Inducible promoter Pro50640 induced by low temperature, high salt, hypertonic or abscisic acid in plant and application of inducible promoter Pro50640

Abstract

The invention discloses an inducible promoter Pro50640 induced by low temperature, high salt, hypertonic or abscisic acid in a plant and application of the inducible promoter Pro50640. The promoter Pro50640 is obtained by cloning from an arabidopsis thaliana genome, and the nucleotide sequence of the promoter Pro50640 is as shown in SEQ ID NO. 1. A plant expression vector is constructed by using the promoter, and a plant transgenic test is carried out to obtain a transgenic plant. Experiments prove that the promoter Pro50640 provided by the invention can obviously enhance the expression level of the gene under the treatment conditions of low temperature, high salt, high permeability or abscisic acid. The invention provides an inducible efficient promoter for plant gene function research and genetic engineering breeding, and the inducible efficient promoter can be widely applied to cultivation of stress-resistant plant varieties, so that the purpose of obviously enhancing the expression level of stress-resistant genes under low-temperature, high-salt, high-permeability and abscisic acid treatment can be achieved; the method has important application value and prospect in crop genetic engineering breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to an inducible promoter Pro50640 induced by low temperature, high salt, hyperosmosis or abscisic acid in plants and an application thereof. Background Art

[0002] In the life cycle of plants, it is inevitable to suffer from various stresses from the external environment, such as low temperature, salinity, drought, etc., which seriously affect the growth and yield of crops. Therefore, how to improve the ability of crops to resist stress has become a research goal of many scientists. In plant genetic engineering research, the expression of exogenous target genes in receptors to improve the resistance of crops to adverse stresses such as low temperature, salinity, drought, and pests and diseases, or to improve crop agronomic traits, etc., has become an important means of current crop molecular breeding. It has been reported in the literature that in genetic engineering, stress-induced promoters are used to drive adversity-related genes to improve crop resistance while avoiding energy waste and yield loss caused by overexpression of stress-resistant genes. Therefore, stress-induced promoters are of great significance for cultivating practical stress-resistant crop varieties.

[0003] Driving transcription factors through stress-inducible promoters and then activating the expression of multiple stress-induced genes is an effective means to improve crop stress resistance. Most of the stress-inducible promoters reported so far are induced by a single stress, while there are relatively few studies on promoters induced by multiple stresses. Because during the entire growth process of plants, they are not only subjected to a single stress, but often to multiple stresses at different growth stages. Therefore, a single stress-inducible promoter has certain limitations in application, while multiple stress-inducible promoters will have more advantages in the application of improving the comprehensive stress resistance of plants.

[0004] Although there are a few reports on the isolation of stress-induced promoters from plants, the number of stress-induced promoters in important food crops, especially those induced by multiple stresses, is still significantly insufficient, which makes it difficult to meet actual needs and to carry out large-scale applications of plant genetic engineering. Summary of the invention

[0005] In view of the current status of the above-mentioned prior art, the purpose of the present invention is to provide an inducible Pro50640 promoter induced by low temperature, high salt, hyperosmosis or abscisic acid in plants and its application. The promoter provided by the present invention is a promoter induced by multiple adverse stresses such as low temperature, high salt, hyperosmosis, abscisic acid and abscisic acid, which enriches the types of promoters and meets the actual needs of application.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides an inducible promoter Pro50640 induced by low temperature, high salt, hyperosmosis or abscisic acid in plants, and the nucleotide sequence thereof is shown in SEQ ID NO.1.

[0007] Furthermore, the primer pair for cloning the promoter Pro50640 includes an upstream primer and a downstream primer, the DNA sequence of the upstream primer is shown in SEQ ID NO.2; the DNA sequence of the downstream primer is shown in SEQ ID NO.3; SEQ ID NO.2: GATTCCCTACATCTTGCCAT; SEQ ID NO. 3: GATGGTGGATTTAAGAGAAAGC.

[0008] The present invention provides a plant expression vector, a host or a host introduced with the plant expression vector containing the inducible promoter Pro50640 according to claim 1.

[0009] The present invention provides the use of the inducible promoter Pro50640 described in claim 1 in driving the expression of plant stress resistance genes.

[0010] Furthermore, the application comprises the following steps: (1) constructing a plant recombinant expression vector containing the inducible promoter Pro50640 that drives the efficient expression of stress resistance genes; (2) The plant recombinant expression vector is introduced into the plant through host-mediated transfer to obtain transformants, and the promoter Pro50640 drives the stress resistance gene to be efficiently expressed in the transformants.

