Protein coding gene from spinach tetrazolium and providing peronospora powder resistance and spinach plant containing same

Abstract

The present invention relates to a Spinacia tetrandra genomic DNA comprising a first or a second genomic DNA fragment, wherein the first or the second genomic DNA fragment comprises a gene encoding a protein that provides resistance to the plant pathogen Peronospora farinosa, and a method for producing the same. The present invention also relates to a method for producing the same. The present invention relates to a spinach tetrandra genomic DNA comprising a first or a second genomic DNA fragment, wherein the first or the second genomic DNA fragment comprises a gene encoding a protein that provides resistance to Peronospora farinosa. The invention also relates to a spinach plant which is resistant to the plant pathogen peronospora melastoma and comprises the first or second genomic DNA fragment. The invention also relates to methods of providing spinach plants resistant to the plant pathogen Peronospora melastoma and methods of identifying spinach plants resistant to the plant pathogen Peronospora melastoma. The invention also relates to the use of one or more nucleic acid sequences or amino acid sequences for providing or identifying plants against the plant pathogen Peronospora melastoma.

Description

[0001] The present invention relates to a four-core spinach (Spinacia tetrandra) genomic DNA comprising a first or second genomic DNA segment, wherein the first or second genomic DNA segment comprises a gene encoding a protein that provides resistance to the plant pathogen Peronospora farinosa. The present invention also relates to a spinach plant resistant to the plant pathogen Peronospora farinosa, which comprises the first or second genomic DNA segment. The present invention also relates to a method for providing a spinach plant resistant to the plant pathogen Peronospora farinosa and a method for identifying the spinach plant. The present invention also relates to the use of one or more nucleic acid sequences or amino acid sequences for providing or identifying plants resistant to the plant pathogen Peronospora farinosa.

[0002] Spinach is grown commercially around the world for its attractive and nutritious leaves. In 2018, global production of spinach was close to 26 million tonnes. Spinach (Spinacia oleracea or S. oleracea) is a member of the subfamily Chenopodioideae in the family Amaranthaceae. Other well-known members of the family include quinoa and beet. The latter is a cultivated plant of great agricultural importance, with examples including sugar beet, red beet and Swiss chard.

[0003] In terms of nutritional value, although spinach provides only a relatively small amount of calories (23 calories per 100 grams of cooked spinach), it is a rich source of vitamins A, B2 (or folate), B6, C, E and K, as well as magnesium, manganese, calcium, potassium, iron and dietary fiber.

[0004] Spinach flowering is induced by (long) day length and under optimal conditions spinach can even reach 4 generations in one year, with its life cycle from seed to new harvest being completed within 3 months. A bottleneck in spinach production can be caused by seed dormancy.

[0005] Spinach is a wind-pollinated plant, and its pollen can travel great distances. If a line changes from female or mixed flowering to (all) male flowering within a week, the line is considered male. Female lines remain in this state for at least three weeks, without producing any pollen. Spinach hybrids can be produced using plants with female flowering periods and plants with male flowering periods as pollinators. All female flowers are fertilized by male plants before the female plants develop male flowers. Seed setting occurs quickly, within 3 days, after which the seed maturation takes about a month.

[0006] Under optimal conditions, commercially available elite spinach lines are grown and harvested within 25 days.

[0007] Breeding has resulted in spinach plants that grow quickly and do not flower too early. Older varieties tend to have narrower leaves and a stronger, slightly more bitter flavor; newer varieties have wider leaves and a milder flavor. In addition, recent types have little tendency to bolt in warm conditions and therefore do not flower and set seed too early.

[0008] Spinach is grown for its leaves. Commercial spinach may have dark green, rounded leaves. Spinach breeders are concerned with leaf morphology. An important share of the cultivated spinach market is early harvested baby leaf spinach. It is important to spinach growers that the leaves stand upright, which aids ease of harvesting, and a dark green color is desirable.

[0009] Spinach originated in Central Asia, but is now produced all over the world. The traditional areas for spinach cultivation as a crop are Europe and North America, but the largest production area is currently China. Spinach is produced for the food processing industry (canned or frozen spinach) and also for the fresh market, where especially young leaf spinach is in high demand. Breeders develop lines with characteristics best suited to the region or purpose.

[0010] An important development in the production and marketing of fresh spinach is the introduction of bagged spinach. For this application, the desired leaf morphology is that the leaves are not too tightly packed together as is present in some savoyed types.

[0011] The basic types of spinach currently on the market are:

[0012] -Crinkled leaves, with dark green, curled and shrunken leaves (mainly used in the fresh market);

[0013] - Flat or smooth leaf spinach, which has broad, smooth leaves that can be easily washed. This type is used in industry (canned or frozen spinach, as well as in processed foods and baby food);

[0014] - Semi savoy is an intermediate type of spinach, with a texture comparable to the savoy type, but as easy to clean as the smooth type. It is cultivated both for the fresh market and for industry.

[0015] - Oriental type, which is heat resistant, has long petioles, pointed leaves, several lateral lobes, and grows upright.

