A method for improving the tolerance and / or yield of rice to heat stress
By mutating the rice OsHTT5 gene through the CRISPR/Cas9 gene editing system and inhibiting the expression of OsHTT5 protein, the problems of rice's tolerance to heat stress and insufficient yield were solved, and the rice's heat stress tolerance and yield were significantly improved.
Patent Information
- Application Number
- CN202411776827.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-05
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-12-05
AI Technical Summary
In the existing technology, rice's tolerance to heat stress and yield are limited, affecting its growth and development, resulting in reduced yield and quality. Especially in the context of global warming, it is necessary to improve rice's heat stress tolerance and yield.
The gene encoding the OsHTT5 protein in rice was mutated using the CRISPR/Cas9 gene editing system to construct a functional mutant of the OsHTT5 protein, inhibit the expression of the OsHTT5 protein, and improve the rice's tolerance to heat stress and yield.
Significantly improve the heat stress tolerance and yield of rice, enhance the average fruit set rate, plant height, total number of grains per panicle, single plant weight and length per panicle, and cultivate heat stress-resistant and high-yielding rice varieties.
Smart Images

Figure CN119409788B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology and more specifically relates to a method for improving the heat stress tolerance and / or yield of rice. Background Art
[0002] Heat stress refers to the phenomenon in which the ambient temperature exceeds the upper limit of an organism's tolerance for normal growth and development, leading to a series of physiological, biochemical, and molecular stress responses. Heat stress is the primary abiotic stress that restricts crop yield and quality. For example, heat stress can affect the normal growth and development of rice, resulting in seedling death and reduced tillering. During the meiotic and flowering stages of rice, heat stress can lead to a decrease in rice seed set and pollen abortion, thus affecting the final yield. Furthermore, heat stress can increase the rate of chalky grains and the area of chalky grains, reducing rice quality.
[0003] Global warming is causing average temperatures to rise, increasing the frequency and intensity of extreme heat events (such as heat waves), which can cause heat stress in crops. Rice is an important food crop, and ensuring its yield is crucial for food security. Therefore, it is crucial to study the mechanisms by which rice responds to heat stress and cultivate heat-tolerant rice varieties to mitigate the adverse effects of global warming on rice yields.
[0004] NAC transcription factors are a class of transcription factors widely found in plants, representing one of the largest transcription factor families in plants. They play key regulatory roles in plant growth and development, including seed germination, secondary cell wall growth, root development, leaf senescence, flower formation and senescence, and fruit ripening. NAC transcription factors are also involved in plant responses to abiotic stresses, such as tolerance to drought, salt stress, and heavy metals. These factors may reveal NAC transcription factors associated with heat tolerance in rice. However, different NAC transcription factors in different plants respond to different abiotic stresses. Among the reported NAC transcription factors, more are associated with drought resistance, while fewer are associated with heat tolerance. Summary of the Invention
[0005] In order to improve the tolerance and yield of rice to heat stress, the present invention analyzed and explored various genes of rice and discovered a protein related to the heat stress resistance of rice, named OsHTT5 protein. Based on this, a method for improving the tolerance and / or yield of rice to heat stress is provided, as well as related applications of preparations for inhibiting the expression of OsHTT5 protein.
[0006] The first object of the present invention is to provide a method for improving the heat stress tolerance and / or yield of rice.
[0007] The second object of the present invention is to provide a use of an agent for inhibiting the expression of OsHTT5 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.
[0008] The third object of the present invention is to provide a use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress.
[0009] The fourth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT5 protein in increasing rice yield or in preparing a product for increasing rice yield.
[0010] A fifth object of the present invention is to provide use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved yield.
[0011] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0012] The present invention uses the CRISPR / Cas9 gene editing system to mutate the gene encoding the OsHTT5 protein in rice, constructing an OsHTT5 protein loss-of-function mutant strain and subjecting it to heat stress. It was found that inhibiting the expression of the OsHTT5 protein significantly improved the rice's tolerance to heat stress. Furthermore, inhibiting the expression of the OsHTT5 protein also significantly increased the average seed set rate, plant height, total number of grains per panicle, plant weight, and panicle length of rice, thereby increasing rice yield. Based on this, the present invention provides a method for improving rice's tolerance to heat stress and / or yield.
