Kit for detecting cryptosporidium tizeri based on RPA (recombinase polymerase amplification) and preparation method thereof

Abstract

The invention discloses a kit and a method for detecting cryptosporidium tizeri based on an RPA (recombinase polymerase amplification) system, which are characterized in that an RPA technology is applied to the detection of cryptosporidium tizeri, and an RPA rapid detection system is established; the amplification process only needs 30 minutes, the time is shorter than 2 hours of conventional PCR, and the time is saved; the reaction temperature range is wide, the experiment can be completed at the constant temperature of 35 DEG C, and the temperature is far lower than 60-95 DEG C of the conventional PCR; the method has low professional requirements on operators, is suitable for grassroots veterinarian diagnosis, and can also be used for scientific research of cryptosporidium tigerum; the RPA primer of the cryptosporidium tizeri can be used for detecting 10 oocysts under the conditions that the temperature is 37 DEG C and the amplification is carried out for 30 minutes.

Description

Technical Field

[0001] The invention discloses a kit for detecting Cryptosporidium tyzeri based on RPA and a preparation method thereof, establishes an RPA detection system, solves the problem of long time consumption in detecting Cryptosporidium tyzeri infection in experimental mice, and belongs to the technical field of parasite detection. Background Art

[0002] Cryptosporidium is a common intestinal parasite with a wide distribution range that can infect humans and a variety of animals. Clinically, it can cause symptoms such as weight loss, malnutrition, and diarrhea, and induce immune responses in the infected host, and can even cause death in the host. Six species of Cryptosporidium have been identified in experimental rodents, including the zoonotic Cryptosporidium tyzeri ( Cryptosporidium tyzzeri ).

[0003] In terms of evolution, the infection site of Cryptosporidium tyzeri is similar to that of human cryptosporidiosis, mainly parasitizing the ileum, and it is similar to human Cryptosporidium ( C. hominis ) and Cryptosporidium parvum ( C. parvum ) is the most closely related species, so the mouse model of infection with Cryptosporidium tyzeri is used to study host protective immunity when infected with Cryptosporidium and evaluate vaccines.

[0004] Since most experimental rodents are the natural hosts of Cryptosporidium tyzeri, when a variety of rodents, especially mice, are kept in laboratory animal rooms, there is a risk of large-scale spread of Cryptosporidium tyzeri. When experimental animals are infected with Cryptosporidium tyzeri, it will seriously interfere with the experimental results, and the measured physiological, biochemical and immune indicators will be affected. In addition to the risk of Cryptosporidium tyzeri to humans, in summary, a sensitive and rapid detection method for Cryptosporidium tyzeri is established. Rapid detection of Cryptosporidium tyzeri infection in experimental rodents has practical significance. Summary of the invention

[0005] The present invention provides a kit for detecting Cryptosporidium tyzeri based on RPA and a preparation method thereof. The present invention also provides a specific primer pair for RPA detection of Cryptosporidium tyzeri, which is used for rapid diagnosis of Cryptosporidium tyzeri.

[0006] The specific primers for RPA detection of Cryptosporidium taize described in the present invention have the following specific primer sequences: Upstream primer: 5'- CTCATTATCGTATTACTCTCCGTTATAGTCTCCGCT -3' Downstream primer: 5'-TTCTACAGTTCTTGCCTTATTTGCTGGTGCGATGGT -3'.

[0007] The application method of a specific primer in RPA detection of Cryptosporidium taize described in the present invention comprises the following steps: 1) Extract genomic DNA from the sample to be tested; 2) RPA amplification: The specific operation is as follows: PBS is set as the negative control; Prepare a 50 μL reaction system: add 25 μL of buffer, 1.0 μL of the 10 μM upstream primer, 1.0 μL of the 10 μM downstream primer, 2.0 μL of the genomic DNA template, 18 μL of ddH20 and 3.0 μL of the initiator to the reaction tube containing the RPA freeze-dried particles; shake well to mix, centrifuge for 3 seconds, and place in a 37°C water bath for reaction for 30 minutes; after the RPA reaction is completed, draw the reaction solution for agarose gel electrophoresis, and observe the electrophoresis results for judgment; 3) Detection of RPA amplification products by gel electrophoresis: Detection of RPA amplification products by gel electrophoresis; detection of a 156 bp band indicates that the RPA sample is a positive sample.

