Method for improving soluble expression of recombinant N-acetyl glucosamine transferase IVa

Abstract

The invention discloses a method for improving the soluble expression quantity of recombinant N-acetyl glucosamine transferase IVa, which comprises the following steps: firstly, constructing truncated N-acetyl glucosamine transferase IVa (GnT-IVa-delta 87), constructing a recombinant expression plasmid pET28a-MBP-GnT-IVa-delta 87 by taking plasmid pET28a as a carrier and MBP as a protein tag, and carrying out a series of optimization aiming at protein expression conditions, so as to obtain the soluble expression quantity of the recombinant N-acetyl glucosamine transferase IVa (GnT-IVa-delta 87). Finally, the MBP-GnT-IVa-delta87 soluble protein is obtained, and the massive soluble expression of the MBP-GnT-IVa-delta87 is realized. The MBP-GnT-IVa-delta87 soluble protein obtained by the invention is used for catalyzing Fmoc-Asn-GlcNAc2Man3GlcNAc2, so that the conversion rate can reach 100%, and the result solves the bottleneck of enzymatic synthesis of the oligosaccharide structure GlcNAc2Man3GlcNAc3, lays a foundation for researching the physiological characteristics of a composite carbohydrate chain, promotes the development of carbohydrate chemistry and carbohydrate biology, and also provides a thought for the development of medicine glycoprotein.

Description

Technical Field

[0001] The invention belongs to the technical field of soluble expression of recombinant N-acetylglucosamine transferase IVa, and specifically relates to a method for improving the soluble expression of recombinant N-acetylglucosamine transferase IVa. Background Art

[0002] Glycosylation refers to the process of modifying proteins or lipids with sugars (oligosaccharides) to form sugar complexes, and is one of the main forms of post-translational modification in eukaryotic cells. The N-glycosylation modification of proteins directly affects the structure and function of proteins and has important physiological significance. N-oligosaccharides have various forms, and their biosynthetic pathways involve the participation of various glycosyltransferases. Therefore, the preparation and property research of glycosyltransferases is one of the important directions in the field of glycoscience. N-acetylglucosamine transferase IVa (GnT-IVa) is one of the key enzymes for the processing of N-sugar chains of glycoproteins in higher eukaryotic cells, catalyzing the formation of tripartite branched N-glycans.

[0003] At present, the expression of human N-acetylglucosamine transferase IVa has only been successfully achieved in insect cell, animal cell and yeast cell expression systems. The protein expressed in insect cells has been purified, but its yield is very low and the cost is high. That is, the in vitro large-scale active expression of GnT-IVa protein has not yet been achieved. Prokaryotic expression systems, such as Escherichia coli, have the advantages of high yield and few interfering proteins, and are ideal systems for in vitro large-scale expression of recombinant GnT-IVa proteins. However, there has been no report on the expression of human GnT-IVa by Escherichia coli. The main reason is that GnT-IVa is a membrane protein resident in the Golgi apparatus and is easily degraded in the prokaryotic system; at the same time, the prokaryotic expression of human proteins often produces a large number of inactive inclusion bodies due to high expression levels and too fast expression speed to fold correctly. In response to these problems, the inclusion bodies are usually dissolved and denatured with urea and then renatured. However, this process is cumbersome and has a low success rate.

[0004] Therefore, it is difficult in this field to express active GnT-IVa protein in large quantities using E. coli. Summary of the invention

[0005] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0006] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0007] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa.

[0008] In order to solve the above technical problems, the present invention provides the following technical solutions: comprising:

[0009] A truncated N-acetylglucosamine transferase IVa was constructed to obtain GnT-IVa-Δ87, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of which is shown in SEQ ID NO: 2;

[0010] Using plasmid pET28a as a vector and MBP as a protein tag, a recombinant expression plasmid pET28a-MBP-GnT-IVa-Δ87 with a nucleotide sequence as shown in SEQ ID NO: 3 was constructed;

[0011] The recombinant expression plasmid is transformed into a host bacterium to obtain a recombinant prokaryotic expression strain, the recombinant prokaryotic expression strain is cultured, and an inducer is added to induce expression, thereby achieving an increase in the soluble expression amount of the recombinant N-acetylglucosamine transferase IVa.

[0012] As a preferred embodiment of the method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa of the present invention, the N-acetylglucosamine transferase IVa is human N-acetylglucosamine transferase IVa.