[0013] Specifically, the method comprises: inhibiting the expression of OsHTT5 protein in rice.
[0014] Specifically, the amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.3.
[0015] Specifically, the expression of the OsHTT5 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT5 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT5 protein.
[0016] More specifically, the expression of the gene encoding the OsHTT5 protein is interfered with by RNA interference technology; the coding region or promoter of the gene encoding the OsHTT5 protein is mutated by a gene editing system, or the gene sequence encoding the OsHTT5 protein is deleted by gene editing technology, or the gene sequence encoding the OsHTT5 protein is knocked out by homologous recombination to inhibit the expression of the OsHTT5 protein in rice.
[0017] Specifically, the mutation includes base insertion, deletion or base conversion.
[0018] Optionally, the nucleotide sequence of the gene encoding the OsHTT5 protein (OsHTT5 gene) is shown as SEQ ID NO.1.
[0019] Optionally, the nucleotide sequence of the coding region of the OsHTT5 gene is shown as SEQ ID NO.2.
[0020] Optionally, the gene editing system is a CRISPR / Cas9-based gene editing system.
[0021] In a specific embodiment of the present invention, the expression of OsHTT5 protein in rice is suppressed by mutating the gene encoding OsHTT5 protein.
[0022] Specifically, the method for inhibiting the expression of OsHTT5 protein in rice is as follows: designing a CRISPR / Cas9-based sgRNA sequence for the gene (or target sequence) encoding the OsHTT5 protein, connecting a DNA fragment encoding the sgRNA sequence to a pCRISPR / Cas9 vector carrying a Cas9 expression cassette and transforming rice callus to achieve site-directed mutagenesis of the gene encoding the OsHTT5 protein, thereby rendering the OsHTT5 protein inactive.
[0023] Specifically, the target sequence recognized by sgRNA conforms to the 5'-N X -NGG-3' or 5'-N X -NTT-3' sequence rules; where N represents any one of A, T, C, G, x is an integer between 17 and 20, N X express X consecutive deoxyribonucleotides.
[0024] As an optional embodiment, the nucleotide sequence of the target site recognized by the sgRNA is shown as SEQ ID NO.4 or SEQ ID NO.9.
[0025] In addition to using CRISPR / Cas9 genome editing technology, gene editing technologies such as zinc finger nucleases (ZFNs) or transcription activator-like effector nucleases (TALENs) can also be used to mutate the gene encoding the OsHTT5 protein.
[0026] Specifically, the present invention obtains an OsHTT5 protein function-deficient mutant strain by mutating the gene encoding the OsHTT5 protein in rice, comprising the following steps:
[0027] S1. Design sgRNA target sequence and adapter primers;
[0028] S2. Constructing an sgRNA vector containing the target sequence fragment: Synthesize adapter primers, denature the adapter primers, and cool them to room temperature to complete annealing. Ligate the annealed primer pair to the digested sgRNA vector, and verify the positive plasmid by PCR amplification and sequencing.
[0029] S3. Construction of a pCRISPR / Cas9 vector containing the target sequence fragment: Cut the gRNA expression cassette containing the target sequence fragment from the gRNA and then ligate it to the pCRISPR / Cas9 vector containing the Cas9 expression cassette;
[0030] S4. Transformation: Transform the target site-containing pCRISPR / Cas9 vector into rice callus tissue. After screening, differentiation, and rooting, positive transgenic plants are identified.
[0031] S5. Identification of mutation sites: Extract DNA from positive plants, design identification primers to amplify the extracted DNA, purify it, sequence it, and analyze the mutation.
[0032] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.4, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.5 and SEQ ID NO.6.
[0033] Specifically, when the target sequence is the nucleotide sequence shown in SEQ ID NO.9, the nucleotide sequences of the adapter primers are shown in SEQ ID NO.10 and SEQ ID NO.11.
[0034] Specifically, the nucleotide sequences of the primer pair used to identify the mutation site are shown in SEQ ID NO.7 and SEQ ID NO.8.
[0035] Specifically, the rice is japonica rice.
[0036] More specifically, the rice is the japonica rice variety Zhonghua 11.
