZαA-hcc6 prepared in Example 1 was linearized by single enzyme digestion, and then recovered by ethanol precipitation after enzyme digestion with Sac I. The recombinant humanized collagen type III linearized plasmid was obtained.

[0077] 2. Preparation of yeast competence:

[0078] The Pichia pastoris strain X-33 was inoculated into YPD liquid medium, and cultured overnight at 28°C and 220 rpm. The OD600 value of the bacterial solution was determined. The initial OD600 value was 0.5, and the bacterial solution was inoculated into 50 mL of YPD liquid medium and cultured until the OD600 value was 1.3-1.5. After centrifugation at 4°C and 3000 g for 5 min, the culture medium was discarded. The yeast cells were resuspended with 50 mL of sterile water, and then centrifuged at 4°C and 3000 g for 5 min. The supernatant was discarded. The yeast cells were resuspended with 25 mL of sterile water, and then centrifuged at 4°C and 3000 g for 5 min. The supernatant was discarded. The yeast cells were resuspended with 1 mL of pre-cooled sorbitol, and then centrifuged at 4°C and 3000 g for 5 min. The supernatant was discarded. The yeast cells were resuspended with 100 μL of pre-cooled sorbitol, and then the bacterial solution was aliquoted at 80 μL per tube.

[0079] 3. Transformation of Pichia pastoris bacteria:

[0080] Take 10 μL prepared recombinant type III humanized collagen linearized plasmid into Pichia pastoris competent cells, mix uniformly, then transfer to the pre-cooled electric transfer cup on ice, and ice-bath for more than 5 min. Wipe the outer wall of the electric transfer cup, put it into the electric shock instrument, then add 1 mL sorbitol suspension of bacterial cells, and then transfer the liquid to a 1.5 mL centrifuge tube, and incubate at 28°C for 3-12 h, then inoculate on a YPD plate containing 0.1 mg / mL bleomycin, and incubate at 28°C until colonies grow.

[0081] 4. Recombinant type III humanized collagen genetically engineered bacterial strain expression verification:

[0082] Pick a single colony in 10 mL BMYG medium, and incubate at 28°C, 220 rpm until OD600 = 2-6. Centrifuge at 3000g for 5 min, resuspend the yeast cells with 10 mL BMMY medium to make OD600 = 1, and continue to incubate at 28°C, 220 rpm, and add methanol every 24 hours to a final concentration of 0.5%. After 72 h of induction, centrifuge to obtain the supernatant, and send it for SDS-PAGE electrophoresis detection.

[0083] The SDS-PAGE electrophoresis detection result of the recombinant type III humanized collagen prepared by the present application is shown in Figure 2 . Figure 2 It is a recombinant type III humanized collagen shake flask expression SDS-PAGE electrophoretogram, (M: Marker; 1: negative control, 2-7: recombinant type III humanized collagen Pichia pastoris genetically engineered bacterial shake flask expression verification), from Figure 2 It can be seen that the new recombinant type III humanized collagen amino acid sequence provided by the present application is successfully expressed and secreted in the Pichia pastoris expression system.

[0084] Example 3, preparation of recombinant type III humanized collagen

[0085] 1. Recombinant type III humanized collagen fermentation:

[0086] Inoculate the recombinant type III humanized collagen expression strain prepared in Example 2 into YPD medium, and incubate at 28°C, 220 rpm until the seed liquid concentration OD600 = 15-25, and there is no foreign bacteria under microscopic examination. Inoculate the seed liquid into a 20 L fermenter (containing 8 L BS medium) at a 5% inoculation amount, and the initial culture conditions are: rotation speed 100 rpm, tank pressure 0.05 MPa, control pH 5.2, and temperature 30°C. Control the dissolved oxygen above 30% by adjusting the air flow and stirring speed.

[0087] When the carbon source in the initial fermentation medium was depleted, dissolved oxygen rose sharply, and 50% glycerol was added to replenish the carbon source. Once the carbon source (50% glycerol) was exhausted, glycerol feeding was stopped, and methanol was added to initiate induction. Dissolved oxygen (DO) was maintained above 5% by adjusting the turbine rotation speed, air flow rate, and methanol flow rate. Fermentation supernatants were collected at 0h, 24h, 48h, 72h, and 88h for SDS-PAGE electrophoresis analysis.

[0088] The SDS-PAGE electrophoresis image of the fermentation supernatant of recombinant type III humanized collagen prepared in this invention is shown below. Figure 3 As shown. Figure 3 This is an SDS-PAGE electrophoresis image of the fermentation supernatant of recombinant type III humanized collagen (M: Marker; 1-5: SDS-PAGE electrophoresis images after 0h, 24h, 48h, 72h, and 88h induction, and after a 10-fold dilution of the sample). Figure 3 It can be seen that after 88 hours of induction, the supernatant of fermentation diluted 10 times had an electrophoretic band brightness that was 4 times that of the 66.2KD standard, and an electrophoretic purity of 95.2%.