[0013] As a preferred embodiment of the method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa of the present invention, the recombinant expression plasmid is transformed into a host bacterium, wherein the host bacterium is a prokaryotic host bacterium, including Escherichia coli Rosetta, Rosetta gami2, and BL21.

[0014] As a preferred embodiment of the method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa of the present invention, the conversion method comprises:

[0015] The recombinant expression plasmid is transferred into the competent cells of the host bacteria, incubated on ice, heat-shocked, transferred to ice, and finally coated on a solid plate containing the required antibiotics to achieve transformation.

[0016] As a preferred embodiment of the method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa of the present invention, the inducer is IPTG.

[0017] As a preferred embodiment of the method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa of the present invention, the induction concentration of IPTG is 0 to 1000 μM, and the induction time is 8 to 20 h.

[0018] As a preferred embodiment of the method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa of the present invention, the culturing of the recombinant prokaryotic expression strain comprises:

[0019] Inoculating the recombinant prokaryotic expression strain into a liquid culture medium, culturing the activated strain overnight, and then transferring to an expansion culture medium for expansion culture;

[0020] Wherein, the liquid culture medium is kanamycin liquid culture medium, and the expansion culture medium contains one or more of peptone, yeast powder, glycerol, and K2HPO4.

[0021] As a preferred embodiment of the method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa of the present invention, the method for inducing expression comprises:

[0022] The recombinant prokaryotic expression strain was cultured to OD 600 =0.6, move to 16℃ to cool down, add inducer and induce culture at 16℃.

[0023] As a preferred embodiment of the method for increasing the soluble expression level of recombinant N-acetylglucosamine transferase IVa of the present invention, the yield of the recombinant N-acetylglucosamine transferase IVa protein expressed by the method is 544 mg / L of culture medium.

[0024] As a preferred embodiment of the method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa of the present invention, the recombinant N-acetylglucosamine transferase IVa protein expressed by the method has a conversion rate of 100% for catalyzing Fmoc-Asn-GlcNAc2Man3GlcNAc2.

[0025] Beneficial effects of the present invention:

[0026] The present invention constructs a truncated N-acetylglucosamine transferase IVa (GnT-IVa-Δ87), uses plasmid pET28a as a vector and MBP as a protein tag to construct a recombinant expression plasmid pET28a-MBP-GnT-IVa-Δ87, performs a series of optimizations on protein expression conditions, and finally obtains MBP-GnT-IVa-Δ87 soluble protein, thereby achieving an increase in the soluble expression amount of MBP-GnT-IVa-Δ87.

[0027] The MBP-GnT-IVa-Δ87 soluble protein obtained by the present invention is used to catalyze Fmoc-Asn-GlcNAc2Man3GlcNAc2 to achieve a conversion rate of 100%. This result solves the bottleneck of enzymatic synthesis of the oligosaccharide structure GlcNAc2Man3GlcNAc3 and lays a foundation for studying the physiological properties of complex sugar chains, promotes the development of sugar chemistry and sugar biology, and also provides ideas for the development of medical glycoproteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0029] Figure 1 This is the result of Western blot detection of MBP-GnT-IVa-Δ87 in Example 1 of the present invention.

[0030] Figure 2 This is a diagram showing the results of protein purification detected by SDS-PAGE in Example 1 of the present invention.

[0031] Figure 3 This is a graph showing the results of in vitro activity detection of MBP-GnT-IVa-Δ87 in Example 1 of the present invention.

[0032] Figure 4 This is a graph showing the results of Western blot detection of the optimal IPTG induction concentration in Example 2 of the present invention.

[0033] Figure 5 This is a graph showing the results of Western blot detection of the optimal IPTG induction time in Example 3 of the present invention.

[0034] Figure 6 It is a comparison chart of the soluble components and insoluble components of the protein constructed in Example 1 of the present invention and the proteins constructed in Comparative Examples 1 to 4, and a quantitative analysis data chart thereof.

[0035] Figure 7 This is a comparison chart of the expression levels of the protein constructed in Example 1 of the present invention and the protein constructed in Comparative Example 5. DETAILED DESCRIPTION

[0036] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0037] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0038] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0039] The raw materials used in the present invention are all commercially available in the art unless otherwise specified, specifically:

[0040] Restriction endonucleases, TaqDNA polymerase, and ligase were purchased from TaKaRa, Japan. Oligosaccharide substrate Fmoc-Asn-GlcNAc2Man3GlcNAc2 was donated by the National Institute of Advanced Industrial Science and Technology, Japan. Gel recovery, PCR product purification, plasmid extraction kits, and IPTG were purchased from Shanghai Shenggong Biotechnology Co., Ltd., UDP-GlcNAc was purchased from Qingdao Shuge Co., Ltd., and other reagents were purchased from Sinopharm. Primer synthesis and sequencing were performed at Tianlin Biotechnology Co., Ltd.