[0016] For fresh market production, most of spinach is produced under high plant density, which creates an ideal environment for disease development. In addition, the demand for producing organic vegetables is increasing day by day, because consumers increasingly seek for vegetables obtained without using pesticides, fungicides, insecticides and without chemical treatment of seeds. The difficulty here is that, in the absence of pesticides, fungicides, insecticides, spinach plants are sensitive to plant diseases. Therefore, this area needs to comprise the antipathogen resistance of the coding that hereditarily, preferably exists naturally.

[0017] The most common pathogens causing diseases in spinach are Peronospora, Fusarium, Stemphyllium, Colletotrichum, Cercospora and Cucumber mosaic virus. The main disease in spinach is downy mildew, which is caused by the oomycete pathogen Peronospora effusa (also named P. farinosa f.sp. spinacae or abbreviated as Pfs). The short life cycle of Pfs leads to rapid proliferation of the pathogen on susceptible cultivars. Initially, small irregular spots of light yellow appear on the upper surface of the leaves, and spotted purple fuzzy growths appear on the lower surface. Spores appear on the leaves 9-12 days after the first infection and are spread by wind and water splashes. Infected leaves are no longer attractive for consumption and are susceptible to other secondary (microbial) infections.

[0018] One method of controlling downy mildew is to spray the plants with fungicides. This method is highly undesirable due to the severe impact on the environment, and in addition, this method is costly and labor-intensive. In addition, half of the spinach produced in agriculture is planned for the organic market, and the fungicides used are not suitable for resisting downy mildew.

[0019] Peronospora farinosa is a pathogen that can quickly overcome or destroy resistance. Within 2 to 3 years, it was observed that the newly introduced resistance genes were bypassed by the pathogen, thus requiring the continuous identification of new sources of resistance. So far, the International Working Group on Peronospora effusa / farinosa / Pfs (IWGP) has described 17 official races. Since only a limited set of Peronospora (RPF) genes derived from spinach (S. oleracea) has been identified, wild relatives of spinach are a potential source of concern for novel and alternative RPF genes.

[0020] Effector-triggered immunity (ETI) is part of the plant immune system, and NB-LRR proteins form a class of proteins that can trigger ETI. NB-LRR proteins are named from the central nucleotide binding domain and the C-terminal leucine-rich repeat domain. A variety of plant disease resistance proteins are NB-LRR proteins, where NB-LRR proteins recognize pathogen effectors and activate host defense. The C-terminal LRR domain of NB-LRR proteins is highly irregular, with different lengths and different numbers of LRR repeats. The LRR domain is involved in pathogen recognition, and mutations in the C-terminal half of the LRR domain have been shown to affect recognition specificity. The LRR domain contains patches with epitopes involved in effector binding. Recognition of pathogen effectors by the LRR domain transduces signals to the rest of the protein. WO2018059651 and related patent documents disclose WOLF genes encoding CC-NB-LRR family proteins, which provide resistance to powdery mildew in spinach plants.

[0021] Considering that a large part of spinach production is organically grown, the demand for spinach varieties that are resistant to all known downy mildew races (race) (currently Pfs 1-19) is very high. However, in the fields of spinach cultivars with complete resistance (i.e., resistance to Pfs 1 to 19), the problem that growers encounter changes from downy mildew to other pathogens that can affect spinach. An example of this pathogen is the fungus Stemphylium, which is the pathogenic pathogen of Stemphylium leaf spot. Two species of Stemphylium have been described to cause disease on spinach, including Stemphylium beticola (Stemphylium beticola) (formerly known as Stemphylium botryosum) and Stemphylium vesicarium. In recent years, S. vesicarium is the modal species in these two species.

[0022] S. capsularis produces typical conidia that germinate on the leaf surface and cause small necrotic lesions with brown rings on spinach leaves. Leaf spot can significantly reduce the quality and yield of spinach, especially for the fresh market. Inter-cultivar differences in the response to S. capsularis have been observed.

[0023] Another pathogen that affects spinach production is cucumber mosaic virus (CMV), the causative agent of spinach wilt. CMV belongs to the Bromoviridae family and the Cucumovirus genus, which exhibits a broad host range of 1,200 plant species in more than 100 plant families. Important commercial crops that can be infected by CMV include cucurbits, peppers, lettuce, celery, tomatoes, and beans. Genetically encoded resistance to CMV can prevent the spread of CMV, especially when rotation with sensitive crops is a normal production practice. Symptoms of spinach include yellowing of leaves, twisted crowns, curled leaves, stunted plant growth (shrinkage), and death. For freshly marketed spinach, yellowing leaves are not suitable for sale. Therefore, genetic resistance to CMV is a welcome addition to enhance disease resistance in spinach plants.

