Development and application of molecular markers linked to eQTLs of key transcription factors for oil content in Brassica napus
By identifying the eQTL site qlec1.C03.1 on the C03 chromosome of Brassica napus and its closely linked SNP molecular markers, the problem of slow progress in breeding high-oil-content rapeseed was solved, achieving efficient molecular marker-assisted breeding and promoting the breeding process of high-oil-content rapeseed.
Patent Information
- Application Number
- CN202411668127.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-12-16
- Estimated Expiration
- 2044-11-21
AI Technical Summary
Existing technologies are insufficient to effectively identify key transcription factors and their upstream regulatory genes that contribute to the oil content of rapeseed seeds, resulting in slow progress in breeding high-oil-content rapeseed.
By identifying the eQTL site qlec1.C03.1 on the C03 chromosome of Brassica napus and its closely linked SNP molecular markers, we developed a molecular marker-assisted breeding method for detecting and predicting oil content, thereby enabling high oil content breeding.
It has accelerated the breeding process of high oil content rapeseed and provided an efficient molecular marker-assisted breeding method, which is suitable for large-scale promotion and application.
Smart Images

Figure CN119391897B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of plant molecular breeding, and particularly relates to development and application of an eQTL of a key transcription factor for oil content in Brassica napus and a molecular marker closely linked to the eQTL. BACKGROUND
[0002] Brassica napus is the first largest oil crop planted in China.
[0003] Triacylglycerol is biosynthesized as an energy reserve during seed maturation to support seed germination and seedling development. At present, a large number of studies focus on elucidating the complex transcriptional regulatory balance between seed development and seed oil content. However, seed oil content is a complex trait, and the transcriptional regulation of its biosynthesis is affected by developmental and environmental signals. The accumulation of seed oil is synergistically regulated by multiple transcription factors, including WRINKLED1 (WRI1) and the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON2 (LEC2), FUSCA3 (FUS3) and ABSCISIC ACID INSENSITIVE3 (ABI3) in the seed-specific LAFL gene regulatory network. These transcription factors play a core role in seed development and have an important impact on the accumulation of seed oil content. Through reverse genetics, some core transcription factors have been reported in Brassica napus and their important influence on seed oil content has been clarified. Therefore, mining the upstream regulatory genes of these core regulatory factors will improve the understanding of oil metabolism regulation mechanism and provide new gene resources for high oil content breeding of Brassica napus.
[0004] Therefore, through forward genetics, the eQTL of a key transcription factor in the accumulation of oil content in Brassica napus is identified, and a molecular marker is developed, which can be used for high oil content molecular marker-assisted breeding. SUMMARY
[0005] The application provides an eQTL qlec1.C03.1 of a key regulatory factor for oil content on C03 chromosome of Brassica napus, which affects the expression of a Brassica napus oil content regulatory factor BnaA09.LEC1 and plays a key role in the accumulation of oil content in Brassica napus. A molecular marker closely linked to the QTL site can be used for map-based cloning and molecular marker-assisted breeding, and is suitable for large-scale popularization and application.
[0006] To achieve the above object, the application provides application of a high-oil-content C03 chromosome QTL site qlec1.C03.1 of Brassica napus, which is between 4,235,655bp and 4,535,655bp of the C03 chromosome of the Brassica napus high-oil-content C03 chromosome major QTL site. The site can be used for detecting and predicting the high and low oil content of the Brassica napus, and can also be used for molecular marker assisted breeding of the high-oil-content Brassica napus, accelerates the breeding process of the high-oil-content Brassica napus, and is suitable for large-scale popularization and application.
[0007] The application provides a SNP molecular marker combination closely linked to the Brassica napus oil content gene BnaA09.LEC1, which comprises: SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465. The reference genome version thereof is: Zhongshuang 11 (ZS11.v0).
