Genetically engineered bacterium for producing cerebroside in cordyceps sinensis as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for producing cerebroside components in cordyceps sinensis as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium provided by the invention comprises a chassis strain Aspergillus oryzae delta pyrG, and two ceramide synthase genes CsCerS1 and CsCerS2 which are derived from Cordyceps sinensis Cordyceps sinensis (BerK.) Sacc., and meanwhile, the ceramide synthase gene AoCerS1 which is endogenous in the Aspergillus oryzae strain is damaged or is not damaged. By using the genetically engineered bacterium to produce the cerebroside component in the cordyceps sinensis, the resource bottleneck problem of directly separating and obtaining the cerebroside component from the cordyceps sinensis can be solved, and the genetically engineered bacterium has a good application prospect.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, and in particular to a genetic engineering bacterium for producing cerebrosides in cordyceps sinensis, a construction method thereof and an application thereof. Technical Background

[0002] Cordyceps sinensis is a precious traditional Chinese medicine with a long history and culture, wide public recognition, unique resource distribution and important economic and social value. It is known as the treasure of Chinese medicine. Cordyceps sinensis is a dried complex of the fruiting body and larval corpse of the Cordyceps sinensis (BerK.) Sacc. of the ergot family parasitizing on the larvae of the bat moth family insects. It has multiple pharmacological effects such as immune regulation, anti-tumor, and anti-inflammatory. Literature reports that the cerebroside components in Cordyceps sinensis have significant immunosuppressive activity (the use of a class of cerebroside compounds as immunosuppressants, Chinese patent CN115010775A). Compared with the cerebroside components of plants and animals, the cerebroside components in Cordyceps sinensis contain a double bond between C8 and C9 of the sphingosine chain, and C9 is connected to a methyl group.

[0003] Cordyceps sinensis has harsh growth conditions and only grows in the Qinghai-Tibet Plateau at an altitude of 3,000-5,000 meters. 90% of it is distributed in the five provinces of Tibet, Qinghai, Sichuan, Yunnan, and Gansu in the Qinghai-Tibet Plateau of my country. A small amount is distributed in parts of the southern foothills of the Himalayas in Bhutan, India, and Nepal. It is not distributed in Europe and the United States, making it rare and expensive. Therefore, there is a resource bottleneck in directly isolating cerebroside components from Cordyceps sinensis.

[0004] Cerebrosides are a type of glycosphingolipids, which are composed of ceramides formed by amide bonds between sphingosine chains and long-chain acyl groups connected to hexose at the C-1 position. In the early stage, the biosynthetic pathway of fungal cerebroside compounds has been elucidated, among which ceramide synthase is the key gene that determines the structural composition of ceramide. Therefore, we replaced the endogenous ceramide synthase gene of Aspergillus oryzae with the ceramide synthase gene derived from Cordyceps sinensis in the Aspergillus oryzae chassis strain, thereby constructing an Aspergillus oryzae engineered strain with high yield of cerebrosides in Cordyceps sinensis, solving the resource bottleneck for in-depth development and utilization. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a genetically engineered bacterium for producing cerebrosides in Cordyceps sinensis.

[0006] The first aspect of the present invention provides a method for constructing a genetically engineered bacterium for producing cerebrosides in Cordyceps sinensis, wherein the chassis strain of the engineered bacterium is Aspergillus oryzaeΔpyrG, and two ceramide synthase genes CsCerS1 and CsCerS2 derived from Cordyceps sinensis are introduced into Aspergillus oryzae, while the endogenous ceramide synthase gene AoCerS1 of Aspergillus oryzae is destroyed.

[0007] In one embodiment, the chassis strain of the engineered bacteria is Aspergillus oryzae in which the orotidine-5'-phosphate decarboxylase gene (pyrG) is knocked out.

[0008] In one embodiment, two ceramide synthase genes CsCerS1 and CsCerS2 derived from Cordyceps sinensis are integrated into the genome of Aspergillus oryzae.

[0009] In one embodiment, the endogenous ceramide synthase gene AoCerS1 of the chassis strain Aspergillus oryzae is disrupted.

