Application of GSW8 gene in regulation and control of high temperature resistance of rice

Abstract

The invention discloses application of a GSW8 gene in regulation and control of high-temperature resistance of rice, and belongs to the technical field of gene engineering. The GSW8 gene responds to high temperature stress of rice, knockout mutants GSW8-KO1 and GSW8-KO2 of the GSW8 gene and overexpression materials GSW8-OE1 and GSW8-OE2 are constructed, the mutants and the overexpression materials are subjected to seedling-stage high-temperature treatment, the survival rate of plants is observed, and the GSW8 negative regulation and control of the high temperature tolerance of the rice is found. New gene resources and genetic materials are provided for improving the high-temperature tolerance of the rice and cultivating new high-temperature-resistant varieties, and the GSW8 gene has important breeding application value in regulation and control of the high-temperature tolerance of the rice.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to an application of a GSW8 gene in regulating high temperature tolerance of rice. Background Art

[0002] Rice (Oryza sativa L.) is one of the world's major food crops. In recent years, the global climate has gradually warmed, and frequent high temperatures in summer have greatly reduced crop yields. Rice is very sensitive to high temperatures. Studies have found that for every 1°C increase in average daily temperature, rice yield will decrease by 3.2%. This is because high temperature stress will accelerate the growth rate of rice plants, shorten the rice growth cycle, and reduce the number of effective tillers and panicles of rice, thereby affecting rice yield and quality. High temperature will make rice leaves smaller and reduce leaf area, thereby affecting its photosynthesis efficiency and growth and development speed. In addition, high temperature stress will cause changes in rice flowering time, affect its pollination efficiency, lead to a decrease in its fruiting rate, and changes in panicle shape such as shortened panicle length and reduced panicle number. These factors will affect the final yield of rice. Chloroplast membrane damage caused by high temperature stress will damage the chloroplast structure of rice and hinder the photosynthesis of leaves, causing rice leaves to turn yellow or white. In addition, high temperature stress will also change the morphology and density of rice root hairs, causing the root system to become shorter and the root mass to decrease, affecting the absorption of water and nutrients by rice roots.

[0003] When rice is exposed to high temperatures during the seedling stage, its growth and development will be hindered, and the seedlings may turn white or even die. When rice is exposed to high temperatures during the heading stage, it will directly lead to a decrease in the fruit set rate, a reduction in rice yield or even a total crop failure. Therefore, discovering the heat-resistant genes of rice is of great significance for breeding new heat-resistant rice varieties. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide an application of the GSW8 gene in regulating the high temperature tolerance of rice, so as to enhance the ability of rice to tolerate high temperatures.

[0005] The technical solution of the present invention to solve the above technical problem is as follows: provide an application of a GSW8 gene in regulating high temperature tolerance of rice, the nucleotide sequence of the GSW8 gene is shown in SEQ NO.1.

[0006] Furthermore, knocking out the GSW8 gene enhances rice's high temperature tolerance.

[0007] Furthermore, overexpression of the GSW8 gene reduced rice's high temperature tolerance.

[0008] The invention provides a preparation for regulating high temperature tolerance of rice, and the preparation comprises a GSW8 gene.

[0009] Further, the formulation includes an agent capable of inhibiting the expression of the GSW8 gene.

[0010] Furthermore, the preparation also includes an agent capable of overexpressing the GSW8 gene.

[0011] The present invention also provides a method for preparing a high temperature resistant rice variety, and the high temperature resistant rice variety is prepared by knocking out the GSW8 gene.

[0012] The present invention has the following beneficial effects: The present invention finds that the GSW8 gene responds to high temperature stress in rice. By constructing knockout mutants GSW8-KO1 and GSW8-KO2 of the GSW8 gene, and overexpression materials GSW8-OE1 and GSW8-OE2, and then subjecting the mutants and overexpression materials to high temperature treatment at the seedling stage, the survival rate of the plants is observed, and it is found that GSW8 negatively regulates the high temperature tolerance of rice. Knocking out the GSW8 gene will enhance the high temperature tolerance of rice, while overexpressing the GSW8 gene will reduce the high temperature tolerance of rice. The present invention provides new gene resources and genetic materials for improving the high temperature tolerance of rice and cultivating new high temperature resistant varieties. The GSW8 gene of the present invention has important breeding application value in regulating the high temperature tolerance of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The expression of GSW8 gene in different rice materials before and after high temperature treatment at seedling stage;