[0037] Given that inhibiting the expression of the OsHTT5 protein in rice can improve its tolerance to heat stress and yield, the present invention seeks to protect the use of an agent for inhibiting the expression of the OsHTT5 protein in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress.
[0038] Specifically, the improving the tolerance of rice to heat stress is improving the tolerance of rice to heat stress at the seedling stage.
[0039] The present invention also claims the use of an agent for inhibiting the expression of the OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress.
[0040] The present invention also claims the use of an agent for inhibiting the expression of OsHTT5 protein in increasing rice yield or in preparing a product for increasing rice yield.
[0041] Specifically, the agent increases rice yield by increasing the average seed setting rate, total number of grains per panicle, length per panicle, plant height and / or single plant weight of rice.
[0042] The present invention also claims the use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with increased yield.
[0043] Specifically, the reagent for inhibiting the expression of the OsHTT5 protein includes a reagent that interferes with the expression of the gene encoding the OsHTT5 protein, such as dsRNA, or a vector for mutating or knocking out the gene encoding the OsHTT5 protein.
[0044] The present invention has the following beneficial effects:
[0045] The present invention utilizes the CRISPR / Cas9 gene editing system to mutate the rice OsHTT5 gene, constructs a mutant strain with loss of function of the OsHTT5 protein, and subjects it to heat stress. It was found that inhibiting the expression of the OsHTT5 protein can significantly improve the tolerance of rice to heat stress. Furthermore, inhibiting the expression of the OsHTT5 protein can also significantly increase the average seed set rate, plant height, total number of grains per panicle, plant weight, and length per panicle of rice, thereby increasing rice yield. Based on this, preparations capable of inhibiting the expression of the OsHTT5 protein can be used to improve the tolerance and yield of rice to heat stress, construct heat-stress-resistant rice strains, and the like. The present invention is beneficial for the cultivation of heat-resistant and high-yield rice varieties, and is beneficial for alleviating the adverse effects of climate warming on rice yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] Figure 1 The expression response of OsHTT5 gene in rice seedlings under heat stress conditions.
[0047] Figure 2 The phenotypes of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain before and after heat stress treatment.
[0048] Figure 3 These are the test results of the heat stress tolerance of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain. A to D in the figure are the survival rate, ion leakage rate, total chlorophyll content, and hydrogen peroxide content test results of the strains, respectively; ***p<0.001.
[0049] Figure 4These are the yield trait analysis results of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain. A to E in the figure are the statistical results of average fruit set rate, plant height, total number of grains per ear, single plant weight, and length per ear, respectively; **p<0.01; ***p<0.001 in the figure. DETAILED DESCRIPTION
[0050] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0051] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0052] The nucleotide sequence of the OsHTT5 gene (gDNA) described in the embodiment of the present invention is shown in SEQ ID NO.1, the nucleotide sequence of the coding region (cDNA) of the OsHTT5 gene is shown in SEQ ID NO.2, and the amino acid sequence of the encoded OsHTT5 protein is shown in SEQ ID NO.3.
[0053] Example 1 Expression response of the OsHTT5 gene in rice seedlings under heat stress conditions
[0054] The present invention designs qPCR primers of the OsHTT5 gene and detects the expression response of the OsHTT5 gene in rice seedlings under heat stress treatment conditions by qPCR.
[0055] The rice used in the experiment was 14-day-old seedlings of the japonica rice variety Zhonghua 11. The heat stress treatment conditions were: 45℃, 12h light / 12h dark. Samples were taken at 0, 6, 12, and 24h of heat treatment, and total RNA was extracted and reverse transcribed into cDNA. The obtained cDNA was used as a template for qPCR detection, and Actin was the internal reference.
[0056] The nucleotide sequences of the qPCR primers and internal reference primers used in qPCR detection are as follows:
[0057] qPCR Primer F: ATCAAGAAGGCGCTCGTGT
[0058] qPCR Primer R: CGTGCATGATCCACTCCGTC
[0059] Internal reference primer F: CACATTCCAGCAGATGTGGA
[0060] Internal reference primer R: GCGATAACAGCTCCTCTTGG
[0061] The qPCR reaction system and reaction conditions are shown in Tables 1 and 2 below, respectively:
[0062] Table 1 qPCR reaction system
[0063]
[0064]
[0065] Table 2 qPCR reaction conditions
[0066]
[0067] The expression response of OsHTT5 gene in rice seedlings under heat stress conditions is shown in Figure 2. Figure 1 As shown. Figure 1 It can be seen that the expression level of OsHTT5 peaked at the 6th and 12th hours after heat treatment and then showed a decreasing trend, indicating that it responded to heat stress.