[0010] In one embodiment, when two ceramide synthase genes CsCerS1 and CsCerS2 of Cordyceps sinensis are introduced into Aspergillus oryzae or when the endogenous ceramide synthase gene of Aspergillus oryzae is knocked out, the recombinant plasmid is introduced into Aspergillus oryzae by protoplast transfection, Agrobacterium-mediated transfection, or electroporation transfection.

[0011] In one embodiment, the introduction of two ceramide synthase genes of Cordyceps sinensis and the destruction of the endogenous ceramide synthase gene of Aspergillus oryzae can be performed simultaneously or stepwise.

[0012] In one embodiment, the two ceramide synthase genes CsCerS1 and CsCerS2 of Cordyceps sinensis can be integrated into the genome of Aspergillus oryzae by homologous recombination or non-homologous recombination.

[0013] In one embodiment, the endogenous ceramide synthase gene AoCerS1 of Aspergillus oryzae is disrupted by point mutation, deletion mutation, or insertion mutation.

[0014] In a preferred embodiment, the genetically engineered bacteria are constructed by the following method:

[0015] (1) Insert the gRNA expression cassette targeting the endogenous ceramide synthase gene AoCerS1 of the chassis strain into the plasmid containing the pyrG defect screening tag and the Cas9 expression cassette to construct the knockout plasmid pBlue-gRNA AoCerS1-pyrG-Cas9; the two ceramide synthase genes CsCerS1 and CsCerS2 from Cordyceps sinensis were connected to the amylase promoter / terminator respectively, and then inserted into the recombinant plasmid containing 1300bp fragments upstream and downstream of the AoCerS1 cleavage site to construct the expression plasmid pHS AoCerS1 -CsCerS1-CsCerS2.

[0016] (2) pBlue-gRNA was transfected into protoplasts by PEG-mediated transfection AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 were simultaneously introduced into the chassis strain, and finally a genetically engineered bacterium was obtained in which AoCerS1 was knocked out and CsCerS1 and CsCerS2 were heterologously expressed to produce cerebrosides in Cordyceps sinensis.

[0017] The second aspect of the present invention provides a genetically engineered bacterium obtained by the above method.

[0018] The third aspect of the present invention provides the use of the above-mentioned engineered bacteria in the production of cerebrosides. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the insertion of two expression cassettes, CsCerS1 and CsCerS2, into the AoCerS1 cleavage site through homologous recombination. DETAILED DESCRIPTION

[0020] The present invention is further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. In the following embodiments, conventional techniques related to molecular biology and biomedicine, as well as gene protein sequences accessible in public databases, are not described in detail.

[0021] Example 1 Construction of genetically engineered bacteria

[0022] 1. Construction of chassis strain Aspergillus oryzaeΔpyrG

[0023] The pyrG gene of Aspergillus oryzae JNU24XJ0557 (accession number CGMCC41560, accession date October 30, 2024) was mined using local blast, and its sgRNA expression cassette was designed based on the pyrG gene, constructed into the pBlue-Cas9 plasmid containing the plasmid autonomous replication element AMA1 and the Cas9 expression cassette, and the knockout plasmid was constructed and transfected into Aspergillus oryzae JNU24XJ0557. The 5-FoA SCD+Ura plates were used for screening, and the clones growing on the plates were picked for genomic PCR verification and sequencing to obtain the Aspergillus oryzaeΔpyrG strain in which the pyrG gene was successfully knocked out. The clones in which the pyrG gene was successfully knocked out by sequencing were inoculated on DPY and DPY+Ura plates for secondary verification, and the clones that could only grow on DPY+Ura plates but not on DPY plates were picked for subsequent directed integration.