[0024] As noted, powdery mildew has rapid adaptability to genetically encoded resistance. New powdery mildew isolates continue to appear, which can escape host recognition, thereby bypassing resistance. In order to counteract this rapid adaptation, breeders either look for new resistance genes, or combine or stack known resistance, that is, two or more different powdery mildew resistance genes are introduced into a plant to increase the chance that plants can overcome the infection of Peronospora (Peronospora) or reduce the possibility that 19 pathogen species currently recognized overcome resistance. Therefore, the art needs to provide new and alternative genetically encoded resistance to powdery mildew so that breeders can develop new spinach cultivars that are resistant to the plant pathogen powdery mildew. In addition to other objects, the object of the present invention is to meet the above-mentioned needs in the art.

[0025] This object, among others, is met by the invention as listed in the accompanying claims.

[0026] Specifically, among other objects, according to a first aspect, the above objects are met by providing a four-core spinach genomic DNA comprising

[0027] - a first genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No. 1 or a nucleic acid sequence having at least 90% identity with SEQ ID No. 1, or

[0028] - a second genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No. 2 or a nucleic acid sequence having at least 90% identity with SEQ ID No. 2,

[0029] Wherein the first or second genomic DNA fragment comprises a gene encoding a protein that provides resistance to the plant pathogen powdery mildew.

[0030] In the context of the present invention, "spinach reference genome" or "the spinach reference genome" refers to the spinach genome disclosed by Cai, X., Sun, X., Xu, C., et al., Genomic analyses provide insights into spinach domestication and the genetic basis of agronomic traits. Nat Commun. 12, 7246 (2021). https: / / doi.org / 10.1038 / s41467-021-27432-z. Based on this publicly available spinach genome, a technician will be able to easily identify the corresponding position in any spinach genome, for example by completely or partially aligning the sequences of the listed genomic fragments.

[0031] More specifically, the above objectives are met, among other objectives, by providing a genomic DNA of Spinach quadruped, comprising

[0032] - a first genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No.1 or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity with SEQ ID No.1, or

[0033] - a second genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No. 2 or a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity with SEQ ID No. 2,

[0034] Wherein the first or second genomic DNA fragment comprises a gene encoding a protein that provides resistance to the plant pathogen powdery mildew.

[0035] In the context of the present invention, sequence identity is understood as contiguous nucleic acid or amino acid sequence identity over the entire sequence using commonly known alignment tools, such as BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi).

[0036] Furthermore, according to another aspect, the above objects are met by providing, among other objects, a genomic DNA of Spinach quadruped, said genomic DNA comprising:

[0037] - the first genomic DNA fragment comprises a gene encoding a first resistance protein, which provides resistance to the plant pathogen powdery mildew, wherein the first resistance protein comprises the amino acid sequence shown in SEQ ID No. 5 or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID No 5; or

[0038] - the second genomic DNA fragment comprises a gene encoding a second resistance protein, which provides resistance to the plant pathogen powdery mildew, wherein the second resistance protein comprises the amino acid sequence shown in SEQ ID No.6 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID No.6; and / or

[0039] -The second genomic DNA fragment comprises a gene encoding a third resistance protein, which provides resistance to the plant pathogen powdery mildew, wherein the third resistance protein comprises the amino acid sequence shown in SEQ ID No.22 or a sequence having at least 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID No.22.

[0040] Furthermore, according to another aspect, among other objects, the above objects are met by providing a four-core spinach genomic DNA, wherein:

[0041] - the first genomic DNA fragment comprises the first cDNA nucleic acid sequence shown in SEQ ID No.3 or a sequence having at least 90% identity with SEQ ID No.3, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity; or

[0042] - the second genomic DNA fragment comprises the second cDNA nucleic acid sequence shown in SEQ ID No.4 or a sequence having at least 90% identity with SEQ ID No.4, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity; and / or

[0043] -The second genomic DNA fragment comprises the third cDNA nucleic acid sequence shown in SEQ ID No.21 or a sequence having at least 90% identity with SEQ ID No.21, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity.

[0044] According to another aspect, the above objects are met, among other objects, by providing a protein comprising the amino acid sequence shown in SEQ ID No. 5, 6 or 22, or a protein comprising an amino acid sequence that is at least 85%, 86%, 87%, 88%, 89%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identical to SEQ ID No. 5, 6 or 22.

[0045] According to yet another aspect, the above-mentioned objects are met, among other objects, by providing a cDNA comprising a nucleic acid sequence as shown in SEQ ID No. 3, 4 or 21, or a cDNA comprising a nucleic acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 98% or 99% identity with SEQ ID No. 3, 4 or 21.

[0046] According to another embodiment, the above objects are met, among others, by providing a spinach plant resistant to the plant pathogen Downy Mildew, said spinach plant comprising:

[0047] - a first or second genomic DNA fragment as defined above, and / or

[0048] - a first or second resistance protein and / or a third resistance protein as defined above, and / or

[0049] - a first or second cDNA sequence and / or a third cDNA sequence as defined above.

[0050] Alternatively, the present invention relates to a spinach plant resistant to the plant pathogen Downy Mildew, the spinach plant comprising:

[0051] - a first and a second genomic DNA fragment as defined above, and / or

[0052] - a first and a second resistance protein and / or a third resistance protein as defined above, and / or

[0053] - the first and the second cDNA sequence and / or the third cDNA sequence as defined above.