[0041] The nucleotide sequences of the protein tags used in the specific examples and comparative examples of the present invention are shown in Table 1.

[0042] Table 1

[0043]

[0044]

[0045]

[0046] The detection method of protein expression effect in the present invention refers to:

[0047] Western blot detection of MBP-GnT-IVa-Δ87 recombinant protein

[0048] (I) Extraction of induced MBP-GnT-IVa-Δ87 recombinant protein

[0049] 1. Cultivate the E. coli expression strain containing pET28a-MBP-GnT-IVa-Δ87 plasmid and induce expression with IPTG;

[0050] 2. Add protein lysis buffer (25mM Tris-HCl pH 8.0, 0.15M NaCl) and disrupt the cells using ultrasound;

[0051] 3. Centrifuge at 9000g, 4°C for 30 min;

[0052] 4. Take 40 μL of supernatant and add 5× Loading Buffer, shake and mix, add the same volume of buffer to suspend the precipitate, take 40 μL and add 5× Loading Buffer, shake and mix;

[0053] 5. Boil in boiling water for 5 minutes, centrifuge at 18000g for 5 minutes, aspirate 5 μL of the supernatant for protein electrophoresis, and freeze the remaining sample at -20℃;

[0054] 6. Prepare SDS-PAGE gel and perform electrophoresis at 90V for 20min. When the sample enters the separation gel, perform electrophoresis at 180V until bromophenol blue runs out of the separation gel. Stop electrophoresis.

[0055] (II) Transfer

[0056] Use a paper cutter to cut out PVDF membrane and filter paper that are slightly larger than the glue. Soak the PVDF membrane in methanol for 1 minute and then put it into the transfer buffer. Soak two sets of 8 stacked filter papers in the transfer buffer. Put one set of 8 filter papers into the transfer membrane tank, then put in the PVDF membrane and protein glue, and finally stack another set of filter paper. Expel the bubbles and put the transfer tank into the instrument for transfer.

[0057] (III) Closure

[0058] After the transfer was completed, the PVDF membrane was taken out, placed in a 5% skimmed milk powder in PBST solution, and blocked on a shaker for 1 h.

[0059] (IV) Primary Antibody Incubation

[0060] The blocking solution was discarded, and Anti-His antibody (1:5000) was added and incubated on a shaking platform for 1 h.

[0061] (V) Secondary Antibody Incubation

[0062] Pour away the primary antibody, wash the PVDF membrane three times with 1×PBST, 10 min each time; add the corresponding secondary antibody (goat anti-mouse), and incubate on a shaker for 1 h.

[0063] (VI) ECL exposure

[0064] The secondary antibody was discarded, and the PVDF membrane was washed three times with 1×PBST, each time for 10 min; HRP chemiluminescent substrate solution was added to the PVDF membrane, and the protein expression signal was detected on the Tianneng chemiluminescent detector.

[0065] The standard enzyme activity detection system is as follows (50 μL): 100 mM MES / NaOH (pH 7.0), 10 mM MnCl2, 30 μM Fmoc-Asn-GlcNAc2Man3GlcNAc2, 2 mM UDP-GlcNA c, 200 μg / mL GnT-IVa-Δ87, and the reaction system is incubated at 37°C for more than 3 hours. After the reaction is completed, the reaction system is centrifuged at 18,000 g for 5 minutes, the supernatant is taken and detected by high performance liquid chromatography and the reaction system is compared with the standard sample.

[0066] The HPLC detection conditions are as follows: the instrument used is Alliance e2695HPLC (Waters), the fluorescence detector used is 2475FLR Detector (Waters), the liquid chromatography column used is an amino column (TOSHO TSKgel Amide-803μm 4.6×150mm), wherein the Fmo c-tagged sugar chain is detected, the excitation wavelength used by the fluorescence detector is 260nm, and the detection wavelength is 315nm; the elution conditions are acetonitrile (CH3CN)-ammonium acetate (NH4OAc) linear gradient elution (solution A: CH3CN; solution B: 0.1M NH4OAc pH 5.0; elution conditions: 0-30min, 80%-60%A; 30min-35min, 60%-80%A; 35-40min, 80%A; flow rate: 1mL / min) to separate the substrate and the product.