[0068] Example 2 Obtaining the OsHTT5 gene mutant strains htt5-1 and htt5-2
[0069] The present invention utilizes CRISPR / Cas9 technology to mutate the OsHTT5 gene, thereby constructing an OsHTT5 gene mutant strain. The specific process is as follows:
[0070] 1. Design of sgRNA target sequence and adapter primer
[0071] For the OsHTT5 gene (nucleotide sequence shown in SEQ ID NO. 1), the target sequence was designed using the targetDesign applet (http: / / skl.scau.edu.cn / targetdesign / ) (reference: DOI: http: / / dx.doi.org / 10.1016 / j.molp.2017.06.004).
[0072] The sgRNA target sequence (5'→3') designed in this example is as follows:
[0073] Target-HTT5-U3: CCTCTACCGCCACGACCCAT(SEQ ID NO.4)
[0074] Based on the target sequence, the adapter primers with sticky ends (5'→3') are designed as follows:
[0075] Target-HTT5-U3F:ggcaCCTCTACCGCCACGACCCAT(SEQ ID NO.5)
[0076] Target-HTT5-U3R:aaacATGGGTCGTGGCGGTAGAGG(SEQ ID NO.6)
[0077] 2. Construction of pU3-gRNA vector containing Target-HTT5 fragment
[0078] Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the above-mentioned adapter primers with sticky ends. The synthesized adapter primers were heated at 90°C for 30 seconds to denature and then moved to room temperature for cooling to complete annealing. The annealed primers were ligated to the pU3-gRNA vector after enzyme digestion. After PCR amplification and sequencing verification, the pU3-gRNA vector containing the Target-HTT5-U3 fragment was obtained.
[0079] The PCR primers used for PCR verification were Target-HTT5-U3F / Target-HTT5-U3R.
[0080] 3. Construction of pCRISPR / Cas9 vector containing Target-HTT5-U3 fragment
[0081] The expression cassette of the Target-HTT5-U3 fragment was cut out from the pU3-gRNA vector containing the Target-HTT5-U3 fragment and ligated to the pCRISPR / Cas9 vector containing the Cas9 expression cassette. After PCR amplification and sequencing verification, the pCRISPR / Cas9 vector containing the Target-HTT5-U3 fragment was obtained.
[0082] 4. Obtaining mutant strains
[0083] The pCRISPR / Cas9 vector containing the target (Target-HTT5-U3) was transformed into callus tissue of the japonica rice variety Zhonghua 11 through Agrobacterium tumefaciens-mediated genetic transformation. After secondary screening, differentiation and rooting into seedlings, the resulting plants were planted in a net room, and mutant strains were identified and screened by sequencing.
[0084] 5. Sequencing and identification of mutation sites in mutant strains
[0085] Genomic DNA (gDNA) of the screened mutant strains was extracted and used as a template for PCR amplification using primers HTT5TF (AGATCGAACACCTCGTGTCC; shown in SEQ ID NO. 7) and HTT5TR (TGAGCACAACATGGTGAACT; shown in SEQ ID NO. 8). The products were purified and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the target sequence of the wild-type Zhonghua 11 plant before mutation to analyze the mutation status.
[0086] The PCR amplification reaction system is shown in Table 3:
[0087] Table 3 PCR amplification reaction system
[0088]
[0089] The PCR amplification reaction conditions were as follows: 94°C for 2 min; 94°C for 20 sec, 58°C for 20 sec, 72°C for 30 sec, 30 cycles; 72°C for 5 min.