[0008] Further, the molecular marker SNP_Bna_C0304512029 is located at 4512029bp on the C03 chromosome of the Brassica napus, and the base at 4512029bp on the C03 chromosome is A or T, and the mutation causes polymorphism;
[0009] The molecular marker SNP_Bna_C0304512083 is located at 4512083bp on the C03 chromosome of the Brassica napus, and the base at 4512083bp on the C03 chromosome is T or C, and the mutation causes polymorphism;
[0010] The molecular marker SNP_Bna_C0304512236 is located at 451223bp on the C03 chromosome of the Brassica napus, and the base at 451223bp on the C03 chromosome is C or T, and the mutation causes polymorphism;
[0011] The molecular marker SNP_Bna_C0304513037 is located at 4513037bp on the C03 chromosome of the Brassica napus, and the base at 4513037bp on the C03 chromosome is T or G, and the mutation causes polymorphism;
[0012] The molecular marker SNP_Bna_C0304513324 is located at position 4513324 on the C03 chromosome of Brassica napus, wherein the base at position 4513324 on the C03 chromosome is G or A, and the mutation results in polymorphism;
[0013] The molecular marker SNP_Bna_C0304513788 is located at position 4513788 on the C03 chromosome of Brassica napus, wherein the base at position 4513788 on the C03 chromosome is C or T, and the mutation results in polymorphism;
[0014] The molecular marker SNP_Bna_C0304514134 is located at position 4514134 on the C03 chromosome of Brassica napus, wherein the base at position 4514134 on the C03 chromosome is T or C, and the mutation results in polymorphism;
[0015] The molecular marker SNP_Bna_C0304514465 is located at position 4514465 on the C03 chromosome of Brassica napus, wherein the base at position 4514465 on the C03 chromosome is G or A, and the mutation results in polymorphism;
[0016] Further, the primers or probes of the molecular marker SNP_Bna_C0304512029 are designed according to the DNA fragment of 400 bp sequence before and after position 4512029 on the C03 chromosome of Brassica napus as the template, and the DNA fragment is shown as SEQ ID NO: 1;
[0017] The primers or probes of the molecular marker SNP_Bna_C0304512083 are designed according to the DNA fragment of 400 bp sequence before and after position 4512083 on the C03 chromosome of Brassica napus as the template, and the DNA fragment is shown as SEQ ID NO: 2;
[0018] The primers or probes of the molecular marker SNP_Bna_C0304512236 are designed according to the DNA fragment of 400 bp sequence before and after position 4512236 on the C03 chromosome of Brassica napus as the template, and the DNA fragment is shown as SEQ ID NO: 3;
[0019] The primers or probes of the molecular marker SNP_Bna_C0304513037 are designed according to the DNA fragment of 400 bp sequence before and after position 4513037 on the C03 chromosome of Brassica napus as the template, and the DNA fragment is shown as SEQ ID NO: 4;
[0020] The primer or probe of the molecular marker SNP_Bna_C00_4514134 is designed according to the DNA fragment of the sequence of 400 bp before and after 4514134 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO: 7.
[0021] The primer or probe of the molecular marker SNP_Bna_C00_4513788 is designed according to the DNA fragment of the sequence of 400 bp before and after 4513788 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO: 6.
[0022] The primer or probe of the molecular marker SNP_Bna_C00_4514134 is designed according to the DNA fragment of the sequence of 400 bp before and after 4514134 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO: 7.
[0023] The primer or probe of the molecular marker SNP_Bna_C00_4514465 is designed according to the DNA fragment of the sequence of 400 bp before and after 4514465 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO: 8.
[0024] Further, by detecting the base sequences of SNP_Bna_C00_4512029, SNP_Bna_C00_4512083, SNP_Bna_C00_4512236, SNP_Bna_C00_4513037, SNP_Bna_C00_4513324, SNP_Bna_C00_4513788, SNP_Bna_C00_4514134 and SNP_Bna_C00_4514465, the Brassica napus is classified into haplotype hap.A, hap.B or hap.C, wherein hap.A is high-oil-content haplotype, and hap.B or hap.C is low-oil-content haplotype.
[0025] Further, the base sequence detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in the hap.A haplotype is AA, TT, CC, TT, GG, CC, TT and GG, the base sequence detected in the hap.B haplotype is TT, CC, TT, GG, AA, TT, CC and AA, and the base sequence detected in the hap.C haplotype is TT, CC, TT, GG, AA, CC, CC and AA.