[0008] The present invention discloses a Cryptosporidium Tyzer RPA detection kit, comprising some preparations: 1) RPA amplification reaction reagents: including reaction tubes containing RPA freeze-dried particles, reaction buffer, initiator and ddH2O; The components of the RPA freeze-dried particle reaction tube include recombinase, DNA polymerase, single-stranded DNA binding protein and dNTP; 3) The specific primers described: 10 μM upstream primer 1.0 μL, 10 μM downstream primer 1.0 μL.

[0009] The positive effects of the present invention are: the RPA technology is applied to the detection of Cryptosporidium taize, and an RPA rapid detection system is established; the amplification process only needs 30 minutes, which is less than the 2h time saved by conventional PCR; the reaction temperature range is wide, and the experiment can be completed at a constant temperature of 35°C, which is much lower than the 60°C-95°C of conventional PCR; the professional requirements for operators are low, and the method is suitable for primary veterinary diagnosis and can also be used for scientific research on Cryptosporidium taize; the RPA primers of Cryptosporidium taize can detect 10 oocysts under the conditions of 37°C and 30min amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 : The specific evaluation results of the RPA of the present invention for detecting the genomic DNA of Cryptosporidium tayzeri; Figure 2 : The reaction temperature optimization results of the RPA detection of Cryptosporidium tayzeri genomic DNA in the present invention; Figure 3: The reaction time optimization results of the RPA detection of Cryptosporidium tayzeri genomic DNA in the present invention; Figure 4 : The sensitivity evaluation results of RPA in detecting the genomic DNA of Cryptosporidium tayzei of the present invention; Figure 5 : An example of detecting Cryptosporidium tyzeri in 41 rat feces samples by RPA of the present invention. DETAILED DESCRIPTION

[0011] The present invention is further described by way of the following examples, which do not limit the present invention in any way. Without departing from the technical solution of the present invention, any modification or change made to the present invention that is easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention. Example 1

[0012] According to the gp60 gene of Cryptosporidium typhimurium reported in GenBank (GenBank: OQ835604.1), primers were designed using Primer Premier 5 software:

[0013] 2) Specificity test of RPA detection method Extract DNA from Cryptosporidium taize as a template, set PBS as a negative control, and use the RPA kit for detection. The specific operation is as follows: prepare a 50μL reaction system: add 25μL of buffer, 1.0μL of 10μM upstream primer, 1.0μL of 10μM downstream primer, 2.0μL of genomic DNA template, 18μL of ddH20 and 3.0μL of initiator to the reaction tube containing RPA freeze-dried particles. Vortex and mix thoroughly, centrifuge for 3s, and place in a 37℃ water bath for 30min. After the RPA reaction is completed, aspirate the reaction solution for agarose gel electrophoresis, and observe the electrophoresis results for judgment.

[0014] In order to detect whether the designed primers would cross-react with other susceptible parasites and pathogens of mice, DNA of pathogens such as Trichomonas muris and Escherichia coli was used as template, PBS was set as negative control, and RPA reaction was carried out according to the above reaction system to evaluate the detection specificity of the designed primers. Figure 1 As shown, only the genome of Cryptosporidium tyzeri produced amplified bands, indicating that this method has a strong specificity for detecting Cryptosporidium tyzeri.

[0015] 3) Optimization of reaction conditions for RPA detection: In order to determine the optimal reaction conditions of the detection method, the optimal reaction temperature and optimal reaction time of the RPA reaction were determined respectively with clear bands as the standard. The RPA reaction was carried out according to the system described in Example 2, and the reaction temperature optimization results were obtained as follows: Figure 2 As shown in Figure 2, the optimal reaction temperature is 37°C; the reaction time optimization results are shown in Figure 2 Figure 3 As shown, the optimal reaction time is 30 min.