[0090] In this example, two different mutant strains were obtained, named htt5-1 and htt5-2. The sequencing results (5'→3') of the wild-type Zhonghua 11 and the mutant strains are shown below:
[0091] WT: CGACCTCTACCGCCACGACCCATGGGACCTCCCCCGGGACCTCCC CCACCGCGCCCTCTTCG
[0092] htt5-1:CGACCTCTACCGCCACGACC AC ATGGGACCTCCCCCGGGACCTCCCCCACCGCGCCCTCTTCG
[0093] htt5-2: CGACCTCTACCGCCACGACC--ATGGGACCTCCCCCGGGACCTCCCCCACCGCGCCCTCTTCG
[0094] Among them, WT represents wild type; htt5-1 and htt5-2 represent different mutant strains; “ AC" is the mutated base; "--" in the sequence indicates a base deletion. Comparison shows that the mutant strain obtained in this embodiment has a base deletion or mutation in the target sequence compared with the wild type, indicating that the present invention successfully mutated the OsHTT5 gene and obtained an OsHTT5 gene mutant strain (OsHTT5 protein function loss mutant strain). Example 3 Obtaining OsHTT5 gene mutant strains htt5-3 and htt5-4
[0095] In this example, the OsHTT5 gene was mutated using the same method as in Example 2, except that a different target sequence was used.
[0096] The sgRNA target sequence (5'→3') designed in this example is as follows:
[0097] Target-HTT5-U6:TCCCGGCCGGACGACGGCTT(SEQ ID NO.9)
[0098] Based on the target sequence, the adapter primers with sticky ends (5'→3') are designed as follows:
[0099] Target-HTT5-U6F:GCCGTCCCGGCCGGACGACGGCTT(SEQ ID NO.10)
[0100] Target-HTT5-U6R:AAACAAGCCGTCGTCCGGCCGGGA(SEQ ID NO.11)
[0101] In this example, two different mutant strains were obtained, named htt5-3 and htt5-4. The sequencing results (5'→3') of the wild-type Zhonghua 11 and the mutant strains are shown below:
[0102] WT: CGGCGGCGCAGTCGTGGGGGGAGACGCGGACGCCGGAGTCGGA GGTCGTCGACAGCGACG
[0103] htt5-3:CGGCCGGCCATCGTGGGGGGAG G ACGCGGACGCCGGAGTCGGAGGTCGTCGACAGCGACG
[0104] htt5-4:CGGCGGCGCAGTCGTGGGGG------TCGTCGACAGCGACG
[0105] Among them, WT represents wild type; htt5-3 and htt5-4 represent different mutant strains; the “G ” is the mutated base; “------” in the sequence indicates a base deletion. By comparison, the mutant strain obtained in this embodiment has a base deletion or mutation in the target sequence compared with the wild type, indicating that the present invention has successfully mutated the OsHTT5 gene and obtained an OsHTT5 gene mutant strain (OsHTT5 protein function loss mutant strain).
[0106] Example 4 Detection of the tolerance of OsHTT5 gene mutant strains to heat stress
[0107] In this example, the positive mutant lines htt5-1 and htt5-2 identified in Example 2 were subjected to heat stress treatment. The effects of the mutant OsHTT5 gene on the tolerance of rice to heat stress were observed by comparing the phenotypic changes of the plants before and after heat stress treatment, and detecting the survival rate (%), ion leakage rate (%), total chlorophyll content (mg / g), and hydrogen peroxide (H2O2) content (μM / g FW) of the plants after heat stress treatment.
[0108] Heat stress treatment: Several plump seeds of the wild type Zhonghua 11 and the OsHTT5 gene mutant strains htt5-1 and htt5-2 were selected, soaked in water, and clamped onto 96-well plates for hydroponics after the seeds germinated; after 14 days of growth, seedlings with consistent growth were selected and subjected to heat stress treatment respectively. The heat stress treatment conditions were: 45℃, 12h light / 12h dark, and the heat stress treatment time was 7 days; after heat stress treatment, the seeds were placed at 28℃ for recovery, and the recovery time was 5 days.
[0109] Determination of ion leakage rate (R1 / R2): Add 10 mL of sterile ddH2O to a 15 mL sterile centrifuge tube. Cut 0.05 g of rice seedling leaves of comparable size into small pieces and place them into the 15 mL centrifuge tube, completely immersing the leaves. Shake overnight at 100 rpm at room temperature. After overnight, invert the 15 mL centrifuge tube to mix thoroughly, and then measure R1 using a conductivity meter. After obtaining R1, place the 15 mL centrifuge tube in boiling water for 15 minutes. After cooling naturally to room temperature, measure it a second time using a conductivity meter to obtain R2. The ratio of R1 to R2 is the ion leakage rate.