[0026] The present application also provides the application of the molecular marker combination of any one of the above in any one of the following:
[0027] (1) the application in high-oil-content Brassica napus breeding;
[0028] (2) the application in Brassica napus whole genome breeding;
[0029] (3) the application in Brassica napus high oil trait evaluation;
[0030] (4) the application in Brassica napus high oil trait related variety screening;
[0031] (5) the application in Brassica napus high oil trait related variety identification;
[0032] (6) the application in Brassica napus high oil trait related variety molecular assisted breeding;
[0033] (7) the application in Brassica napus high oil trait related variety germplasm resource protection;
[0034] (8) the application in Brassica napus high oil trait related variety germplasm resource improvement.
[0035] Further, by detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in Brassica napus, the Brassica napus is classified into haplotype hap.A, hap.B or hap.C, wherein hap.A is a high-oil-content haplotype, and hap.B or hap.C is a low-oil-content haplotype.
[0036] Further, the base sequences detected by SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in hap.A haplotype are AA, TT, CC, TT, GG, CC, TT and GG, the base sequences detected in hap.B haplotype are TT, CC, TT, GG, AA, TT, CC and AA, and the base sequences detected in hap.C haplotype are TT, CC, TT, GG, AA, CC, CC and AA.
[0037] The present application also provides a method for detecting the oil content of Brassica napus, identifying or assisting in identifying the oil content of Brassica napus, predicting the oil content of Brassica napus, and assisting in breeding Brassica napus with high oil content, by detecting the base sequences of SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 in Brassica napus, wherein when the polymorphism of the combination of molecular markers is AA, TT, CC, TT, GG, CC, TT and GG, it corresponds to high oil content, and when the polymorphism of the combination of molecular markers is TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponds to low oil content.
[0038] The application further provides a method for identifying high-oil-content Brassica napus, wherein the combination of molecular markers is detected, and when the polymorphism of the combination of molecular markers is AA, TT, CC, TT, GG, CC, TT and GG, it corresponds to high-oil-content.
[0039] The application further provides a method for identifying low-oil-content Brassica napus, wherein the combination of molecular markers is detected, and when the polymorphism of the combination of molecular markers is TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, it corresponds to low-oil-content. BRIEF DESCRIPTION OF DRAWINGS
[0040] In order to more clearly illustrate the technical solutions of the embodiments of the application, the following will briefly introduce the drawings needed to be used in the embodiments. It should be understood that the following drawings only show some of the embodiments of the application, and therefore should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can also be obtained without creative labor on the basis of these drawings.
[0041] Figure 1 Schematic diagram of eQTL qlec1.C03.1 locus.
[0042] Figure 2 BnaA09.LEC1 expression in different haplotype materials. DETAILED DESCRIPTION
[0043] The following examples are only used to more clearly illustrate the technical solutions of the application, and therefore are only examples, and cannot limit the protection scope of the application. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in the present application should be understood as the usual meanings understood by those skilled in the art to which the application belongs. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0044] Example 1 Expression data of key transcription factor BnaA09.LEC1 of Brassica napus seed oil content
[0045] 273 Brassica napus core germplasm materials (from Huazhong Agricultural University) were planted in the experimental field of Huazhong Agricultural University. In the field test, each material was planted in 2 rows, and 10 plants were reserved in each row with a plant distance of about 20 cm.
[0046] At flowering, the siliques of each material were marked, and the seed samples were collected at 40 days after flowering (40DAF) for transcriptome sequencing. Total RNA was extracted using TIANGEN RNA prep plant reagent kit, 1.5 μg of RNA was used to construct a sequencing library, and the sequencing library was sequenced using UltraTMRNA library preparation kit was used to construct sequencing library. The constructed library was sequenced on Illumina Hiseq4000 platform to generate 150bp paired-end reads. FastQC software was used to control the quality of the reads. Filtered reads were aligned to Brassica napus reference genome (ZS11.v0) using STAR software (Dobin et al., 2013) for extracting segment sequencing depth. Salmon software (Patro et al., 2017) and tximport (Soneson et al., 2015) were used to obtain gene expression matrix. The genome was divided into 500bp windows, and each window was slid once every 250bp. The reads of each window were calculated using pysam, and then divided by the average reads of the variety to perform LOG2(TPM) standardization. The expression data of the key transcription factor BnaA09.LEC1 regulating the seed oil content of Brassica napus is shown in Table 1.