[0016] 4) Sensitivity test; In order to determine the sensitivity of the detection method, genomic DNA was extracted from the purified Cryptosporidium tyzeri oocysts as a template for RPA reaction and gradient dilution was performed. RPA reaction was performed according to the system described in Example 2. The results are shown in FIG. Figure 4 As shown, the minimum detection limit is 10 oocysts.

[0017] Experimental Example 1: Detection of clinical samples by the established method; 41 fecal samples of experimental mice were collected to verify the clinical test effect of the detection method, and the conventional PCR test results were used as a control to verify the accuracy of the RPA detection method.

[0018] DNA from 41 stool samples was extracted as a template, PBS was set as a negative control, and RPA reaction was performed according to the system described in Example 1 (conventional PCR method was used for detection at the same time): 25 μL of buffer, 1.0 μL of 10 μM upstream primer, 1.0 μL of 10 μM downstream primer, 2.0 μL of genomic DNA template, 18 μL of ddH20 and 3.0 μL of initiator were added to the reaction tube containing RPA freeze-dried particles. Vortex and mix thoroughly, centrifuge for 3 seconds, and place in a 37°C water bath for reaction for 30 minutes. After the RPA reaction is completed, the reaction solution is aspirated for agarose gel electrophoresis, and the electrophoresis results are observed for evaluation. The results are as follows Figure 5 As shown: Among the samples tested by RPA and conventional PCR, 3 fecal samples showed positive characteristics, and the results described by the two methods were consistent. The results are shown in Table 2.

[0019] Table 2. Comparison of the results of RPA and conventional PCR detection of mouse feces samples

[0020] The invention designs RPA primers of Cryptosporidium taize by referring to the gp60 gene sequence of Cryptosporidium taize, establishes an RPA detection method, and obtains the amplification product at 37°C for about 30 minutes. The minimum detection limit of Cryptosporidium taize oocysts is 10, which provides an effective technical means for the rapid detection of Cryptosporidium taize.

Claims

1. A specific primer for RPA detection of Cryptosporidium taize, characterized in that The specific primer sequence is: Upstream primer: 5'- CTCATTATCGTATTACTCTCCGTTATAGTCTCCGCT -3' Downstream primer: 5'-TTCTACAGTTCTTGCCTTATTTGCTGGTGCGATGGT -3'.

2. A method for using the specific primers as claimed in claim 1 in RPA detection of Cryptosporidium taize, characterized in that The following steps are involved: 1) Extract genomic DNA from the sample to be tested; 2) RPA amplification: The specific operation is as follows: PBS is set as the negative control; Prepare a 50 μL reaction system: add 25 μL of buffer, 1.0 μL of the 10 μM upstream primer, 1.0 μL of the 10 μM downstream primer, 2.0 μL of the genomic DNA template, 18 μL of ddH20 and 3.0 μL of the initiator to the reaction tube containing the RPA freeze-dried particles; shake well to mix, centrifuge for 3 seconds, and place in a 37°C water bath for reaction for 30 minutes; after the RPA reaction is completed, draw the reaction solution for agarose gel electrophoresis, and observe the electrophoresis results for judgment; 3) Detection of RPA amplification products by gel electrophoresis: Detection of RPA amplification products by gel electrophoresis; detection of a 156 bp band indicates that the RPA sample is a positive sample.

3. A Taize Cryptosporidium RPA detection kit, characterized in that The kit contains the specific primers described in claim 1: 1) RPA amplification reaction reagents: including reaction tubes containing RPA freeze-dried particles, reaction buffer, initiator and ddH2O; 2) The components of the RPA freeze-dried particle reaction tube include recombinase, DNA polymerase, single-stranded DNA binding protein and dNTP; 3) The specific primers of claim 1: 1.0 μL of 10 μM upstream primer and 1.0 μL of 10 μM downstream primer.

Images