[0110] Determination of hydrogen peroxide (H2O2) content: Use the Biyuntian Hydrogen Peroxide Content Detection Kit (Cat. No.: S0038) for determination. For specific procedures, please refer to the kit instructions.
[0111] The phenotypes of the OsHTT5 gene mutant and wild-type Zhonghua 11 lines before and after heat stress treatment are as follows: Figure 2 As shown. Figure 2It can be seen that after heat stress treatment, the leaves of htt5-1 and htt5-2 mutant strains did not shrink or die, while the wild-type plants showed high temperature intolerance.
[0112] The results of the heat stress tolerance test of the OsHTT5 gene mutant strain and the wild-type Zhonghua 11 strain are as follows: Figure 3 As shown, Figure 3 A to D in the figure are the test results of strain survival rate, ion leakage rate, total chlorophyll content and hydrogen peroxide content. Figure 3 It can be seen that compared with the wild type Zhonghua 11, the ion leakage rate and hydrogen peroxide content of the OsHTT5 gene mutant strains htt5-1 and htt5-2 decreased after heat stress treatment, while the survival rate and total chlorophyll content increased, with significant differences (p < 0.001), indicating that by mutating the rice OsHTT5 gene and inhibiting the expression of OsHTT5 protein, the tolerance of rice to heat stress can be significantly improved.
[0113] Example 5 Yield Trait Analysis of OsHTT5 Gene Mutant Strains
[0114] Several plump seeds of the wild-type Zhonghua 11 and the OsHTT5 gene mutant lines htt5-1 and htt5-2 were selected and grown to maturity according to conventional planting and management methods. Yield traits were analyzed (average fruit set rate, plant height, total number of grains per panicle, single plant weight (weight of the rice panicle of the entire plant) and length of each panicle were counted respectively).
[0115] The yield trait analysis results of OsHTT5 gene mutant strains and wild-type Zhonghua 11 strains are shown in Figure 2. Figure 4 As shown, Figure 4 A to E in the table are the statistical results of average fruit set rate, plant height, total number of grains per ear, plant weight and length of each ear. Figure 4 It can be seen that the average fruit set rate, plant height, total number of grains per panicle, single plant weight and length per panicle of the OsHTT5 gene mutant lines htt5-1 and htt5-2 were significantly different from those of the wild type Zhonghua 11 (p < 0.01 or p < 0.001), indicating that by mutating the rice OsHTT5 gene and inhibiting the expression of OsHTT5 protein, the average fruit set rate, plant height, total number of grains per panicle, single plant weight and length per panicle of rice can be significantly improved, thereby increasing rice yield.
[0116] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. A method for improving the heat stress tolerance and / or yield of rice, characterized in that: The method comprises: inhibiting the expression of OsHTT5 protein in rice; the amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.3; and increasing the rice yield by increasing the average seed setting rate, total number of grains per panicle, length of each panicle and weight per plant.
2. The method according to claim 1, characterized in that The expression of the OsHTT5 protein in rice is inhibited by interfering with the expression of the gene encoding the OsHTT5 protein, or by mutating or knocking out the coding region or promoter of the gene encoding the OsHTT5 protein.
3. Use of an agent for inhibiting OsHTT5 protein expression in improving the tolerance of rice to heat stress or in preparing a product for improving the tolerance of rice to heat stress, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.
3.
4. Use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with improved tolerance to heat stress, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO.
3.
5. Use of an agent for inhibiting OsHTT5 protein expression in increasing rice yield or in preparing a product for increasing rice yield, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO. 3; the reagent increases rice yield by increasing the average seed setting rate, total number of grains per panicle, length of each panicle and weight per plant.
6. Use of an agent for inhibiting the expression of OsHTT5 protein in cultivating rice plants with increased yield, characterized in that: The amino acid sequence of the OsHTT5 protein is shown in SEQ ID NO. 3; the reagent increases rice yield by increasing the average seed setting rate, total number of grains per panicle, length of each panicle and weight per plant.
Citation Information
Patent Citations
Application of OsHTT4 protein in regulation and control of heat resistance and yield of rice
CN119464361A