Structural variation molecular marker related to Wenchang chicken feather color variation and application thereof

Abstract

The invention discloses a structural variation molecular marker related to Wenchang chicken feather color variation and application thereof, and relates to the field of gene detection, the structural variation marker sequence of the molecular marker is SEQ ID No: 01, the deletion site is on a Wenchang chicken reference genome ASM4043665v1, and the deletion site is Gallus gallus chick; the position of the probe in Genbank: GCA040436655.1 is CM080655.1: 9712333-9712763, and the probe in Genbank: GCA040436655.1 is CM080655.1 According to the present invention, the feather color containing the SEQ ID No: 01 structure variation marker sequence in the Wenchang chicken genome is deeper than the feather color of the individual without the SEQ ID No: 01 structure variation marker sequence, such molecular marker can be applied to the breeding detection kit of Wenchang chicken, and the powerful reference is provided for the directional breeding of the feather color.

Description

Technical Field

[0001] The invention relates to the field of biological gene detection, in particular to a structural variation molecular marker related to Wenchang chicken feather color variation and an application thereof. Background Art

[0002] Wenchang chicken generally refers to Hainan Wenchang chicken, which is a broiler breed originating from Hainan Province, China. Compared with other chicken breeds, Wenchang chicken has more prominent characteristics from appearance to meat quality. Research on chicken feather color traits helps to strengthen variety differentiation and identification. It is particularly important to establish significant identification between varieties and ensure the neat appearance of the same variety in breeding work. Birds in nature show rich feather colors, and feather color traits play an important role in avoiding natural enemies, predation, courtship and resisting ultraviolet rays. Therefore, there is a great market demand for feather color breeding of Wenchang chicken. The market has uniform requirements for the feather color of Wenchang chicken breeds. In order to meet market demand, a method is needed to be able to screen by detecting variations and be applied as a molecular marker in Wenchang chicken breeding. The present invention obtains a structural variation marker sequence used as a molecular marker for Wenchang chicken feather color breeding through detection and screening, solves such a problem, and can provide a powerful reference for the directional breeding of feather color in actual breeding work. Summary of the invention

[0003] In order to overcome the deficiencies in the prior art, the purpose of the present invention is to provide a structural variation molecular marker associated with Wenchang chicken feather color variation and its application. The present invention finds that the feather color of the Wenchang chicken genome containing the structural variation marker sequence is darker than the feather color of the individual lacking the sequence. Such molecular markers can be applied to the breeding detection kit of Wenchang chicken, providing a powerful reference for the directional breeding of feather color.

[0004] In order to achieve the above object, the present invention adopts the following technical solution: A structural variation molecular marker associated with Wenchang chicken feather color variation, the structural variation marker sequence is SEQ ID No: 01, the deletion site is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus (chicken); the position in Genbank: GCA_040436655.1 is CM080655.1: 9712333-9712763.

[0005] The aforementioned structural variation molecular marker related to Wenchang chicken feather color variation, the structural variation marker sequence is located in the LOC107052320 gene on chromosome chr1, and the structural variation breakpoint is in the flanking sequence of the Wenchang chicken genome ASM4043665v1: the upstream 30bp is GGAGGGTTCCAAGTTCAGATGACATTCTCC SEQ ID No:04, and the downstream 30bp is CTGGGCCTCAGGCCCTCAAAAACAAAGGA SEQ ID No:05.

[0006] The aforementioned structural variation molecular marker associated with Wenchang chicken feather color variation, the detection primers of the structural variation marker sequence include: Forward primer F is 5'-TACGCCAACCAAGTCACCAG 3' SEQ ID No:02; The reverse primer R is 5'-GTGAAGGGAAGAGACCTGGG 3' SEQ ID No:03.

[0007] The above-mentioned structural variation molecular marker is related to the feather color variation of Wenchang chicken. The feather color of the Wenchang chicken containing the structural variation marker sequence in the genome is darker than the feather color of the individual lacking the sequence.

[0008] The invention discloses an application of a structural variation molecular marker related to Wenchang chicken feather color variation, wherein the structural variation marker sequence is SEQID No: 01, the deletion site is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus (chicken); the position of the Genbank: GCA_040436655.1 is CM080655.1: 9712333-9712763; and the invention is applied to a directed breeding detection kit for Wenchang chicken feather color.

[0009] The present invention is beneficial in that: The present invention screens molecular markers that can provide a powerful reference for directional breeding of feather color through the newly disclosed Wenchang chicken genome ASM4043665v1, Gallus gallus (chicken); The present invention finds that the feather color of Wenchang chicken individuals lacking the structural variation marker sequence of SEQ No: 01 is significantly different from the feather color of individuals without the missing structural variation marker sequence, and the feather color of Wenchang chicken individuals containing the structural variation marker sequence in the genome is darker than the feather color of individuals lacking the sequence.