[0047] Table 1 Expression of transcription factor BnaA09.LEC1 in 273 Brassica napus seeds at 40DAF of seed development
[0048]
[0049]
[0050]
[0051] Example 2 Positioning eQTL qlec1.C03.1 by whole genome association analysis using the expression of BnaA09.LEC1
[0052] Genotype data for the whole genome association analysis was sampled from young leaf tissue, which was first rinsed in 10% ethanol and then ground to a powder in a mortar using liquid nitrogen. 700 μΐ of pre-warmed DNA extraction solution was added. After mixing, the sample was placed in a 65°C water bath for 1 h, with mixing every 10-15 min. 700 μΐ of a mixture (phenol:chloroform:isoamyl alcohol = 25:24:1) was added and mixed gently for 10 min. The sample was centrifuged at 10,000 x g for 15 min at room temperature. The supernatant was transferred to a new 2 mL centrifuge tube. An equal volume of a mixture (chloroform:isoamyl alcohol = 24:1) was added, mixed, and allowed to stand for 5 min. The sample was centrifuged at 10,000 x g for 15 min, and the supernatant was transferred to a new centrifuge tube. Two volumes of anhydrous ethanol were added, mixed, and allowed to stand at -20°C for 1 h. The sample was centrifuged at 10,000 x g for 10 min, and the supernatant was discarded. The pellet was washed with 500 μΐ of pre-cooled 75% ethanol, and the supernatant was discarded. The pellet was air-dried. 100 μΐ of a solution containing 2% RNase A was added, and the sample was allowed to stand at 37°C for 1 h and then at 4°C overnight. The DNA solution was extracted again with an equal volume of a mixture (chloroform:isoamyl alcohol = 24:1), mixed, and allowed to stand for 10 min. The sample was centrifuged at 10,000 x g for 15 or 20 min, and the RNase A was removed. The supernatant (about 60 μΐ) was transferred to a new tube and centrifuged for 1 min. The DNA concentration, quality, and integrity were determined using agarose gel electrophoresis (0.8%) and a UV spectrophotometer. The absorbance 260 / 280 ratio of all DNA samples was determined to be between 1.8 and 2.0. The DNA samples were then transported on dry ice to a sequencing company. Each material was sequenced to a depth of about 9x.
[0053] The genotype data was pre-processed by first using FastQC software to assess sequencing quality, and then filtering the sequencing sequences for adapters and low-quality reads. Clean data for each material was obtained by double-end sequencing, and then mapping was performed using bwa software and variant detection was performed using GATK software. After obtaining the total SNP data set for the association population, SNP data set quality filtering was performed according to a minimum allele frequency of ≥ 0.05, a deletion rate of ≤ 0.1, and a heterozygosity rate of ≤ 0.15. A high-quality population SNP data set was finally obtained for subsequent analysis.
[0054] In the whole genome association analysis, the mixed analysis model of 3VmrMLM was used, and 10,836,767 SNP and InDel markers were used, wherein the group structure matrix parameter was set as k = 4, the kinship matrix was calculated by 3VmrMLM, the svpal threshold parameter was set as 0.01, the threshold of P in the second step marker screening was 4.27e-09 (= 0.05 / m, wherein m is the number of markers), and the threshold of LOD was ≥ 3.0, and the QTL site related to the expression amount of BnaA09.LEC1 was identified in the whole genome range. Among them, one eQTL qlec1.C03.1 site was identified on C03 chromosome, which was located between 4,235,655 bp and 4,535,655 bp on C03 chromosome, and the LOD value of the site was 7.52 Figure 1 ).
[0055] Example 3 Haplotype analysis of qlec1.C03.1 linkage variation and oil content and BnaA09.LEC1 expression and development of molecular markers
[0056] Taking the lead SNP (SNP_Bna_C0304513037 at 4513037 on C03 chromosome) in the major QTL site of BnaA09.LEC1 on C03 chromosome as a reference, the range of 150 kb upstream and downstream thereof was defined as a QTL interval. In the QTL interval, linkage disequilibrium (LD) analysis was performed on each SNP and InDel marker, and the LD between each SNP marker and SNP_Bna_C0304513037 in the QTL interval was calculated, and the sites with R 2 greater than 0.6 were selected. Eight SNP molecular markers were identified.