[0054] According to a preferred embodiment, the above objects are met, among others, by providing a spinach plant as defined above, wherein said plant is resistant to at least the plant pathogen Peronospora races Pfs 10 to Pfs 19.

[0055] The inventors unexpectedly discovered that by introducing the four-core spinach genomic fragment on chromosome 4, it is possible to introduce a genomic fragment providing additional resistance on chromosome 3. This opens up the possibility of introducing additional resistance into plants.

[0056] According to an even more preferred embodiment, the above objects are met, among others, by providing a spinach plant as defined above, wherein said plant is further resistant to the plant pathogen Sclerotium sphaeroides and / or CMV.

[0057] According to another aspect, the above objectives are met, among other objectives, by providing a spinach plant as defined above, wherein the resistance is obtained, obtainable or originates from: the deposit NCIMB 43993 for the first four-core spinach genomic fragment and / or the deposit NCIMB 43994 for the second four-core spinach genomic fragment.

[0058] The seeds of the plant according to the present invention, spinach (Spinacia oleracea) 2130195, deposited NCIMB 43993 and spinach 2025195, deposited NCIMB 43994 were deposited on June 13, 2022 at NCIMB-National Collection of Industrial, Food and Marine Microorganisms, Craibstone Estate, 35 Ferguson Building, Bucksburn, Aberdeen, UK, postal code AB219YA (NCIMB Limited, Craibstone Estate, 35 Ferguson Building, Bucksburn, Aberdeen AB219YA, United Kingdom).

[0059] Tetrandra and Spinacia turkestanica are contemporary wild relatives. Morphologically, they resemble Spinacia oleracea. They are either male or female, with sharp leaves with pointed corners. However, there are problems with using Tetrandra and its derivatives in the seed industry. Tetrandra produces large, clustered and sharp seeds. This is highly undesirable in seed production for two reasons:

[0060] (i) it is difficult to obtain uniform coating of sharp seeds, and

[0061] (ii) Sharp seeds are incompatible with automatic seed drills.

[0062] In the context of the present invention, sharp seeds are defined as non-round seeds, which have sharp thorns and a tendency to cluster. This is in contrast to the agricultural elite plant spinach, which mainly produces round or round seeds without sharp thorns and a tendency to cluster. Therefore, there is a need in the art to provide spinach plants that produce non-sharp seeds in one seed batch.

[0063] Thus, according to a particularly preferred embodiment, the present invention provides a spinach plant as defined above, wherein the plant produces seeds comprising at most 25%, preferably 20%, more preferably 10% or even more preferably 5% pointed seeds.

[0064] According to another aspect, the present invention relates to a method for providing spinach plants resistant to the plant pathogen Downy Mildew,

[0065] The method comprises the steps of introducing into spinach plants susceptible to the pathogen Downy mildew:

[0066] - a first or second genomic DNA fragment as defined above, or

[0067] - a first, second and / or third cDNA sequence as defined above;

[0068] They are operably linked to appropriate expression and translation sequences.

[0069] More specifically, the above method comprises the use of Agrobacterium and / or CRISPR Cas.

[0070] Even more specifically, in the above method, the first and second genomic DNA fragments are obtainable from, obtained from or derived from deposit numbers NCIMB 43993 and NCIMB 43994, respectively.

[0071] According to a further aspect, the present invention relates to a method for identifying spinach plants that are resistant to downy mildew,

[0072] The method comprises the following steps:

[0073] - isolating or providing plant material of spinach plants,

[0074] - detecting in said plant material:

[0075] - a first or second genomic DNA fragment as defined above, and / or

[0076] - a first, second and / or third resistance protein as defined above, and / or

[0077] - a first, second and / or third cDNA sequence as defined above.

[0078] In addition, the present invention also relates to the use of one or more nucleic acid sequences selected from SEQ ID No.1, SEQ ID No.2, SEQ ID No.3, SEQ ID No.4 and SEQ ID No.21 and / or one or more amino acid sequences selected from SEQ ID No.5, SEQ ID No.6, SEQ ID No.8 and SEQ ID No.22 for identifying or providing plants resistant to the plant pathogen powdery mildew, preferably races Pfs 10 to Pfs 19.

[0079] The present invention will be further described by the following examples and figures, in which:

[0080] Figure 1 : A four-stamen spinach seed is shown;

[0081] Figure 2 : Four-core spinach × spinach and backcrossed to spinach seeds are shown;

[0082] Figure 3 : Seeds of NCIMB 43994, a spinach with a mini-introgression of four-stamen spinach, are shown;

[0083] Figure 4 : The first and second four-core spinach genome fragments of the present invention are shown. Abbreviations used in the figure: TSS-transcription start site; start codon; exon (CDSi, gray); last exon with stop codon (blue, CDSI); terminator after the stop codon; poly A tail. Within the first four-core spinach genome fragment (SEQ ID No.1) and the second four-core spinach genome (SEQ ID No 2), smaller fragments where potential genes are located are selected and visualized. Both the first and second genome fragments contain 7 exons, including the start codon and the stop codon;

[0084] Figure 5 : The cDNA of the second accession of Spinach is shown: SEQ ID No. 4 (green) is compared with the sequencing result for splice variant 1 SEQ ID No 21 (yellow) as predicted by Augutsus.