[0011] Furthermore, the plant recombinant expression vector is pCAMBIA1301-Pro50640.

[0012] Furthermore, the plants are crops, including cotton, tobacco, soybean, rapeseed, rice and wheat.

[0013] Furthermore, the transformant is a cell line, callus tissue or transgenic plant.

[0014] Furthermore, the host is Agrobacterium.

[0015] The invention provides application of the inducible promoter Pro50640 in cultivating plant stress-resistant varieties.

[0016] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: the present invention uses the primer sequences shown in SEQ ID No. 2 and SEQ ID No. 3 to clone the promoter Pro50640 from the Arabidopsis genome by PCR cloning technology, and then uses the promoter to construct a plant expression vector of the reporter gene GUS, conduct a plant transgenic test, and obtain a transgenic plant. Experiments have shown that the promoter Pro50640 provided by the present invention can significantly enhance the expression level of the GUS reporter gene under low temperature, high salt, hyperosmotic or abscisic acid treatment conditions.

[0017] In the face of the current situation where ideal inducible promoters are extremely lacking in the stress-resistant breeding process, the present invention provides an inducible and efficient promoter for plant gene function research and genetic engineering breeding, which can be widely used in the cultivation of stress-resistant plant varieties, and can achieve the purpose of significantly enhancing the expression level of stress-resistant genes under low temperature, high salt, hyperosmosis and abscisic acid treatment. It has important application value and prospects in genetic engineering breeding of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : Electrophoresis diagram of PCR amplification of promoter Pro50640 of the present invention; Figure 2 : The plasmid PCR electrophoresis diagram of the promoter Pro50640 of the present invention connected to the expression vector pCAMBIA1301; Figure 3 : Schematic diagram of the plant expression vector pCAMBIA1301-Pro50640:GUS constructed by the present invention; Figure 4 : The promoter Pro50640 of the present invention drives the GUS gene under low temperature (4°C), high salt (NaCl), hyperosmotic (mannitol) or abscisic acid stress conditions to perform GUS histochemical staining; indicating that Pro50640 is a promoter strongly induced by low temperature, high salt, hyperosmotic and abscisic acid; Figure 5 : The GUS enzyme activity in the leaves of pCAMBIA1301-Pro50640:GUS transgenic Arabidopsis thaliana was detected under low temperature, high salt, hyperosmotic or abscisic acid treatment conditions, further proving that Pro50640 is a promoter strongly induced by low temperature, high salt, hyperosmotic and abscisic acid. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be fully described below in conjunction with the drawings in the embodiments of the present invention. The described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0020] Example 1: Cloning of promoter Pro50640 Arabidopsis thaliana young leaves were taken, and their genomic DNA was extracted using a plant genomic DNA extraction kit, and then detected by agarose gel electrophoresis. Then, the Arabidopsis thaliana genomic DNA was used as a template, the upstream primer was: GATTCCCTACATCTTGCCAT (SEQ ID NO.2), and the downstream primer was: GATGGTGGATTTAAGAGAAAGC (SEQ ID NO.3), and the candidate region of the Pro50640 promoter was amplified by PCR.

[0021] PCR reaction system: 12.5 μL high-fidelity DNA polymerase mixture, 1 μM primer, 2 μL template DNA, and sterile water to make up to 25 μL.

[0022] The PCR amplification reaction program was: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 min, 50°C annealing for 15 s, 72°C extension for 2 min, a total of 30 cycles, and stored at 4°C. The PCR products were detected by electrophoresis ( Figure 1 ), and sequenced to obtain the Pro50640 promoter of about 2000 bp in length, the sequence of which is SEQ ID NO.1 (2051 bp):

[0023] Example 2: Construction of plant expression vector and Agrobacterium transformation The pCAMBIA1301 vector was digested with Pst I and Nco I, and the large fragment was recovered for later use. Using the PCR product in Example 1 as a template, tcctctagagtcgacGATTCCCTACATCTTGCCAT (SEQ ID NO.4) and ttaccctcagatctaccatggGATGGTGGATTTAAGAGAAAGC (SEQ ID NO.5) were used for PCR amplification again, and the amplification conditions were the same as in Example 1. The PCR product was then purified and recovered, and the promoter target fragment was connected to the pCAMBIA1301 vector by homologous recombination, and positive recombinants were determined by PCR sequencing identification ( Figure 2 ). Thus, the plant recombinant expression vector pCAMBIA1301-Pro50640:GUS ( Figure 3 ).