[0057] According to these markers, 273 materials in the population were divided into haplotypes, and more than 80% of the materials were hap.A, hap.B and hap.C. Further haplotype analysis of BnaA09.LEC1 expression amount of materials corresponding to the three haplotypes was performed, and it was found that there was a significant difference Figure 2 ). It was also found that the lead SNP site (SNP_Bna_C0304513037) in the major QTL site qlec1.C03.1 was located in the BnaC03.MYB56 gene interval, and the expression amount of the gene was significantly related to BnaA09.LEC1 Figure 2). When the SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 detected base sequence is AA, TT, CC, TT, GG, CC, TT and GG combination, the Brassica napus sample is homozygous high-oil haplotype (haplotype: hap. A), the Brassica napus sample is homozygous low-oil haplotype when the SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134 and SNP_Bna_C0304514465 detected base sequence is TT, CC, TT, GG, AA, TT, CC and AA combination and TT, CC, TT, GG, AA, CC, CC and AA combination (i.e. haplotype: hap. B and hap. C), and part of the material 8 SNP molecular markers detection results and oil content and BnaA09.LEC1 gene expression data are listed in Table 2, wherein the detection method of oil content is: each material harvests 6 single plants with uniform growth and free pollination, and after natural air drying in the seed storage room, whole plant threshing is carried out, and 5 grams of seed after impurity removal are weighed, and NIRSy stems 5000 near infrared instrument of Foss Company is used to determine the seed oil content, and the instrument is provided by the public platform of the oilseed rape engineering technology research center of Huazhong Agricultural University.
[0058] Table 2 part of the material 8 SNP molecular markers detection results and oil content and BnaA09.LEC1 gene expression data
[0059]
[0060]
[0061] The 8 markers in the group are phenotypically grouped: when the 8 markers are combined as ATCTGCTG, the average oil content of the material is 51.94%, and the average expression of BnaA09.LEC1 is 2.67; when the 8 markers are combined as TCTGATCA, the average oil content of the material is 41.65%, and the average expression of BnaA09.LEC1 is 0.87; when the 8 markers are combined as TCTGACCA, the average oil content of the material is 44.67%, and the average expression of BnaA09.LEC1 is 0.96 (Table 2). Therefore, the above SNP molecular markers can be screened alone or combined in pairs, and used for screening and breeding of rapeseed seed oil content, which has good application prospect.
[0062] Specifically, for the above SNP molecular marker combination, corresponding primers or probes can be designed, which are used for high oil content molecular marker assisted breeding, wherein the primer or probe of the molecular marker SNP_Bna_C0304512029 is designed according to the DNA fragment of 400 bp sequence before and after the 4512029 bp of C03 chromosome of Brassica napus as a template, and the DNA fragment is shown as SEQ ID NO: 1;
[0063] The primer or probe of the molecular marker SNP_Bna_C0304512083 is designed according to the DNA fragment of 400 bp sequence before and after the 4512083 bp of C03 chromosome of Brassica napus as a template, and the DNA fragment is shown as SEQ ID NO: 2;
[0064] The primer or probe of the molecular marker SNP_Bna_C0304512236 is designed according to the DNA fragment of 400 bp sequence before and after the 4512236 bp of C03 chromosome of Brassica napus as a template, and the DNA fragment is shown as SEQ ID NO: 3;
[0065] The primer or probe of the molecular marker SNP_Bna_C0304513037 is designed according to the DNA fragment of 400 bp sequence before and after the 4513037 bp of C03 chromosome of Brassica napus as a template, and the DNA fragment is shown as SEQ ID NO: 4;
[0066] The primer or probe of the molecular marker SNP_Bna_C0304513324 is designed according to the DNA fragment of 400 bp sequence before and after the 4513324 bp of C03 chromosome of Brassica napus as a template, and the DNA fragment is shown as SEQ ID NO: 5;
[0067] The primer or probe of the molecular marker SNP_Bna_C03_4514465 is designed according to the DNA fragment of 400 bp sequence before and after 4514465 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO:8.
[0068] The primer or probe of the molecular marker SNP_Bna_C03_4514134 is designed according to the DNA fragment of 400 bp sequence before and after 4514134 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO:7.