[0085] Example 1. Downy mildew test

[0086] Resistance to downy mildew f.sp. spinaciae (synonym of P. effusa [hereinafter referred to as Pfs]) was tested in a qualitative disease assay. Briefly, a minimum of 8 plants were inoculated with a spore suspension of a single Pfs race or isolate 10 to 14 days after sowing untreated seeds in the soil. Pfs was maintained on living susceptible host plants, e.g., Viroflay or Blight or plant material where spores were stored at -20°C for up to 1 year. The inoculated plants were cultivated under plastic at high humidity (80-100%) and a temperature range of 16°C-20°C. After 24 hours, the plastic was removed and the plants were evaluated 9 to 12 days after inoculation. Plants were considered susceptible when spore formation was observed on cotyledons or true leaves, and resistant when spore formation was not observed.

[0087] The difference group as described in Table 1 is included in each disease trial under the same environmental conditions to confirm the race. This difference group of Pfs was developed by the International Powdery mildew Working Group (IWGP) and can be found on the website of the International Seed Federation (ISF). This difference group consisting of spinach varieties and near-isogenic lines (NIL, near-isogenic lines) is used to determine the Pfs race. In this table, "-" represents resistance (no spore formation), "+" represents sensitivity (spore formation), "(-)" represents moderate resistance (sparse spore formation on the tip of the cotyledon), and "nt" represents that the current strain has not been tested. Seeds of this difference group and Pfs race can be obtained at Naktuinbouw (POBox 40, NL-2370AA, Roelofarendsveen, Netherlands, naktuinbouw.com).

[0088] Table 1. IWGP spinach difference groups of Pfs. Where "-" indicates resistance, "+" indicates sensitivity, and "(-)" indicates moderate resistance.

[0089]

[0090]

[0091] Table 2. Resistance pattern of spinach plants according to the invention. Where "-" indicates resistance, "+" indicates sensitivity, and "nt" is not tested.

[0092] Pfs Deposit NCIMB 43994 Deposit NCIMB 43993 1 - nt 2 - - 3 - nt 4 - - 5 - nt 6 - nt 7 - nt 8 - nt 9 - nt 10 - - 11 - - 12 - - 13 - - 14 - - 15 - - 16 - - 17 - - 18 - - 19 - -

[0093] Example 2. Stemphylium - Disease Test

[0094] Resistance to S. capsularis was tested in a qualitative disease assay. Briefly, a minimum of 20 plants per line were transplanted into pots 7 to 10 days after sowing untreated seeds in soil. Plants were inoculated when the first true leaves were fully expanded between 14 and 20 days after sowing. S. capsularis was maintained in glycerol at -80°C and propagated on potato dextrose agar (PDA). Spores were harvested and counted to give a concentration of 1 × 10 4 spores / mL of spore suspension. The inoculated plants were incubated under plastic at high humidity (80-100%) and a temperature range of 20°C-22°C. After 24 hours, the plastic was removed and the plants were evaluated 4 days after inoculation. When leaf spots were observed on true leaves, the plants were considered sensitive, and when leaf spots were not observed, the plants were considered resistant.

[0095] variety Score Deposit NCIMB 43993 R Deposit NCIMB 43994 R Responder S Patton S

[0096] Example 3. CMV-disease assay.

[0097] Resistance to CMV was tested in a qualitative disease assay. Briefly, 7 to 10 days after sowing untreated seeds in soil, a minimum of 20 plants per line were transplanted into pots. Between 14 and 20 days after sowing, when the first true leaves were fully expanded, the plants were inoculated. CMV was maintained as freeze-dried spinach leaves at 4°C. CMV was first mechanically inoculated on Nicotiana benthamiana and then propagated on sensitive spinach varieties. Spinach plants were evaluated 10 days after inoculation. Plants with yellowing leaves were considered sensitive, while plants without yellowing leaves were considered resistant.

[0098] variety Score Deposit NCIMB 43994 R Responder S

[0099] Example 4. Significantly fewer sharp seeds.

[0100] Four-staple spinach has sharp seeds - Figure 1 This type of seed (pointed seed) has a tendency to form clumps, which is undesirable. Pointed seeds are problematic because it is difficult to obtain a uniform coating on the seed and it is difficult to work with pointed seeds in automatic seed drills.

[0101] Hybridize four-core spinach with spinach and backcross spinach three times Figure 2 Evaluation by visual inspection showed that the seed batch produced from this cross showed 50% fewer pointed seeds compared to the four-seed spinach starting material.