[0024] 2. pBlue-gRNA AoCerS1 Construction of -pyrG-Cas9 plasmid

[0025] Using sgRNACas9 software to screen and obtain gRNA targeting AoCerS1 AoCerS1 , gRNA AoCerS1 The nucleotide sequence is TCAACGCTTGGTTAAGCGGT (SEQ ID NO.1). Then, using primers containing the target sequence and other related primers, the U6 promoter and gRNA Scaffold fragment were amplified from the template plasmid, and finally the gRNA expression cassette targeting AoCerS1 (SEQ ID NO.2) was obtained by fusion PCR. It was then inserted into a plasmid containing a pyrG (pyrG element sequence is shown in SEQ ID NO.3) defect screening tag and a Cas9 expression cassette to form a knockout plasmid pBlue-gRNA AoCerS1 -pyrG-Cas9 (SEQ ID NO. 4).

[0026] 3. pHS AoCerS1 - Construction of CsCerS1-CsCerS2 plasmid

[0027] Amplify the homology arm fragments of 1300 bp upstream and downstream of the AoCerS1 cleavage site from the genome of the chassis strain, and then insert them into the plasmid pESC through In-fusion to form the recombinant plasmid pHS AoCerS1CsCerS1 and CsCerS2 were amplified from the genome of Cordyceps sinensis, and then inserted into the pBlue-amyB plasmid containing the amylase promoter and terminator, respectively. The CsCerS1 and CsCerS2 expression cassettes were amplified (the CsCerS1 expression cassette sequence is shown in SEQ ID NO.5, and the CsCerS2 expression cassette sequence is shown in SEQ ID NO.6), respectively, and then inserted into pHS by In-fusion. AoCerS1 In the formation of pHS AoCerS1 -CsCerS1-CsCerS2 (SEQ ID NO. 7).

[0028] 4. Insert pBlue-gRNA AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 were simultaneously transfected into the base strain Aspergillus oryzaeΔpyrG to obtain a gene strain producing cerebrosides ( Figure 1 ).

[0029] 1) Separately transfer the pBlue-gRNA AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 E. coli host cells were inoculated into 20-30 mL of LB liquid medium containing 100 μg / mL ampicillin antibiotics and cultured overnight, and then high-concentration (>1 μg / μL) recombinant plasmids were extracted for subsequent transfection experiments;

[0030] 2) Pick an appropriate amount of mycelium from the bottom plate of A. oryzaeΔpyrG strain and place it in 10 mL DPY+Ura medium (2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4, 0.2% uracil) at 28°C and 200 rpm shaking for 1-2 days;

[0031] 3) Add 10 mL of the above culture solution to 100 mL of DPY+Ura medium, mix well, and culture at 28°C and 180 rpm for 1 day;

[0032] 4) Prepare 10 mL of TF solution 1: weigh 0.79 g (NH4)2SO4 and 0.1 g Yatalase lyase in a 15 mL centrifuge tube, add 10 mL of TF solution 0, turn it upside down to dissolve, and filter it into a 50 mL centrifuge tube using a 0.22 μm microporous filter membrane;

[0033] 5) According to the concentration of the bacterial solution, take an appropriate amount of the bacterial solution into a sterilized syringe, filter the bacterial solution, squeeze and collect the bacterial cells, take out the bacterial cells with a sterilized long bamboo stick, put them into a centrifuge tube containing 10mL TF solution 1, and culture them in a constant temperature box at 30℃ and 70rpm for 3h to break the cell wall; when the supernatant is obviously turbid and light red, filter the protoplasted bacterial solution through the syringe filter into a 50mL centrifuge tube;

[0034] 6) Add an equal amount of TF solution 2, mix by inverting, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, add 5 mL of TF solution 2 to the precipitate, mix by inverting, aspirate 10 μL, count the number of protoplasts under a microscope using a hemocytometer, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, and add an appropriate volume of TF solution 2 (according to the number of protoplasts counted above, dilute or concentrate appropriately to make the protoplast concentration between 1 and 5 × 10 7 / mL), mix by inverting;

[0035] 7) Take 200 μL of the protoplast solution into a 15 mL centrifuge tube, add 10 μL of the recombinant plasmid at a concentration of 1 μg / μL, mix well, and let stand on ice for 30 min. Add 250 μL, 250 μL, and 850 μL of TFsolution 3 to the suspension three times, respectively. After each addition, gently mix with a 1 mL pipette tip and let stand at room temperature for 20 min.