[0089] 2. Purification of recombinant type III humanized collagen:

[0090] Fermentation was terminated after 88 hours of induction, and the fermentation product was obtained. The fermentation product was centrifuged at 10℃ and 9000 rpm for 20 min to obtain the fermentation filtrate. The fermentation filtrate was used to capture proteins through a cation exchange medium and eluted with elution buffer (10 mmol / L PB buffer, pH 8.0) to obtain recombinant type III humanized collagen. The purified recombinant type III humanized collagen was subjected to SDS-PAGE electrophoresis and HPLC detection.

[0091] The SDS-PAGE electrophoresis and HPLC detection results of the purified recombinant type III humanized collagen of this invention are as follows: Figure 4 and Figure 5 As shown. Figure 4 The image shows the SDS-PAGE electrophoresis results of purified recombinant type III humanized collagen (1: recombinant type III humanized collagen; M: marker). Figure 5 The figure shows the HPLC detection results of purified recombinant type III humanized collagen.

[0092] from Figure 4 It can be seen that the electrophoretic purity of the recombinant type III humanized collagen obtained by this invention is 97.3%. From Figure 5 It can be seen that the HPLC purity of the recombinant type III humanized collagen obtained by this invention is 92.49%.

[0093] Example 4: Solubility test of recombinant type III humanized collagen

[0094] 1. Experimental method:

[0095] The recombinant humanized collagen type III prepared in Example 3 was dissolved in 15 mL of PBS (pH 7.4) solvent to prepare a recombinant humanized collagen type III solution with a concentration of 10 g / L, 15 g / L, 25 g / L, 50 g / L, and 100 g / L. The time required for complete dissolution of the recombinant humanized collagen type III was recorded, and no precipitation occurred after standing for 30 min.

[0096] 2. Experimental results:

[0097] The experimental results are shown in Table 1.

[0098] Table 1. Solubility test results of recombinant humanized collagen type III

[0099]

[0100]

[0101] As shown in Table 1, the recombinant humanized collagen type III prepared in the present application has strong solubility, and the solubility in a salt solution can reach 100 g / L.

[0102] Example 5. Evaluation of cell proliferation activity of recombinant humanized collagen type III

[0103] 1. Experimental method:

[0104] 1.1. Grouping:

[0105] The positive control group (PC) was a standard bovine collagen type I from the China Institute for Drug Control, and the detection concentration was 1 mg / mL. The experimental sample group was the recombinant humanized collagen type III prepared in Example 3 of the present application, and the detection concentrations included 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.015625 mg / mL.

[0106] 1.2. Cell proliferation rate detection:

[0107] Each group of samples was prepared with DMEM medium and added to a 96-well plate, which was then refrigerated and left standing for 24 h. The medium in the wells was discarded, and human embryonic skin fibroblast (ESF) cells in good growth condition were taken, digested, and counted. After adjusting the cell density, the cells were inoculated into the 96-well plate and cultured for 24 h. The cells were observed under a microscope (100 μm) and photographed. 76 μL of CCK-8 working solution was added, and the plate was cultured in the dark for 1 h and shaken for 30 min. The absorbance value of each well at a wavelength of 450 nm was measured in an enzyme marker instrument, and the cell proliferation rate was calculated.

[0108] The cell proliferation rate is calculated according to the following formula:

[0109] Cell proliferation rate = OD 450e / OD 450b (OD 450e is the absorbance of the experimental sample group and the positive control group; OD 450b is the absorbance of the blank control group).

[0110] 2. Experimental results:

[0111] The experimental results are shown in Table 2 and Figures 6-7 .

[0112] 2.1. The results of the detection of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III are shown in Table 2:

[0113] Table 2. Results of the detection of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III

[0114]

[0115]

[0116] 2.2. The results of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III are shown in Table 2: Figure 6

[0117] Figure 2 is a graph showing the results of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III (NC is the blank control, and PC is the bovine collagen type I standard). Figure 6 2.3. The results of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III combined with the observation of the state of the cells are shown in Table 2:

[0118] Figure 7 Figure 3 is a graph showing the results of the proliferation rate of ESF cells treated with the recombinant humanized collagen type III combined with the observation of the state of the cells.

[0119] Figure 7 From Table 2 and , it can be seen that the cell proliferation rate of ESF cells treated with the recombinant humanized collagen type III at concentrations of 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL, and 0.015625 mg / mL is higher than that of the blank control group (NC) and the positive control group (PC), and the cell proliferation rate of ESF cells treated with the recombinant humanized collagen type III at a concentration of 0.03125 mg / mL is 1.24 times that of the bovine collagen type I standard at a concentration of 1 mg / mL.

[0120] Figure 6 ​​

[0121] From Figure 7 It can be seen from the cell number that the recombinant humanized type III collagen prepared in the application has a significant effect of promoting the proliferation of ESF cells at the concentrations of 2 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.25 mg / mL, 0.125 mg / mL, 0.0625 mg / mL, 0.03125 mg / mL and 0.015625 mg / mL.