[0102] Plants deposited under NCIMB 43994 - Figure 3These plants had only a relatively small introgression of the four-staple Spinach gene and their genome was predominantly Spinach. By visual inspection, it was estimated that only 5% of the seed lots had sharp seeds, and in the case where the seed was sharp, it was clearly not as sharp as the seeds of the four-staple Spinach (starting material). Plants from deposit NCIMB 43993 showed similar results to plants from NCIMB 43994 in terms of seed morphology (results not shown).

[0103] Example 5. Genomic DNA sequence, cDNA and protein of Spinach.

[0104] Based on QTL analysis, two four-core spinach accession plants that provide resistance to powdery mildew were identified and sequenced using Illumina technology. The sequencing data has been mapped to the spinach reference genome and a de novo genome assembly has been performed. Previously performed marker analysis led to the identification of a QTL, and this QTL is located on chromosome 4 at (3468181..3487380) of the spinach reference genome. Within the scope of this QTL, genes of high interest encoding putative resistance proteins were observed.

[0105] Comparative genomics between the spinach reference genome and the two de novo four-core spinach genomes led to the identification of a chromosomal region for each four-core spinach de novo genome assembly. In the first four-core spinach accession, the genomic fragment is SEQ ID No. 1 of 13.5 kb; in the second four-core spinach accession, the genomic fragment is SEQ ID No. 2 of 17.5 kb.

[0106] The first genomic fragment (according to the nucleic acid sequence of SEQ ID No. 1) and the second genomic fragment (according to the nucleic acid sequence of SEQ ID No. 2) were displayed using Softberry software. Within these fragments, a smaller fragment in which a potential gene was located was selected and visualized - Figure 4 For both fragments, the identified genes had a similar structure, ie, each fragment had 7 exons including a start codon and a stop codon.

[0107] Based on BlastN, the gene of the resistance protein of coding inference was identified on chromosome fragment, and the coding sequence of the gene of being concerned about was predicted with Augustus.In the first four cores spinach accession numbers, cDNA is the SEQ ID No.3 of 3693bp, which produces 1230 amino acid whose protein sequence (SEQ ID No.5).The cDNA of the second four cores spinach accession numbers is SEQ ID No.4 (3693bp), which produces 1230 amino acid whose protein sequence (SEQ ID No.6).

[0108] The coding sequences of the resistance genes of the two four-core spinach accession numbers of the present invention respectively show 97.3% and 97.3% homology with the spinach reference genome. Alignment shows that the putative resistance protein undergoes positive selection in the four-core spinach resistance accession number plants, resulting in powdery mildew resistance. The protein sequences of the putative resistance genes of the two four-core spinach accession numbers respectively show 95.1% and 95.2% homology with the spinach reference genome.

[0109] To confirm the prediction of the gene sequence of the second tetrapod accession number (ie, SEQ ID No 4, cDNA and SEQ ID No 6, protein), RT-PCR reactions were performed.

[0110] RNA was isolated with the innuPREP Plant RNA Kit (Analytik Jena) and cDNA was subsequently synthesized with the First Strand cDNA Synthesis Kit (NEB). Primer pairs were designed in the CDS predicted by August and after the PCR reaction this resulted in two distinct bands on the gel, which indicated the presence of two splice variants. To confirm this result, the PCR product was sequenced with nanopore sequencing and this resulted in the sequence of the first splice variant. Figure 5 In the , the predicted cDNA sequence SEQ ID No.4 (green) is compared with the sequencing result SEQ ID No.21 (yellow) obtained for splice variant 1, both of which are derived from the second four-core spinach accession number. It can be observed that exon 1 is different between the prediction (Augustus) and splice variant 1. In the case of splice variant 1, exon 1 is longer, and it has 2857bp. Other exons were correctly predicted, and their lengths were the same between the prediction (Augustus) and splice variant 1.

[0111] The cDNA sequence of splice variant 1 derived from the accession number of Spinach 24 core is designated as SEQ ID No. 21. The translated protein of said cDNA is designated as SEQ ID No. 22 (derived from the accession number of Spinach 24 core).

[0112] Table 3. cDNA of the second A. truncatula accession as predicted by Augustus (SEQ ID No. 4) compared to the sequencing result of splice variant 1 (SEQ ID No. 21).

[0113]

[0114]

[0115] Example 6. LRR domains.

[0116] The protein sequence of the protein that the present invention provides resistance that derives from the reference genome (i.e., SEQ ID No.5 and SEQ ID No.6) contains the same protein domain. The length of the domain and the order of the domain are conserved between the proteins of the reference genome. However, in SEQ ID No.5 and SEQ ID No.6, several amino acid substitutions have occurred. The technician is familiar with the method for calculating sequence similarity and sequence identity. Use EMBOSS stretcher 6.6.0 (www.ebi.ac.uk / Tools / psa / emboss_stretcher), use the EBLOSUM62 matrix and set the gap open penalty: 12 and the gap extension penalty: 2, calculate the sequence similarity of the amino acid sequence.