[0010] Technical terms: The flanking sequence refers to a non-translated nucleotide sequence outside the first exon and the last exon of the coding region. Genome ASM4043665v1: Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus (chicken); Genbank: GCA_040436655.1. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 It is the genotype frequency of the structural variation marker sequence of the present invention in each breed of chicken; (Genotye: genotype; Proportion: ratio;) Figure 2 It is the electrophoresis result of the structural variation marker sequence deletion verification of the present invention; (Pearl, Silver, Golden, White, Marker, Yellow) Figure 3 The diagram is a schematic diagram of the detection of the site of each feather color and the deletion site of the present invention. (Chromosome: chromosome, Conserved region: conserved region, Exon: exon, Repeat domain: DNA sequence region that appears repeatedly in the genome, SV: structural variation, Hap-colored: Hap-color, Hap-white: Hap-white, Structure: structure, annotation: annotation, Colored feather: colored feather, White feather: white feather). DETAILED DESCRIPTION

[0012] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0013] The following is a complete presentation of the screening process and detection process of the molecular markers of the present invention to verify the technical effect of the present invention: The samples and their sources are shown in Table 1: Table 1 A total of 354 individuals, including Wenchang chickens from 3 chicken farms.

[0014] Structural variation (SV) detection workflow 1. SV identification by next-generation sequencing Illumina paired-end sequencing data of 354 individuals were obtained, from which SVs were detected using the following algorithms: Read-pair (RP), Split-read (SR), Read depth (RD), and Assembly (AS). We combined multiple SV detection algorithms to maximize sensitivity by using six detection software: Manta, Delly, Wham, Smoove, Dysgu, and GRIDS2, and an ensemble of at least two algorithms from each software. The SVs obtained for each sample were merged using SURVIVOR software with the following parameters: 50 1 1 1 0 50. Then, the merged SVs were filtered using the following parameters: NA 50100000 0 -1. Next, the breakpoints of the SVs were refined according to their highest frequency positions.

[0015] 2. Assembly-based SV identification In addition to the genome ASM4043665v1, published assembled genomes of 30 samples from NCBI were used to detect assembly-based structural variation by constructing a pan-genome variation map. This step was done using the Pggb software with the parameters -p 95-s 10000 -T 20 --poa-params 1,9,16,2,41,1. Next, the vg toolkit was used in the deconstruct mode with default parameters to identify SVs of all autosomes and chromosome Z on ASM4043665v1. The generated vcf file contains SVs of all 31 assembled genomes.

[0016] The deletion site range is located at chr1: 9712333-9712763 in the genome ASM4043665v1; The position in genome ASM4043665v1 ( GCA_040436655.1 ) is CM080655.1:9712333-9712763.

[0017] The structural variation marker sequence is located in the LOC107052320 gene on chromosome chr1. The flanking sequence of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 is: 30 bp upstream GGAGGGTTCCAAGTTCAGATGACATTCTCC SEQID No:04, and 30 bp downstream CTGGGCCTCAGGCCCTCAAAAACAAAGGA SEQ ID No:05.

[0018] 3. Pan-genome map construction ASM4043665v1 was used as the backbone of the pan-genome graph, and previously identified NGS-based and assembly-based SVs were merged into the pan-genome variation graph using the construct module of the vg toolkit without removing any alternative alleles. The resulting pan-genome graph was then indexed in XG and GCSA formats using "vg index" with the "-L" parameter enabled for both formats. SVs are depicted as bubbles in the graph, and paths represent the corresponding alleles. These paths include the start and end nodes of the reference sequence, as well as the paths that traverse these nodes.

[0019] 4. Graph-based SV genotyping The pan-genome map was used to genotype 354 samples with high-depth sequencing (>10×). The clean reads of each sample were aligned with the map genome using "vgGiraffe" to obtain the result file in GAM format, excluding alignments with alignment quality <5 or base quality <5. Subsequently, "vg pack" was used to build the index under default parameters. On the constructed pan-genome map, "vg call" was used to generate SV genotyping results for 354 samples with parameters -v --bias-mode --het-bias 2,4.

[0020] 5. SV GWAS GWAS were performed on the SV dataset using linear mixed models using GEMMA96 (v1.0.3) and adjusted for sex, kinship, and population structure as cofactors. Kinship matrices were calculated using all SNPs in GEMMA, and population structure was determined using the first 10 principal components. Genome-wide significance thresholds were determined using a uniform threshold of 0.05 / n, where n represents the effective number of independent SVs and SNPs calculated using the genetic type I error calculator.

[0021] 6. Structural variation marker sequences A structural variation marker sequence was screened and used as a molecular marker for the breeding of Wenchang chicken, as shown in Table 2. The genotyping results showed that there were three genotypes: 0 / 0 (no deletion), 0 / 1 (heterozygous deletion), and 1 / 1 (homozygous deletion).