[0014] Figure 2 To analyze the expression of GSW8 gene induced by high temperature by quantitative PCR;

[0015] Figure 3 Schematic diagram of GSW8 knockout target site and knockout plant mutation method;

[0016] Figure 4 This is a schematic diagram of the structure of the GSW8 knockout vector GSW8-BGK03;

[0017] Figure 5 Schematic diagram of the GSW8 overexpression vector structure;

[0018] Figure 6 The quantitative detection results of GSW8 overexpressing plants;

[0019] Figure 7 Comparison of phenotypes of wild-type ZH11 and GSW8 knockout mutant before and after high temperature treatment;

[0020] Figure 8 Comparison of the phenotypes of wild-type ZH11 and GSW8 overexpressing materials before and after high temperature treatment. DETAILED DESCRIPTION

[0021] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0022] Example 1 Expression of GSW8 gene in different rice materials before and after high temperature treatment at seedling stage

[0023] Eleven representative rice varieties of different types, including Basmatil, CG14, DG, Kasalath, Lemont, LJ, NAMROO, NIP, R498, TM and TUMBA, were germinated at normal temperature and grown for 14 days before being subjected to high temperature treatment (45°C for 9 hours) at the seedling stage. RNA was extracted from leaves of each material under normal temperature and high temperature treatment conditions, and transcriptome sequencing was performed to quickly screen differentially expressed genes under high temperature and normal temperature. After analyzing the transcriptome data, it was found that the expression level of the GSW8 gene was significantly different under normal temperature and high temperature. The results are as follows: Figure 1 As shown in the figure, the expression of GSW8 gene was significantly downregulated in 11 representative rice varieties of different types after high temperature induction. Therefore, it is speculated that this gene may be involved in the high temperature stress response of rice.

[0024] Example 2 Expression of GSW8 gene after high temperature induction

[0025] The expression changes of the GSW8 gene after high temperature treatment were confirmed by quantitative PCR detection. First, a pair of quantitative PCR primers Y1879-F and Y1880-R were designed on the CDS of the GSW8 gene using PrimerPremier 6 software. The primer sequences are as follows:

[0026] Y1879-F: 5'-GGTGGTTTCATTCTTGGAG-3' (SEQ ID NO. 2);

[0027] Y1880-R: 5'-CACATCTTGGGACCCTTTG-3' (SEQ ID NO. 3).

[0028] The wild-type R498 variety was cultured in a plant growth incubator at 28°C for 14 days and then transferred to a 45°C incubator for high temperature treatment. After 0h, 0.5h, 1h, 3h, 6h, 12h and 24h of treatment, leaves were taken to extract RNA according to the kit instructions, and reverse transcribed using the kit to obtain cDNA. Then, a quantitative PCR kit was used to analyze the expression of the GSW8 gene after high temperature treatment for different times using the above quantitative primers. The results are shown in Figure 2As shown, it was found that the expression level of GSW8 gene began to significantly down-regulate after 0.5h of high temperature treatment, and the expression level reached the lowest after 1h and 3h, and then the expression level began to return to normal levels, proving that the GSW8 gene is involved in the high temperature stress response of rice.

[0029] Example 3 Construction of knockout mutant of GSW8 gene

[0030] (1) CRISPR / Cas9 knockout target site selection

[0031] To obtain a complete loss-of-function mutant, we designed a knockout target site near the ATG in exon 1 of GSW8 (see Figure 3 , where the underline represents the PAM sequence; “.” represents the base deletion at that position; WT is the wild-type medium 11), and the target site sequence is: 5'-CCAACTAAGCAATGGCCTTT-3' (SEQ ID NO. 4).