[0117] The LRR protein domain has been previously shown to play an important role in acquiring resistance to pathogens, and comparison of the LRR protein domains of the reference (SEQ ID No. 5 and SEQ ID No. 6) proteins resulted in #identity: 316 / 333 (94.9%); #similarity: 321 / 333 (96.4%); #gap: 0 / 333 (0.0%). Specific amino acid changes in the LRR domain are shown in Table 3.

[0118] Comparative genomics of nanopore sequencing amplicons with Augustus predicted genes and splice variants revealed that the LRR domain still exists in two forms.

[0119] Table 4: Mutations in the LRR domain

[0120]

[0121] Example 7. Introduction of a gene fragment from Spinacia oleracea providing resistance to powdery mildew into spinach (Spinacia oleracea) using Agrobacterium tumefaciens.

[0122] By using Agrobacterium tumefaciens, transient transformation of plants with resistance genes results in the production of pathogen-resistant plants. To this end, molecular biological techniques can be used to design and obtain constructs carrying the genetically encoded resistance according to the present invention. These constructs will have:

[0123] (1) a gene fragment encoding resistance from the accession number of Spinach quinquefolia, which is referred to as SEQ ID No. 3;

[0124] (2) a gene fragment encoding resistance from the accession number of Spinach quinquefolia, which is referred to as SEQ ID No. 4;

[0125] Susceptible spinach plants can be transformed with construct (1) or construct (2) by co-cultivation with Agrobacterium tumefaciens. In addition, positive and negative controls are included. Once transformation is complete, the transformants can be disease tested using P. farinosa isolates. It is expected that the transformants will be resistant to P. farinosa infection, while the wild-type plants will still be susceptible.

[0126] Example 8. Virus-induced gene silencing experiment (VIGS) to silence genetically encoded resistance from Spinach.

[0127] Tobacco rattle virus (TRV)-derived VIGS vectors have been extensively described for studying gene function in Arabidopsis thaliana, Nicotiana benthamiana, tomato (Lycopersicon esculentum), and other plants. Prior to the experiments, we obtained plasmids 0155-157pTRV1 and 0158-160pTRV2-MCS from the Arabidopsis Biological Resource Center.

[0128] To identify the genomic fragment from Spinach, namely:

[0129] (i) a gene fragment encoding resistance from the accession number of Spinach quadruped, which is referred to as SEQ ID No. 3;

[0130] (ii) a gene fragment encoding resistance from the accession number of Spinach quinquefolia, which is referred to as SEQ ID No. 4;

[0131] When these fragments are present in the four-core spinach plants according to the invention and are responsible for the observed resistance phenotype, VIGS experiments can be performed.

[0132] For this purpose, VIGS constructs targeting previously described genomic fragments (SEQ ID No. 3 and SEQ ID No. 4) were designed with pssRNAit. In addition, a positive VIGS control was used and this positive control targeted the (Phytoene Desaturase) PDS gene. The negative control was an empty vector.

[0133] Due to the very high sequence identity between SEQ ID No. 3 and SEQ ID No. 4, the same siRNA molecule can be used. Targeting 3 sequences (VIGS1, VIGS2, VIGS3).

[0134] For the PDS positive control, the two sequences were targeted PDS1 and PDS2, see below.

[0135] SiRNA (antisense) SiRNA (positive sense) Off-target number Vigs1 UAUAAACCGGGCCGAUGCCUU GGCAUCGGCCCGGUUUAUAAG 0 Vigs2 AUAAACCGGGCCGAUGCCUUC AGGCAUCGGCCCGGUUUAUAA 0 Vigs3 CGAUGCAACCCCUUCUGCGCU CGCAGAAGGGGUUGCAUCGAC 0 PDS1 UAUAAACCGGGCCGAUGCCUU GGCAUCGGCCCGGUUUAUAAG 0 PDS2 CUAACGGGGUGUCUGGAGCCA GCUCCAGACACCCCGUUAGUC 0

[0136]

[0137]

[0138] Subsequently, these fragments were obtained using molecular biological techniques, cloned into the above-mentioned VIGS plasmid and transformed into Agrobacterium tumefaciens. After co-cultivation with A. tumefaciens, the four-core spinach plants according to the present invention were used as described below:

[0139]

[0140] After VIGS silencing, the transformed plants obtained can be tested for disease using Peronospora race 17. Non-transformed plants remain resistant to the pathogen, whereas plants in which the VIGS experiment was successful are expected to become susceptible to Peronospora.

[0141] In addition, longer target sequences were designed and used. Longer fragments resulted in the production of many small RNAs, and the changes in successful silencing were significantly higher than when only one small RNA was used as input. SEQ ID No 19 targets resistance genes: first and / or second genomic DNA from Spinach. SEQ ID No 20 targets phytoene desaturase (control).

[0142]

[0143]

Claims

1. Spinacia tetrandra genomic DNA, including - a first genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No. 1 or a nucleic acid sequence having at least 90% identity with SEQ ID No. 1; or - a second genomic DNA fragment having the nucleic acid sequence shown in SEQ ID No. 2 or a nucleic acid sequence having at least 90% identity with SEQ ID No. 2; The first genomic DNA fragment or the second genomic DNA fragment comprises a gene encoding a protein that provides resistance to the plant pathogen Peronospora farinosa.