[0067] Example 1

[0068] 1) Construction of a recombinant prokaryotic expression vector of MBP-GnT-IVa-Δ87:

[0069] A truncated N-acetylglucosamine transferase IVa was constructed to obtain GnT-IVa-Δ87, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of which is shown in SEQ ID NO: 2;

[0070] Primers MBP-Fw, MBP-Rv, MBP-GnT-IVa-Δ87-Fw, and MBP-GnT-IVa-Δ87-Rv were designed, and their sequences are shown in Table 1 ;

[0071] Table 2

[0072] Primer name Sequence information MBP-Fw agactggaggaggaggatctgataataccctaaagctgtt MBP-Rv cttgtcatcgtcatcagatcctcctcctccagtctgcgcgtctttcaggg MBP-GnT-IVa-Δ87-Fw gatctgatgacgatgactaggataataccctaaagctgtt MBP-GnT-IVa-Δ87-Rv cagtggtggtggtggtggtgctcgaggttggtggcttttttaatat

[0073] Using pET28a as the expression plasmid and MBP as the protein tag, the vector was synthesized by a biological company to construct a recombinant prokaryotic expression vector of MBP-GnT-IVa-Δ87, and the nucleotide sequence is shown in SEQ ID NO:3.

[0074] 2) Construction of the recombinant prokaryotic expression strain of MBP-GnT-IVa-Δ87:

[0075] The recombinant prokaryotic expression vector of MBP-GnT-IVa-Δ87 was transformed into the Escherichia coli Rosetta (DE3) strain. Specifically, 1uL of plasmid (100ng / uL) was transferred into 50μL of Rosetta (DE3) competent medium, incubated on ice for 45min, heat shocked at 42°C for 1min, transferred to ice for 2min, and finally spread on a solid plate containing the required antibiotics.

[0076] The above-mentioned recombinant prokaryotic expression strain was activated by overnight culture. Specifically, a single colony that was successfully sequenced was selected and inoculated into a 50 μg / mL kanamycin liquid culture medium, and the activated strain was cultured overnight at 37° C. and 200 rpm.

[0077] The activated recombinant prokaryotic expression strain was transferred to a liquid culture medium containing the corresponding antibiotics. Specifically, the activated Rosetta (DE3) strain was transferred to a 50 μg / mL kanamycin liquid culture medium and cultured at 37°C with shaking until the OD 600 =0.6, the inducer IPTG was added at a final concentration of 100 μM, and the culture was induced at 16°C for 16 h to obtain the recombinant protein of MBP-GnT-IVa-Δ87.

[0078] Figure 1 This is the Western blot detection of MBP-GnT-IVa-Δ87 protein, 1: cell lysate before induction, 2: cell lysate after induction, antibody: anti-His. From the results, it can be seen that the MBP-GnT-IVa-Δ87 protein was successfully expressed.

[0079] 3) Purification and activity detection of MBP-GnT-IVa-Δ87 recombinant protein;

[0080] Step 2) After induction, the recombinant prokaryotic expression strain was centrifuged at 4°C, 9000g for 1min, the bacteria were collected, and the bacterial precipitate was suspended in 15mL of protein lysis buffer, and the cells were broken by ultrasonic disruptor, 5s each time, 5s interval each time, for a total of 30min; 9000g centrifugation for 30min, the supernatant was taken, and Ni affinity chromatography column purification was performed, and the target protein was eluted with protein lysis buffer containing 100mM and 500mM imidazole, respectively, and the purification results were detected by SDS-PAGE. The purified clean protein was concentrated using an ultrafiltration tube, and the desalting buffer was the cell lysis buffer. After concentration, the protein concentration was detected using a BCA kit. The purified enzyme was tested for in vitro activity.

[0081] Figure 2This is the result of SDS-PAGE detection of protein purification. From the results, it can be seen that the MB P-GnT-IVa-Δ87 recombinant protein was successfully purified.

[0082] Figure 3 (A) is a schematic diagram of the function of GnT-IVa protein. Figure 3 (B) is the HPLC detection chart of MBP-GnT-IVa-Δ87 protein activity, 1 represents the MBP-GnT-IVa-Δ87 reaction system and the substrate Fmoc-Asn-GlcNAc2Man3GlcNAc2 standard sample mixture; 2 represents the MBP-GnT-IVa-Δ87 reaction system; 3 represents the substrate Fmoc-Asn-GlcNAc2Man3GlcNAc2 standard sample; the injection volume is 25uL; it can be seen that the purified protein is active.