[0032] (2) Construction of CRISPR / Cas9 knockout vector

[0033] The present invention uses a CRISPR / Cas vector construction kit, selects a CRISPR / Cas vector BGK03 suitable for rice, and constructs a knockout vector GSW8-BGK03 of GSW8. The specific process is as follows:

[0034] ①Synthesize Oligo sequence and prepare Oligo dimer: Design Oligo-F and Oligo-R sequences corresponding to the kit according to the above target sequence. The sequences are as follows:

[0035] Oligo-F: 5'-TGTGGTGCCAACTAAGCAATGGCCTTT-3' (SEQ ID NO.5);

[0036] Oligo-R: 5'-AAACAAAGGCATGCTTAGTTGGCA-3' (SEQ ID NO. 6).

[0037] The above oligo primers were synthesized, dissolved in water to 10 μM, and a reaction system (18 μL Buffer Anneal, 1 μL Oligo-F, 1 μL Oligo-R) was prepared. After mixing, the mixture was heated at 95°C for 3 min on a PCR instrument, and then slowly decreased to 20°C at a rate of 0.2°C / s to obtain an oligo dimer.

[0038] ② Connect the Oligo dimer to the BGK03 vector: Prepare the connection reaction system (10 μL) on ice, the formula is as follows: 1 μL Enzyme Mix, 2 μL BGK03 Vector, 1 μL Oligo dimer, 6 μL ddH2O. After mixing, react at room temperature for 1 hour to complete the connection.

[0039] ③ E. coli transformation: Take out the DH5α competent cell from the -80℃ refrigerator, place it on ice to melt, then add the ligation product of step ② above, mix gently, and let it stand on ice for 30 minutes; then heat shock in a 42℃ water bath for 50 seconds, and immediately put it back on ice to stand for 2 minutes; add 900μL of antibiotic-free LB liquid culture medium (formula see Table 1) to the centrifuge tube, mix well, place it on a 37℃ shaker, and incubate it at 180rpm for 60min; centrifuge at 3000rpm at room temperature for 3min to collect the bacterial solution, retain 80μL of the supernatant (discard the rest), gently blow to resuspend the bacteria, evenly spread it on an LB plate containing kanamycin resistance, and place it in a 37℃ incubator for overnight.

[0040] Table 1 LB medium formula

[0041]

[0042] ④ Obtain the GSW8 knockout vector GSW8-BGK03 plasmid: Pick the monoclonal clone grown on the LB plate in step ③, inoculate it into 5 mL LB liquid culture medium containing kanamycin, and culture it overnight at 37°C in a shaker at 200 rpm; use OMEGA Plasmid Miniprep Kit I (D6943) to extract the plasmid according to the instructions; use the extracted plasmid to construct a special sequencing primer for the BGK03 vector, sequence and verify the target site sequence, and obtain the correctly connected GSW8 knockout vector GSW8-BGK03 (see Figure 4 ); wherein the sequence of the dedicated sequencing primer for constructing the BGK03 vector is as follows: 5'-CCCAGTCACGACGTTGTAA-3' (SEQ ID NO.7).

[0043] (3) Rice genetic transformation

[0044] ① Knockout vector plasmid transformation of Agrobacterium EHA105: Add 1 μL knockout vector plasmid to 1 tube of EHA105 competent cells, place on ice for 30 minutes; quickly freeze in liquid nitrogen for 2 minutes; place in a 37℃ metal bath for 5 minutes to dissolve the cells; immediately add 600 μL of non-antibiotic LB medium, place in a 28℃ shaker, culture at 180rpm for 2-3 hours; centrifuge at 5000rpm for 3 minutes, retain 100 μL of LB medium to resuspend the bacteria; evenly spread on an LB plate containing rifampicin and kanamycin resistance, and culture in a 28℃ incubator for 2-3 days. Pick the monoclonal bacteria grown on the plate, identify the positive clones, and store the positive clones in a -80℃ refrigerator for later use.

[0045] ②Transformation of rice variety Zhonghua 11 (ZH11): The wild-type rice variety Zhonghua 11 was transformed using the Agrobacterium-mediated method, and hygromycin was used for resistance screening to obtain the GSW8 gene knockout mutants GSW8-KO1 and GSW8-KO2.