2. The four-core spinach genomic DNA according to claim 1, wherein - the first genomic DNA fragment comprises a gene encoding a first resistance protein, the first resistance protein providing resistance to the plant pathogen powdery mildew, wherein the first resistance protein comprises the amino acid sequence shown in SEQ ID No.5 or an amino acid sequence having at least 85% identity with SEQ ID No.5; or -The second genomic DNA fragment contains a gene encoding a second resistance protein, which provides resistance to the plant pathogen powdery mildew, wherein the second resistance protein contains the amino acid sequence shown in SEQ ID No.6 and / or SEQ ID No.22 or a sequence having at least 85% identity with SEQ ID No.6 and / or SEQ ID No.

22.

3. The four-core spinach genomic DNA according to claim 1 or 2, wherein - the first genomic DNA fragment comprises the nucleic acid sequence shown in SEQ ID No. 3 or a sequence having at least 90% identity with SEQ ID No. 3; or - The second genomic DNA fragment comprises the nucleic acid sequence shown in SEQ ID No.4 and / or SEQ ID No.21 or a sequence having at least 90% identity with SEQ ID No.4 and / or SEQ ID No.

21.

4. A protein comprising the amino acid sequence shown in SEQ ID No.5, SEQ ID No.6 or SEQ ID No.

22.

5. A cDNA comprising the nucleic acid sequence shown in SEQ ID No.3, SEQ ID No.4 or SEQ ID No.

21.

6. Spinach plants resistant to the plant pathogen Downy mildew, including: - the first genomic DNA fragment and / or the second genomic DNA fragment as defined in any one of claims 1 to 3, and / or - one or more resistance proteins as defined in claim 4, or - One or more cDNA sequences as defined in claim 5.

7. The spinach plant of claim 6, wherein the plant is resistant to at least the plant pathogen Peronospora mildew races Pfs10 to Pfs 19.

8. The spinach plant according to claim 6 or 7, wherein the plant is also resistant to the plant pathogens Stemphylium vesicarium and / or CMV.

9. The spinach plant according to any one of claims 6 to 8, wherein the resistance is obtained, obtainable or derived from: For the first four-stamen Spinach genome fragment, deposit NCIMB 43993; or For the second four-stamen spinach genomic fragment, deposit NCIMB 43994 was made.

10. The spinach plant according to any one of claims 6 to 9, wherein the plant produces seeds comprising at most 25%, preferably 20%, more preferably 10% or even more preferably 5% pointed seeds.

11. A seed or plant part produced by the spinach plant of any one of claims 6 to 10, wherein the seed or plant part comprises: - the first genomic DNA fragment and / or the second genomic DNA fragment as defined in any one of claims 1 to 3, and / or - one or more resistance proteins as defined in claim 4, or - One or more cDNA sequences as defined in claim 5.

12. A resistance gene providing resistance to the plant pathogen powdery mildew, wherein the gene encodes a protein having at least 85% sequence identity to SEQ ID No. 5, SEQ ID No. 6 and / or SEQ ID No.

22.

13. A resistance gene providing resistance to the plant pathogen powdery mildew, wherein the gene is obtainable from the first genomic DNA fragment and / or the second genomic DNA fragment as defined in any one of claims 1 to 3.

14. A method for providing spinach plants resistant to the plant pathogen Downy mildew, wherein the method comprises the steps of introducing into the pathogen Downy mildew-susceptible spinach plants: - the first genomic DNA fragment or the second genomic DNA fragment as defined in any one of claims 1 to 3; or - One or more cDNA sequences as defined in claim 5, operably linked to appropriate expression and translation sequences.

15. A method for providing a spinach plant as claimed in claim 14, wherein the method comprises a transformation step using Agrobacterium and / or CRISPR Cas.

16. The method according to claim 14 or claim 15, wherein the first genomic DNA fragment or the second genomic DNA fragment is obtainable from, obtained from or comes from deposit numbers NCIMB 43993 and NCIMB 43994, respectively.

17. A method for identifying spinach plants resistant to downy mildew, wherein the method comprises the following steps: - isolating or providing plant material of said spinach plant, - detecting in said plant material: - the first genomic DNA fragment and / or the second genomic DNA fragment as defined in any one of claims 1 to 3, or - one or more resistance proteins as defined in claim 4, or - One or more cDNA sequences as defined in claim 5.

18. Use of one or more nucleic acid sequences and / or one or more amino acid sequences for identifying or providing plants resistant to the plant pathogen powdery mildew, preferably races Pfs 10 to Pfs 19, wherein the one or more nucleic acid sequences are selected from the group consisting of SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4, SEQ ID No.21, and the one or more amino acid sequences are selected from the group consisting of SEQ ID No.5, SEQ ID No.6, SEQ ID No.8 and SEQ ID No.22.

Images