[0036] 8) After standing, add 5 mL of TF solution 2 to a 15 mL centrifuge tube, mix by inverting, centrifuge at 4°C, 1500 rpm for 10 min, discard the supernatant, add 200 μL of TF solution 2, gently suspend, add to the center of the lower culture medium, and quickly add the upper culture medium around it, and shake quickly;

[0037] 9) After the above culture medium plate is blown dry, it is wrapped with parafilm and placed upside down in a 28°C incubator for 3-7 days. The transformed strains are picked and then verified by PCR. The strains with positive PCR results are used for subsequent fermentation experiments.

[0038] Example 2 Fermentation of genetically engineered bacteria and identification of cerebroside products

[0039] The genetically engineered bacteria AO-CsCerS1 / 2 constructed in Example 1 was activated by PDA slant, and an appropriate amount of mycelium was picked out and placed in 10 mL DPY medium (2% dextrin, 1% polypeptide, 0.5% yeast extract, 0.05% MgSO4·7H2O, 0.5% KH2PO4), and cultured at 28°C and 200 rpm for 1-2 days; 10 mL of the above culture solution was added to 100 mL DPY medium, mixed and cultured at 28°C and 180 rpm for 1 day to obtain seed solution. According to the inoculation amount of 10mL seed liquid / bottle, it was inoculated into CD-starch fermentation medium (0.3% NaNO3, 0.2% KCl, 0.05% MgSO4·7H2O, 0.1% KH2PO4, 0.002% FeSO4·7H2O, 1% polypeptide, 2% starch, pH 5.5), and a total of 350 bottles were fermented in a shaker at 220rpm and 28℃ for 6 days. After the fermentation liquid was filtered, the bacteria were collected, and then extracted with 90% methanol water for 3 times to obtain 35L of bacterial extract. After the extract was adsorbed on an ODS chromatographic column, it was eluted with 93% methanol and 100% methanol in turn, and the 100% methanol elution was collected to obtain the eluate, which was the cerebroside enrichment site, and the solid product was concentrated and dried to obtain about 7.30g.

[0040] The obtained solid product was further separated and purified by a gel column (Sephadex LH-20) and isocratically eluted with pure methanol to obtain four fractions, CSM-1 (1.21 g), CSM-2 (0.73 g), CSM-3 (4.35 g), and CSM-4 (0.33 g). The fractions where the target compound was located were tracked by TLC thin layer chromatography (developing solvent: chloroform: methanol: water = 9:1.5:0.05; Rf value range of target compound 0.4-0.7), and it was found that the cerebroside compounds were mainly concentrated in the CSM-3 fraction. Next, the CSM-3 fraction was further separated by silica gel column chromatography (5*30 cm) in a chloroform-methanol elution system (95:5, 90:10, 80:20, 75:25, 70:30, 65:35, 60:40, v / v, 500 mL each) to obtain 5 fractions (CSM-3-1, CSM-3-2, CSM-3-3, CSM-3-4, CSM-3-5). The fraction containing the target compound was traced to CSM-3-4 by TLC thin layer chromatography (developing solvent: chloroform: methanol: water = 9:1.5:0.05; Rf value range of the target compound was 0.4-0.7). The CSM-3-4 fraction (2.06 g) was prepared by methanol-water (92:8, v / v) and further purified by a Pheromone C18 preparative column (21.2×250 mm) at a flow rate of 8 mL / min to obtain a mixture of cerebroside compounds of formula (I), formula (II) and formula (III), wherein formula (I) (t R :73.0min,460.3mg), mixture of formula (II) & formula (III) (t R :90.0min,850.8mg), formula (IV) (t R :115.0min,350.6mg). Further, since the polarity of formula (II) and formula (III) is similar, a phenomenyl analytical column (5μm, 4.6×250mm) is used to further separate and purify them. The mobile phase conditions are 88% methanol-water, the flow rate is 1mL / min, and the detection wavelength λ=208nm. Formula (II) (t R :22.5min,700.8mg), formula (III) (t R :27.0min,89.2mg). By comparing the NMR data of the cerebroside compounds of formula (I), formula (II), formula (III) and formula (IV) isolated from Cordyceps sinensis, the structures of the cerebroside compounds of formula (I), formula (II), formula (III) and formula (IV) isolated from the genetically engineered bacteria AO-CsCerS1 / 2 were determined. The results are shown in Tables 1, 2, 3 and 4.