[0083] Example 2

[0084] This example is used to explore the optimal IPTG concentration for inducing expression of MBP-GnT-IVa-Δ87 protein, specifically:

[0085] The 100 μM inducer IPTG in Example 1 was adjusted to 0 μM, 10 μM, 25 μM, 50 μM, 75 μM, 100 μM, 200 μM, 500 μM, and 1000 μM, respectively, and induced and cultured at 16° C. for 16 h (uninduced bacteria were used as negative controls);

[0086] After induction, centrifuge at 9000g for 1 min at 4°C to collect the bacteria, resuspend the bacterial precipitate and 1.5 mL of negative control in cold buffer, and disrupt the cells using an ultrasonic disruptor for 2 s each time with an interval of 2 s for a total of 90 s; centrifuge at 9000g for 30 min, take the supernatant, and detect by Western blot to test the optimal expression of IPT G induction concentration.

[0087] Figure 4 This is the result of Western blot detection of the optimal IPTG induction concentration. From the results, it can be seen that the optimal induction concentration is 100μM, and there is no obvious difference in the expression levels of 100 and 500 visible to the naked eye. In order to save inducer, 100μM was selected.

[0088] Example 3

[0089] This example is used to explore the optimal time for inducing expression of MBP-GnT-IVa-Δ87 protein, specifically:

[0090] The induction time of 16 h in Example 1 was adjusted to 8 h, 10 h, 12 h, 14 h, 16 h, 18 h, and 20 h, respectively (pET28a-MBP bacteria were taken as negative control);

[0091] After induction, centrifuge at 9000g for 1 min at 4°C to collect the bacteria, resuspend the bacterial precipitate and 1.5 mL of negative control in cold buffer, and disrupt the cells with an ultrasonic disruptor for 2 s each time, with an interval of 2 s each time, for a total of 90 s; centrifuge at 9000g for 30 min, take the supernatant, and detect by Western blot to test the optimal expression induction time.

[0092] Figure 5 This is the result of Western blot detection of the optimal induction time ( Figure 5 A) and its quantitative analysis data diagram ( Figure 5 B), the results show that the optimal induction time for MBP-GnT-IVa-Δ87 protein expression is 16h.

[0093] Comparative Example 1

[0094] The difference between this comparative example and Example 1 is that the protein tag MBP is adjusted to Trx, and the remaining steps and processes are referred to Example 1 to obtain the Trx-GnT-IVa-Δ87 recombinant protein of this comparative example.

[0095] Comparative Example 2

[0096] The difference between this comparative example and Example 1 is that the protein tag MBP is adjusted to OmpA, and the remaining steps and processes are referred to Example 1 to obtain the OmpA-GnT-IVa-Δ87 recombinant protein of this comparative example.

[0097] Comparative Example 3

[0098] The difference between this comparative example and Example 1 is that the protein tag MBP is adjusted to PelB, and the remaining steps and processes are referred to Example 1 to obtain the PelB-GnT-IVa-Δ87 recombinant protein of this comparative example.

[0099] Comparative Example 4

[0100] The difference between this comparative example and Example 1 is that the protein tag MBP is adjusted to PhoA, and the remaining steps and processes are referred to Example 1 to obtain the PhoA-GnT-IVa-Δ87 recombinant protein of this comparative example.

[0101] The soluble protein expression of Comparative Example 1 and Comparative Examples 1 to 5 is as follows Figure 5 shown.

[0102] Figure 6 Comparison of soluble and insoluble components of MBP-GnT-IVa-Δ87 protein and other tags, signal peptide fused GnT-IVa-Δ87 protein ( Figure 6 A) and its quantitative analysis data diagram ( Figure 6 B). The protein samples were MBP-GnT-IVa-Δ87, Trx-GnT-IVa-Δ87, OmpA-GnT-IVa-Δ87, PelB-GnT-IVa-Δ87, and PhoA-GnT-IVa-Δ87; S: soluble protein; I: insoluble protein. The results showed that the MBP tag greatly enhanced the soluble expression of the recombinant protein, followed by the OmpA signal peptide.

[0103] Comparative Example 5

[0104] The difference between this comparative example and Example 1 is that a truncated N-acetylglucosamine transferase IVa, GnT-IVa-Δ27, with a nucleotide sequence as shown in SEQ ID NO:4, and an amino acid sequence as shown in SEQ ID NO:5 is constructed, and the remaining steps and processes are referred to Example 1 to obtain the MBP-GnT-IV a-Δ27 recombinant protein of this comparative example.