[0069] The primer or probe of the molecular marker SNP_Bna_C03_4514465 is designed according to the DNA fragment of 400 bp sequence before and after 4514465 bp on the chromosome C03 of Brassica napus, and the DNA fragment is shown as SEQ ID NO:8.
[0070] Further, for example, the following primer set can be used:
[0071] The reagent for detecting the 4512029th base on the chromosome C03 of Brassica napus, i.e., the primer set F: ACCATCAAGCTCTCAAGAAG, R: ACGAAAACTACTTACATTTTGAA, is used in the breeding of Brassica napus with high oil content.
[0072] The reagent for detecting the 4512083th base on the chromosome C03 of Brassica napus, i.e., the primer set F: TGTTTTTGTTTCAAAATGTAAGT, R: AGTTTTGGCTAAAATGACGAA, is used in the breeding of Brassica napus with high oil content.
[0073] The reagent for detecting the 4512236th base on the chromosome C03 of Brassica napus, i.e., the primer set F: ATTGAATACAGTGTGACCAATC, R: ATATGTCACTGACGTTAGCTC, is used in the breeding of Brassica napus with high oil content.
[0074] The reagent for detecting the 4513037th base on the chromosome C03 of Brassica napus, i.e., the primer set F: GCCTTCTTCAACTCATCAGC, R: TCACTCGTTGTCGGTTGTAT, is used in the breeding of Brassica napus with high oil content.
[0075] The reagent for detecting the base at position 4513324 of C03 chromosome of Brassica napus is primer group: F: TGCTATACAACCGACAACGA, R: AAAGCCACTCTTCGTCTTCA, and the reagent is applied to high oil content breeding of Brassica napus.
[0076] The reagent for detecting the base at position 4513788 of C03 chromosome of Brassica napus is primer group: F: CGGGTTATTTCTAGCCATGT, R: GTTTGTTTGTTGTGCAATGC, and the reagent is applied to high oil content breeding of Brassica napus.
[0077] The reagent for detecting the base at position 4514134 of C03 chromosome of Brassica napus is primer group: F: ACATCCTCCATATTAGACCAGC, R: CAATGCTTTCTTCAAACGTCAG, and the reagent is applied to high oil content breeding of Brassica napus.
[0078] The reagent for detecting the base at position 4514465 of C03 chromosome of Brassica napus is primer group: F: TTCTCCTGATTTGACCAGCA, R: ATTAGTTTGGCACGTTTCCC, and the reagent is applied to high oil content breeding of Brassica napus.
[0079] The above specific embodiments describe the implementation of the present application in detail, but the present application is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concepts of the present application, various simple modifications and changes can be made to the technical solutions of the present application, and these simple modifications all belong to the protection scope of the present application.
Claims
1. A molecular marker combination, characterized in that, The molecular marker combination is: SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C0304512236, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465; their sequences are shown in SEQ ID NO:1-8 respectively; wherein, The SNP site in SNP_Bna_C0304512029 is located at 4512029 bp on chromosome C03 of Brassica napus. The base at this location is either A or T, and this mutation leads to polymorphism. The SNP site in SNP_Bna_C0304512083 is located at 4512083 bp on chromosome C03 of Brassica napus. The base is either T or C, and this mutation leads to polymorphism. The SNP site in SNP_Bna_C0304512236 is located at 451223bp on chromosome C03 of Brassica napus. The base at this location is either C or T. This mutation leads to polymorphism. The SNP site in SNP_Bna_C0304513037 is located at 4513037 bp on chromosome C03 of Brassica napus. The base at this location is either C or T, and this mutation leads to polymorphism. The SNP site in SNP_Bna_C0304513324 is located at 4513324 bp on chromosome C03 of Brassica napus. The base at this location is either T or G, and this mutation leads to polymorphism. The SNP site in SNP_Bna_C0304513788 is located at 4513788 bp on chromosome C03 of Brassica napus. The base at this location is either C or T. This mutation leads to polymorphism. The SNP site in SNP_Bna_C0304514134 is located at 4514134 bp on chromosome C03 of Brassica napus. The base at this location is either T or C. This mutation leads to polymorphism. The SNP site in SNP_Bna_C0304514465 is located at 4514465 bp on chromosome C03 of Brassica napus. The base at this location is either G or A. This mutation leads to polymorphism. The reference genome version of the Brassica napus mentioned is ZS11.v0.