[0041] Table 1 NMR data attribution of formula (I) (400MHz, in Pyr-d5)

[0042]

[0043]

[0044]

[0045]

[0046] * Signals may be interchanged within the same column

[0047] Table 2 NMR data assignment of formula (II) (400MHz, in Pyr-d5)

[0048]

[0049]

[0050]

[0051]

[0052] * Signals may be interchanged within the same column

[0053] Table 3 NMR data attribution of formula (III) (600MHz, in Pyr-d5)

[0054]

[0055]

[0056]

[0057]

[0058] * Signals may be interchanged within the same column

[0059] Table 4 NMR data attribution of formula (IV) (400MHz, in Pyr-d5)

[0060]

[0061]

[0062]

[0063]

[0064] *Signals may be interchanged within the same column

[0065] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for constructing a genetically engineered bacterium for producing cerebrosides in Cordyceps sinensis, characterized in that: The method comprises: using Aspergillus oryzae as a base strain, and introducing two ceramide synthase genes CsCerS1 and CsCerS2 derived from Cordyceps sinensis into Aspergillus oryzae.

2. The method according to claim 1, characterized in that The chassis strain is Aspergillus oryzae in which orotidine-5'-phosphate decarboxylase gene (pyrG) is knocked out.

3. The method according to claim 1 or 2, characterized in that The Aspergillus oryzae endogenous ceramide synthase gene AoCerS1 is disrupted or not disrupted.

4. The method according to claim 1, characterized in that When two ceramide synthase genes CsCerS1 and CsCerS2 of Cordyceps sinensis are introduced into Aspergillus oryzae or when the endogenous ceramide synthase gene of Aspergillus oryzae is knocked out, the constructed recombinant plasmid is introduced into Aspergillus oryzae by protoplast transfection, Agrobacterium-mediated transfection or electroporation transfection.

5. The method according to claim 1, characterized in that The steps of introducing two ceramide synthase genes of Cordyceps sinensis and destroying the endogenous ceramide synthase gene of Aspergillus oryzae can be performed simultaneously or stepwise.

6. The method according to claim 1, characterized in that When the two ceramide synthase genes CsCerS1 and CsCerS2 of Cordyceps sinensis are integrated into the genome of Aspergillus oryzae, it can be carried out through homologous recombination or non-homologous recombination.

7. The method according to claim 3, wherein the endogenous ceramide synthase gene AoCerS1 of Aspergillus oryzae is disrupted in a manner selected from site-directed mutagenesis, deletion mutagenesis or insertion mutagenesis.

8. The method according to any one of claims 1 to 7, characterized in that: The method is: (1) Insert the gRNA expression cassette targeting the endogenous ceramide synthase gene AoCerS1 of the chassis strain into the plasmid containing the pyrG defect screening tag and the Cas9 expression cassette to construct the knockout plasmid pBlue-gRNA AoCerS1 -pyrG-Cas9; (2) The two ceramide synthase genes CsCerS1 and CsCerS2 from Cordyceps sinensis were connected to the amylase promoter / terminator respectively, and then inserted into the recombinant plasmid containing the 1300 bp fragments upstream and downstream of the AoCerS1 cleavage site to construct the expression plasmid pHS AoCerS1 -CsCerS1-CsCerS2. pBlue-gRNA was transfected into protoplasts by PEG-mediated transfection AoCerS1 -pyrG-Cas9 and pHS AoCerS1 -CsCerS1-CsCerS2 were simultaneously introduced into the chassis strain, and finally a genetically engineered bacterium for producing Cordyceps sinensis mesencephaloside was obtained in which AoCerS1 was knocked out and CsCerS1 and CsCerS2 were heterologously expressed.

9. A genetically engineered bacterium obtained by constructing according to any one of claims 1 to 8.

Images