[0022] Table 2 Gene Location chromosome Deletion site Missing length SEQ ID No: Missing base sequence LOC107052320 exon chr1 9712333-9712763 430bp 01 TCTGGGCCTCAGGCCCTCAAAGACAATGGAGGAGGTCACACAATTTGTTGCATCACAGACACTCCTGGGTCCCTGCCCAGGTCTCTTCCCTTCACTTCCGTGCCCTCTGTCCTGCCCTCTTACCTCTGCCGCTGTTCACCATCCTGCTCTCCTCTGGCCTGGGCGAGCAGAGGGTGCAGCTCTTTCCTTGATCTACCTATGCCAACCATCTCGCC AATGCCTGTGTGAAACAGGAACTGCCAATGTTCTGCCTGCTGTGACATGACCACAGCATCACCAAGGCAGTTGCTAGCAGCTGATGCCCAAATTACAGCCAGGCTGGTGTTATTTTCATTACTTATCTTTGTATTGATGTCCACGTAGAAGGTGGGACATCTCTCCAGCTAAGCAGCAGAAGACAGGAGGGTTCCATGTTCAGAGGATGTTCTCCA The gene frequencies of structural variation marker sequences in various chicken breeds are as follows Figure 1 As shown: Structural variation marker sequence deletion experimental verification process: 1. The length of the structural variation marker sequence is 430 bp, so the detection primers were designed inside the deletion sequence, using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome), and the target fragment was 430 bp long and specific.

[0023] Forward primer F is 5'-TACGCCAACCAAGTCACCAG 3' SEQ ID No:02; The reverse primer R is 5'-GTGAAGGGAAGAGACCTGGG 3' SEQ ID No:03; 2. The blood samples used for verification were collected from Hainan Wenchang Longquan Wenchang Chicken Industrial Co., Ltd., and the TIANGEN KG204-01 blood direct PCR kit was used to directly configure the PCR reaction system as shown in Table 3: Table 3 Element volume Blood sample template 1.25 μl Forward primer F (10 μM) 0.625 μl Reverse primer R (10 μM) 0.625 μl 2× Blood Direct PCR MasterMix 12.5 μl RNase-Free ddH2O 10 μl 3. PCR reaction conditions: 95℃ pre-denaturation for 3 minutes, 95℃ denaturation for 15 seconds, 54℃ annealing for 20 seconds, 72℃ extension for 30 seconds, denaturation to extension for 30 cycles, 72℃ extension for 5 minutes 4. Electrophoresis: ① Make 2.0% agarose gel: 2.00g agarose is dissolved in 100ml 1% TAE, and 8μl Sparkred fluorescent nucleic acid staining reagent is added. ② Use a pipette to draw 5μl PCR amplification products and add them to the gel wells in sequence, and add 5μl DNA Maker (D2000) as a reference. ③ After 100V constant voltage electrophoresis for 30 minutes, observe under ultraviolet light and take photos for record.

[0024] 5. The electrophoresis results are as follows Figure 2 As shown, The presence of a band at 430 bp indicates that there is no deletion of the structural variation marker sequence, while the absence of a band indicates that there is a deletion of the structural variation marker sequence.

[0025] The gel holes are from left to right, and the feather color information is shown in Table 4: Table 4 Gel wells from left to right 1-3 4-6 7-9 10-16 17 18-24 Feather color Pearl Silver Golden White Marker Yellow From the above experiments, we can know that: at the same age, from Table 4 and Figure 2 It can be seen that the feather color of individuals lacking the structural variation marker sequence is significantly different from that of individuals without the deletion, and the feather color of the Wenchang chicken genome containing the structural variation marker sequence of the present invention is darker than the feather color of individuals lacking the sequence.

[0026] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A structural variation molecular marker associated with Wenchang chicken feather color variation, characterized in that: The sequence of the structural variation molecular marker is SEQ ID No: 01, and the structural variation molecular marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus chicken; the position in Genbank: GCA_040436655.1 is CM080655.1: 9712333-9712763, and the structural variation molecular marker is a deletion site.

2. The structural variation molecular marker associated with Wenchang chicken feather color variation according to claim 1, characterized in that: The sequence of the structural variation molecular marker is located in the LOC107052320 gene on chromosome chr1, and the flanking sequence of the structural variation breakpoint in the Wenchang chicken genome ASM4043665v1 is: 30 bp upstream is GGAGGGTTCCAAGTTCAGATGACATTCTCC SEQ ID No: 04, and 30 bp downstream is CTGGGCCTCAGGCCCTCAAAAACAAAGGA SEQ ID No:

05.

3. The structural variation molecular marker associated with Wenchang chicken feather color variation according to claim 1, characterized in that: The detection primers of the sequence of the structural variation molecular marker include: Forward primer F is 5'-TACGCCAACCAAGTCACCAG 3' SEQ ID No:02; The reverse primer R is 5'-GTGAAGGGAAGAGACCTGGG 3' SEQ ID No:

03.

4. The structural variation molecular marker associated with Wenchang chicken feather color variation according to claim 1, characterized in that: The feather color of the individuals of Wenchang chicken containing the sequence of the structural variation molecular marker in the genome is darker than that of the individuals lacking the sequence.

5. An application of structural variation molecular markers related to Wenchang chicken feather color variation, characterized in that: The sequence of the structural variation molecular marker is SEQ ID No: 01, and the structural variation molecular marker is on the Wenchang chicken gene reference genome ASM4043665v1, Gallus gallus chicken; the position of the structural variation molecular marker in Genbank: GCA_040436655.1 is CM080655.1: 9712333-9712763, and the structural variation molecular marker is a deletion site; and the invention is applied to a directed breeding detection kit for Wenchang chicken feather color.

Images