2. The molecular marker combination according to claim 1, characterized in that, The primers used to detect the molecular marker combination are: The primers used to detect the molecular marker SNP_Bna_C0304512029 are: F: ACCATCAAGCTCTCAAGAAG, R: ACGAAAACTACTTACATTTTGAA; The primers used to detect the molecular marker SNP_Bna_C0304512083 are: F: TGTTTTTGTTTCAAAATGTAAGT, R: AGTTTTGGCTAAAATGACGAA; The primers used to detect the molecular marker SNP_Bna_C0304512236 are: F: ATTGAATACAGTGTGACCAATC, R: ATATGTCACTGACGTTAGCTC; The primers used to detect the molecular marker SNP_Bna_C0304513037 are: F: GCCTTCTTCAACTCATCAGC, R: TCACTCGTTGTCGGTTGTAT; The primers used to detect the molecular marker SNP_Bna_C0304513324 are: F: TGCTATACAACCGACAACGA, R: AAAGCCACTCTTCGTCTTCA; The primers used to detect the molecular marker SNP_Bna_C0304513788 are: F: CGGGTTATTTCTAGCCATGT, R: GTTTGTTTGTTGTGCAATGC; The primers used to detect the molecular marker SNP_Bna_C0304514134 are: F: ACATCCTCCATATTAGACCAGC, R: CAATGCTTTCTTCAAACGTCAG; The primers used to detect the molecular marker SNP_Bna_C0304514465 are: F: TTCTCCTGATTTGACCAGCA, R: ATTAGTTTGGCACGTTTCCC.
3. The use of the molecular marker combination according to any one of claims 1-2 in any of the following: (1) Application in the breeding of high-oil-content Brassica napus; (2) Application in the evaluation of high-oil trait in Brassica napus; (3) Application in the screening of varieties related to high oil content in Brassica napus; (4) Application in the identification of varieties of high-oil-content rapeseed; (5) Application in molecular-assisted breeding of varieties of high-oil-content rapeseed; (6) Application in the conservation of germplasm resources of varieties with high oil content in Brassica napus; (7) Application in the improvement of germplasm resources of varieties with high oil content in Brassica napus.
4. The application according to claim 3, characterized in that, By detecting the molecular marker combination described in claim 1, rapeseed can be classified into haplotypes hap.A, hap.B, or hap.C; wherein, In haplotype hap.A, the genotype sequences of the SNP loci in SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C030451223, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465 are AA, TT, CC, TT, GG, CC, TT, and GG, respectively. The genotype sequences of the SNP loci in haplotypes hap.B, namely SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C030451223, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465, are TT, CC, TT, GG, AA, TT, CC, and AA, respectively. In haplotype hap.C, the genotype sequences of the SNP loci in SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C030451223, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465 are TT, CC, TT, GG, AA, CC, CC, and AA, respectively. Among them, hap.A is a high-oil-content haplotype, while hap.B or hap.C is a low-oil-content haplotype.
5. A method for detecting, identifying, or assisting in the identification of oil content in Brassica napus, predicting oil content in Brassica napus, and assisting in the breeding of high-oil-content Brassica napus, characterized in that... Detection of the molecular marker combination as described in claim 1 in rapeseed, wherein, When the SNP loci genotype sequences in SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C030451223, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465 are AA, TT, CC, TT, GG, CC, TT, and GG respectively, they correspond to high-oil-content Brassica napus. When the genotype sequences of the SNP loci in SNP_Bna_C0304512029, SNP_Bna_C0304512083, SNP_Bna_C030451223, SNP_Bna_C0304513037, SNP_Bna_C0304513324, SNP_Bna_C0304513788, SNP_Bna_C0304514134, and SNP_Bna_C0304514465 are TT, CC, TT, GG, AA, TT, CC or TT, CC, TT, GG, AA, CC, CC, they correspond to low-oil-content Brassica napus.
Citation Information
Patent Citations
High throughput genome specific molecular markers for erucic acid content genes in brassica napus (l.)
CA2612505A1
SNP (Single Nucleotide Polymorphism) molecular marker related detection primer or probe for major QTL (Quantitative Trait Loci) of oil content character of cabbage type rape seeds and application of SNP molecular marker related detection primer or probe
CN114736986A