[0105] Furthermore, on the basis of the MBP-GnT-IVa-Δ27 recombinant protein, the MBP protein tag was replaced with the tag used in comparative examples 1 to 4 to obtain the Trx-GnT-IVa-Δ27 recombinant protein, OmpA-GnT-IVa-Δ27 recombinant protein, PelB-GnT-IVa-Δ27, and PelB-GnT-IVa-Δ27 recombinant protein of the present comparative example.

[0106] Comparing the expression levels of the recombinant protein of this comparative example with the recombinant protein of Example 1, the results are as follows Figure 7 As shown, the results showed that under the optimal expression conditions, the soluble protein yield of MBP-GnT-IVa-Δ87 was higher than that of MBP-GnT-IVa-Δ27.

[0107] In summary, the present invention constructed a truncated N-acetylglucosamine transferase IVa (GnT-IVa-Δ87), and used plasmid pET28a as a vector and MBP as a protein tag to construct a recombinant expression plasmid pET28a-MBP-GnT-IVa-Δ87. A series of optimizations were performed on the protein expression conditions, and finally the MBP-Gn T-IVa-Δ87 soluble protein was obtained, thereby achieving an increase in the soluble expression level of MBP-GnT-IVa-Δ87.

[0108] The MBP-GnT-IVa-Δ87 soluble protein obtained by the present invention is used to catalyze Fmoc-Asn-GlcNAc2Man3GlcNAc2 to achieve a conversion rate of 100%. This result solves the bottleneck of enzymatic synthesis of the oligosaccharide structure GlcNAc2Man3GlcNAc3 and lays a foundation for studying the physiological properties of complex sugar chains, promotes the development of sugar chemistry and sugar biology, and also provides ideas for the development of medical glycoproteins.

[0109] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa, characterized in that: include, A truncated N-acetylglucosamine transferase IVa was constructed to obtain GnT-IVa-Δ87, the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of which is shown in SEQ ID NO: 2; Using plasmid pET28a as a vector and MBP as a protein tag, a recombinant expression plasmid pET28a-MBP-GnT-IVa-Δ87 with a nucleotide sequence as shown in SEQ ID NO: 3 was constructed; The recombinant expression plasmid is transformed into a host bacterium to obtain a recombinant prokaryotic expression strain, the recombinant prokaryotic expression strain is cultured, and an inducer is added to induce expression, thereby achieving an increase in the soluble expression amount of the recombinant N-acetylglucosamine transferase IVa.

2. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 1, characterized in that: The N-acetylglucosamine transferase IVa is human N-acetylglucosamine transferase IVa.

3. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 1, characterized in that: The recombinant expression plasmid is transformed into a host bacterium, wherein the host bacterium is a prokaryotic host bacterium, including Escherichia coli Rosetta, Rosetta gami2, and BL21.

4. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 3, characterized in that: The conversion method comprises: The recombinant expression plasmid is transferred into the competent cells of the host bacteria, incubated on ice, heat-shocked, transferred to ice, and finally coated on a solid plate containing the required antibiotics to achieve transformation.

5. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 1, characterized in that: The inducing agent is IPTG.

6. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 5, characterized in that: The induction concentration of IPTG is 0-1000 μM, and the induction time is 8-20 hours.

7. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 1, characterized in that: The culturing of the recombinant prokaryotic expression strain comprises: Inoculating the recombinant prokaryotic expression strain into a liquid culture medium, culturing the activated strain overnight, and then transferring to an expansion culture medium for expansion culture; Wherein, the liquid culture medium is kanamycin liquid culture medium, and the expansion culture medium contains one or more of peptone, yeast powder, glycerol, and K2HPO4.

8. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 1, characterized in that: The method of inducing expression comprises: The recombinant prokaryotic expression strain was cultured to OD 600 =0.6, move to 16℃ to cool down, add inducer and induce culture at 16℃.

9. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to any one of claims 1 to 8, characterized in that: The yield of the recombinant N-acetylglucosamine transferase IVa protein expressed by the method is 544 mg / L of culture medium.

10. The method for increasing the soluble expression of recombinant N-acetylglucosamine transferase IVa according to claim 9, characterized in that: The conversion rate of the recombinant N-acetylglucosamine transferase IVa protein expressed by the method for catalyzing Fmoc-Asn-GlcNAc2Man3GlcNAc2 is 100%.

Images