[0122] Example 6, Evaluation of Cell Adhesion Activity of Recombinant Humanized Type III Collagen

[0123] 1. Experimental method:

[0124] 1.1, Grouping:

[0125] The reference is a bovine type I collagen standard from the China National Center for Food Safety Risk Detection, and the sample concentration is 2 mg / mL; the positive control group is a sigma gelatin, and the sample concentration is 0.1%; and the experimental sample group is the recombinant humanized type III collagen prepared in Example 3 of the application, and the sample concentration is 0.25 mg / mL, 1 mg / mL and 4 mg / mL.

[0126] 1.2, Cell adhesion rate detection:

[0127] Sample coating: add sample liquid to a 96-well plate and incubate at 37°C for 1 h. Wash once with PBS. Block with 1% BSA at 37°C for 1 h, and wash twice with PBS.

[0128] Cell plating, centrifugation and photographing: mouse skin fibroblast (L929) cells were digested; resuspended and counted, and the cell density was adjusted to 1×10 5 cells / mL, and Hoechst 33342 was added, immediately added to a 96-well plate, 100 μL per well. Incubate the cells at 37°C for 1 h. Seal with a plate film after adding culture medium, and centrifuge the culture plate upside down at 350g for 5 min. Wash with PBS.

[0129] The calculation formula of the cell adhesion rate V is as follows:

[0130] Cell adhesion rate V: V = number of cells after centrifugation / number of cells before centrifugation × 100%

[0131] The calculation formula of the relative cell adhesion P is as follows:

[0132] Relative cell adhesion P: P = average value of the adhesion rates of each duplicate well of the experimental sample / average value of the adhesion rates of each duplicate well of the negative control × 100%

[0133] 2. Experimental results:

[0134] The experimental results are shown in Table 3 and Figures 8-10 As shown.

[0135] 2.1 The adhesion rate of recombinant type III humanized collagen to L929 cells is shown in Table 3:

[0136] Table 3. Results of adhesion rate and relative adhesion of recombinant type III humanized collagen to L929 cells.

[0137]

[0138] 2.2 The adhesion rate and relative cell adhesion of recombinant type III humanized collagen to L929 cells are as follows: Figures 8-9 As shown:

[0139] Figure 8 The graph shows the adhesion rate of recombinant type III humanized collagen to L929 cells (NC is the blank control, and the reference standard is bovine type I collagen). Figure 9 The graph shows the relative adhesion of recombinant type III humanized collagen to L929 cells (NC is the blank control, and the reference standard is bovine type I collagen).

[0140] 2.3 Results of cell adhesion of recombinant type III humanized collagen to L929 cells are as follows: Figure 10 As shown:

[0141] Figure 10 The image shows the cell adhesion results of recombinant type III humanized collagen to L929 cells (NC is the blank control, bovine type I collagen standard is the reference, and PC is 0.1% gelatin).

[0142] From Table 3 and Figures 8-9 It can be seen that the adhesion rate of the recombinant type III humanized collagen prepared in this invention to L929 cells at concentrations of 4 mg / mL, 1 mg / mL and 0.25 mg / mL was significantly different from that of the blank group, and the cell adhesion rate of 1 mg / mL recombinant type III humanized collagen was 2.69 times that of 2 mg / mL bovine type I collagen standard.

[0143] from Figure 10 It can be seen that some L929 cells in the blank control group adhered and spread; cells in the 1 mg / mL reference standard (bovine type I collagen standard) sample group did not adhere or spread; and cells in the 4 mg / mL, 1 mg / mL and 0.25 mg / mL recombinant type III humanized collagen sample groups all showed significant adhesion and spread.

[0144] The above merely illustrates the further embodiments of the present application, but the protection scope of the present application is not limited thereto, any skilled in the art can make equivalent replacements or changes according to the technical scheme and concept of the present application within the disclosed scope, which shall all fall into the protection scope of the present application.

Claims

1. A recombinant humanized collagen type III, characterized in that, The amino acid sequence of the recombinant humanized collagen type III is shown as SEQ ID NO:

5.

2. A recombinant gene encoding a humanized collagen type III, characterized in that, The nucleotide sequence of the coding gene of the recombinant humanized collagen type III is shown as SEQ ID NO:

6.

3. A recombinant humanized collagen type III recombinant vector, characterized in that, The recombinant vector comprises the coding gene of the recombinant humanized collagen type III according to claim 2.

4. An engineered bacterial strain, characterized in that, The engineering strain comprises the coding gene of the recombinant humanized collagen type III according to claim 2 or the recombinant vector of the recombinant humanized collagen type III according to claim 3.

5. A composition characterized in that, The composition comprises the recombinant humanized collagen type III according to claim 1 and acceptable excipients.

Citation Information

Patent Citations

  • Recombinant III-type humanized collagen, nucleic acid, carrier and implant

    CN114085284A

  • Recombinant III-type humanized collagen and application thereof

    CN116987176A

  • Preparation method and application of recombinant full-length III type humanized collagen

    CN118773255A

  • Recombinant humanized III-type collagen as well as preparation method and application thereof

    CN116554305A

  • Recombinant III-type humanized collagen as well as coding gene and application thereof

    CN118684761A