[0046] Example 4 Construction of GSW8 gene overexpression material

[0047] Total RNA was extracted and cDNA was obtained by reverse transcription using RNA extraction and reverse transcription kits from Chengdu Fuji Biotechnology Co., Ltd. The specific operation steps were carried out according to the instructions of the kit. The synthesized cDNA was used as a template to design amplification primers Y1865 and Y1866, and the coding region sequence of the GSW8 gene was amplified using the amplification primers. Then, the coding region sequence of the GSW8 gene was fused to the plant expression vector pCAM1300A between the XbaI and SalI restriction sites using a multi-fragment recombinase to obtain the GSW8 overexpression vector pCAM1300A-GSW8 (see Figure 5 ), and the vector was transformed into wild type ZH11 with reference to the rice genetic transformation steps in Example 3 above, and hygromycin was used for resistance screening to obtain GSW8 gene overexpression materials GSW8-OE1 and GSW8-OE2. Total RNA from leaves of overexpressing plants was extracted with reference to the above method, and cDNA was obtained by reverse transcription and fluorescence quantitative PCR detection was performed with primers Y1879 / 1880, with ACTIN primers as internal reference; wherein, the primer sequences are shown in Table 2.

[0048] Table 2 Primer sequences

[0049] Primer name Sequence (5'-3') Y1865 ACCCGGGGATCCTCTAGAATGGGTTCACGGTTTCCATCC(SEQ ID NO.8) Y1866 CCCATCAACCACGTCGACGACTGGTATTACATCGATGTTCGATG(SEQ ID NO.9) Y1879 GGTGGTTTCATTCTTGGAG(SEQ ID NO.10) Y1880 CACATCTTGGGACCCTTTG(SEQ ID NO.11) ACTIN-F TGTATGCCAGTGGTCGTACCA(SEQ ID NO.12) ACTIN-R CCAGCAAGGTCGAGACGAA(SEQ ID NO.13)

[0050] Following the above steps, the overexpression plants GSW8-OE1 and GSW8-OE2 with significantly upregulated expression levels were successfully obtained (see Figure 6 ).

[0051] Example 5 GSW8 gene negatively regulates rice high temperature tolerance

[0052] To further verify whether the GSW8 gene is involved in regulating rice heat tolerance, wild-type ZH11, knockout mutants GSW8-KO1 and GSW8-KO2 were subjected to high temperature treatment at the seedling stage (see Figure 7 A), the treatment conditions are (see Figure 7 B): Seedlings grown at 28℃ for 14 days were treated at 42℃ for 96 hours, and then resumed growth at normal temperature of 28℃ for 7 days. Figure 7 As shown in C, after high temperature treatment, the survival rate of wild-type ZH11 was only 12.78%, while the survival rates of GSW8-KO1 and GSW8-KO2 were significantly higher than those of the wild-type, reaching 85.99% and 85.53%, respectively.

[0053] In addition, wild-type ZH11, overexpressing materials GSW8-OE1 and GSW8-OE2 were subjected to high temperature treatment at seedling stage (see Figure 8 A), the treatment conditions are (see Figure 8 B): Seedlings grown at 28℃ for 14 days were treated at 42℃ for 72 hours, and then resumed growth at normal temperature of 28℃ for 7 days. Figure 8 As shown in C, after high temperature treatment, the survival rate of wild-type ZH11 was 89.60%, while the survival rates of GSW8-OE1 and GSW8-OE2 were significantly lower than that of the wild-type, at 21.35% and 27.48%, respectively.

[0054] The above results indicate that the GSW8 gene negatively regulates the high temperature tolerance of rice. Disrupting the GSW8 function by gene editing and other means can significantly improve the high temperature tolerance of rice.

[0055] In summary, the present invention proves that the GSW8 gene can respond to high temperature stress in rice and negatively regulate the high temperature tolerance of rice, providing a new gene resource for breeding high temperature resistant rice varieties.

[0056] The nucleotide sequence of the GSW8 gene in the present invention is as follows:

[0057] ATGGGTTCACGGTTTCCATCCCACCAACTAAGCAATGGCCTTATG

[0058] TCTCGGGCCGACCAGAGCAACCTAAGGAGAAGGCTCCAGTCATTGCT

[0059] CCACAGCAATGCCATACACTGGGGGTGACATAAAGAAATCTGGAGAAC

[0060] TAGGGAAAATGTTTGACCTCCATGTTGAAAAGTCGCGGAAGTCTGGTC

[0061] CTTTGGGTAATCAACCTTCAAGAAATACTTCATTTGGTGGTGCTGGTTC

[0062] CAACTCTGGACCAGTTTCTAATGCTCTTGGTCGGTCCAACTACTCTGGT

[0063] TCTATTTCATCATCTGTTCCTGGTGCTGGAGGATCAGCAAGGGCAAAAT

[0064] CAAATTCTGGACCTCTCAATAAGCATGGAGAACCAGGAAAGAAGTCAT

[0065] CTGGTCCCCAGTCAGGCGGAGTGACCCCAATGGCACGTCAGAATTCTG

[0066] GTCCTTTACCTCCTGTTCTTCCTACAACTGGGCTGATCACATCAGGGCC

[0067] TATCTCCTCTGGACCTCTGAATTCATCTGGTGCTCCACGAAAAGTATCA

[0068] GGCCCTCTTGATCCTAGTGTATCAATGAAGATGCGTGCAACTTCTTTTG

[0069] CTCACAACCCAGCTGTTACAAACCTGAATGCCGATGATGGTTACTCTAT

[0070] TAAGGGCAGCATTCCTAAGACAATACTCTGGATGGTTATTCTGCTCTTTT

[0071] TGATGGGGTTCATAGCAGGTGGTTTCATTCTTGGAGCTGTTCATAACCC

[0072] TATTCTGCTGGTAGTTGTGGTGGTCATATTTTGCTTTGTTGCTGCTCTTG

[0073] TGATTTGGAACATTTGCTGGGGAACAAGAGGTGTGACTGGGTTCGTCA

[0074] GTCGCTATCCTGATGCTGATCTCAGAACAGCAAAAGATGGACAGTATGT

[0075] GAAGTTACTGGGGTTGTTACATGTGGAAATTTTCCTCTCGAGTCCTCA

[0076] TTTCAAAGGGTCCCAAGATGTGTGTACACTTCAACTTGCTTGTATGAGT

[0077] ACAGGGGCTGGGATTCGAAAGCTGCTAACACTGAGCACCGCCAATTTA

[0078] CTTGGGGTCTTAGGTCAATGGAGAGACATGCTGTTGATTTCTACATCTC

[0079] TGATTTCCAATCTGGACTACGAGCATTGGTCAAAACAGGATATGGAGC

[0080] ACGGGTAACCCCTTATGTTGATGAATCTGTTGTTATTGACATAAACCCA

[0081] GATAACAAGGACATGTCCCCCGAGTTCTTGAGATGGCTGCGTGAAAGG

[0082] AATCTATCAAGTGATGATCGGATAATGCGCCTGAAAGAAGGATACATTA

[0083] AGGAGGGCAGCACGGTGAGTGTTATGGGGGTTGTTCAAAGGAACGAC

[0084] AACGTGTTGATGATTGTTCCTCCATCGGAACCCATCTCCACTGGCTGCC

[0085] AGTGGGCCAAGTGCATCCTCCCTACTAGCCTTGATGGGCTAGTCTTAAG

[0086] ATGCGAAGATACATCGAACATCGATGTAATACCAGTCTGA(SEQ NO.1).

[0087] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. An application of the GSW8 gene in regulating high temperature tolerance of rice, characterized in that: The nucleotide sequence of the GSW8 gene is shown in SEQ NO.

1.

2. The use of the GSW8 gene in regulating high temperature tolerance of rice according to claim 1, characterized in that: Knocking out the GSW8 gene will enhance the high temperature tolerance of rice.

3. The use of the GSW8 gene in regulating high temperature tolerance of rice according to claim 1, characterized in that: Overexpression of the GSW8 gene reduces high temperature tolerance in rice.

4. A preparation for regulating high temperature tolerance of rice, characterized in that The preparation comprises the GSW8 gene according to claim 1.

5. The preparation for regulating high temperature tolerance of rice according to claim 4, characterized in that The formulation includes an agent capable of inhibiting the expression of the GSW8 gene.

6. The preparation for regulating high temperature tolerance of rice according to claim 4, characterized in that The preparation also includes an agent capable of overexpressing the GSW8 gene.

7. A method for preparing a high temperature resistant rice variety, characterized in that: Preparation of heat-tolerant rice varieties by knocking out the GSW8 gene.

Images