[0024] The plant recombinant expression vector pCAMBIA1301-Pro50640:GUS was transformed into Agrobacterium GV3301 by electroporation. Arabidopsis seeds were sterilized with sodium hypochlorite and sown on the seedling medium, and then transferred to the soil one week later. After flowering, the inflorescence infection method was used to infect the Agrobacterium with pCAMBIA1301-Pro50640:GUS. Specifically, the Agrobacterium cultured at 28°C was cultured to OD600=0.8, resuspended with 5% sucrose solution, and infected and transformed by dipping the flowers. After infection, the plants grew normally in a tissue culture incubator (24°C, 16h / 8h day / night cycle). After harvesting the seeds, resistance screening was performed on a hygromycin medium containing 15mg / L to obtain transgenic seedlings.

[0025] Example 3: GUS activity analysis (1) Analysis of GUS expression activity in transgenic plants Seedlings of homozygous transgenic Arabidopsis T3 were subjected to various stress treatments and analyzed by GUS histochemical staining. Specifically, seedlings grown on MS medium for about 2 weeks were subjected to the following stress treatments: Low temperature treatment: seedlings were placed in MS liquid culture dishes and cultured at 4°C; High salt treatment: seedlings were cultured in MS liquid culture dishes containing 200 mM NaCl; Hyperosmotic treatment: seedlings were cultured in MS liquid culture dishes containing 250 mM mannitol; The control group was treated with MS liquid medium at room temperature. Then, the control and stress-treated seedlings were immersed in GUS staining solution (known formula), vacuumed and placed at 37°C overnight, then decolorized with 75% ethanol, and the staining was observed and photographed under a dissecting microscope.

[0026] Figure 4 The experimental results showed that under low temperature, high salt, hyperosmotic and abscisic acid stress conditions, the promoter Pro50640 was able to drive the GUS reporter gene to express at a high level in transgenic plants, showing a strong blue signal.

[0027] (2) Quantitative detection of GUS enzyme activity To further quantify the expression level of the GUS reporter gene driven by the promoter Pro50640, the present invention used the Blázquez method (Blázquez M. Quantitative GUS Activity Assay in Intact Plant Tissue. CSH Protoc. 2007: pdb.prot4688.) to measure the GUS enzyme activity of the transgenic Arabidopsis seedlings treated according to the above treatment method. The experimental results are as follows: Figure 5 As shown, the experimental results showed that the GUS activity under different stress treatments was 69.5, 66.9, 70.2 and 68.5 times that of normal culture, respectively, showing extremely significant differences.

[0028] The present invention shows through the above results that the promoter Pro50640 is strongly induced by low temperature, high salt, hyperosmosis and abscisic acid, and shows great application potential in crop breeding for stress resistance such as cold resistance, salt resistance and drought resistance.

[0029] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. An inducible promoter Pro50640 induced by low temperature, high salt, hyperosmotic pressure or abscisic acid in plants, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The inducible promoter Pro50640 according to claim 1, characterized in that The primer pair for cloning the promoter Pro50640 includes an upstream primer and a downstream primer, the DNA sequence of the upstream primer is shown in SEQ ID NO.2; the DNA sequence of the downstream primer is shown in SEQ ID NO.3; SEQ ID NO.2: GATTCCCTACATCTTGCCAT; SEQ ID NO. 3: GATGGTGGATTTAAGAGAAAGC.

3. A plant expression vector, a host containing the inducible promoter Pro50640 according to claim 1, or a host introduced with the plant expression vector.

4. Use of the inducible promoter Pro50640 according to claim 1 in driving the expression of plant stress resistance genes.

5. The use according to claim 4, characterized in that: The application comprises the following steps: (1) constructing a plant recombinant expression vector containing the inducible promoter Pro50640 that drives the efficient expression of stress resistance genes; (2) The plant recombinant expression vector is introduced into the plant through host-mediated transfer to obtain transformants, and the promoter Pro50640 drives the stress resistance gene to be efficiently expressed in the transformants.

6. The use according to claim 5, characterized in that: The plant recombinant expression vector is pCAMBIA1301-Pro50640.

7. The use according to claim 5, characterized in that: The plants are crop plants; including cotton, tobacco, soybean, rapeseed, rice and wheat.

8. The use according to claim 5, characterized in that: The transformant is a cell line, callus tissue or transgenic plant.

9. The use according to claim 5, characterized in that: The host is Agrobacterium.

10. Use of the inducible promoter Pro50640 according to claim 1 in breeding plant stress-resistant varieties.

Images