Protein TaVrs3 as well as coding gene and application thereof

Abstract

The invention discloses a protein TaVrs3 as well as a coding gene and application thereof. The application of the protein TaVrs3 or the biological material related to the protein TaVrs3 provided by the invention in any one of the following aspects: E1) regulating and controlling the ear type of a plant; e2) regulating the number of plant spikelet; e3) regulating and controlling the number of grains per ear of the plant; e4) regulating and controlling the weight of the plant seeds; according to the present invention, the experiment results show that the spikelet number, the floret number and the grain number per ear can be significantly increased by simultaneously editing the protein genes TaVrs-B3 and TaVrs-D3 in the wild wheat Fielder, such that the protein TaVrs3 has important application value in the regulation of the wheat ear type character, and has wide prospects in the cultivation of wheat varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to protein TaVrs3 and its encoding gene and application. Background Art

[0002] Wheat is one of the major food crops in the world. Currently, with limited arable land, breeding varieties with longer ears and slightly more spikelets (such as 1-3 more spikelets per ear) to promote coordinated improvement of traits such as number of grains per ear and grain weight is one of the effective ways to carry out high-yield wheat breeding. Therefore, the wheat inflorescence organ "wheat ear" has always been an important trait that wheat breeders pay attention to.

[0003] Wheat has a compound spike inflorescence with several nodes on the spike axis. Usually, there is a spikelet at the base of each node, and each spikelet produces 3-10 florets. If one or more spikelets are born at the base of each node (multiple spikelet traits), it is expected to increase the number of florets per spike and thus increase the yield per plant. For example, some scholars have reported using gene editing technology to edit wheat. DUO1 Gene, found that the gene editing mutant duo1 The lower and middle parts of the spikelets showed a multi-spikelet phenotype with 2-3 spikelets at the base of each axis node. Field yield plot experiments showed duo1 Compared with the wild type, the number of grains per ear can be significantly increased, thereby increasing the yield per unit area of ​​wheat. Therefore, using gene editing to create new favorable genetic mutations with a "multi-spikelet" phenotype in wheat can hopefully increase wheat yield. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to use gene editing to achieve TaVrs3 Gene knockout regulates wheat ear shape traits.

[0005] In order to solve the above technical problems, the first aspect of the present invention provides the use of any one of the following substances A1) -A3) in any one of the following E1-E6: E1) regulates plant panicle shape; E2) regulates the number of spikelets in plants; E3) Regulates the number of grains per ear in plants; E4) Regulates plant grain weight; E5) Regulate the number of florets in plants; E6) Regulate plant yield; A1) Protein TaVRS3; A2) a nucleic acid molecule encoding the protein TaVRS3; A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein TaVRS3; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence list; B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0006] The above protein tags may be tags as shown in Table 1.

[0007] Table 1 shows the sequence of tags

[0008] The substitution and / or deletion and / or addition of one or several amino acid residues mentioned above is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0009] In the above application, the nucleic acid molecule encoding protein TAVRS3 is any one of the following C1)-C3); C1) The coding region includes the nucleic acid molecule shown in Sequence 1, Sequence 3 or Sequence 5 in the sequence list; C2) a nucleic acid molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein with the same function; C3) is a nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology (identity) with the DNA sequence defined in C1) and encodes a protein with the same function.

[0010] The above nucleic acid molecule is DNA or cDNA or CDS.

[0011] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0012] In a second aspect, the present invention provides a substance for inhibiting or reducing the activity or content of the protein TaVRS3 described in the first aspect, or a substance for inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 described in the first aspect, in any of the following uses: F1) causes the plant spikelets to form multiple spikelets; F2) Increase the number of spikelets in plants; F3) Increase the number of grains per ear; F4) Increase the number of florets on the plant; F5) Increase plant yield.

[0013] In the above, the inhibition or reduction of the gene expression can be achieved by gene knockout or by gene silencing.

[0014] The gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene by changing the DNA sequence.

[0015] The gene silencing is a phenomenon that makes the gene not expressed or expressed at a low level without damaging the original DNA. Gene silencing is based on the premise of not changing the DNA sequence, making the gene not expressed or expressed at a low level. Gene silencing can occur at two levels, one is gene silencing at the transcriptional level caused by DNA methylation, heterochromatinization and position effect, and the other is post-transcriptional gene silencing, that is, at the level after gene transcription, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, gene repression (quelling), RNA interference (RNAi) and microRNA (miRNA)-mediated translation inhibition, etc.

[0016] In the application described above, the substance can regulate the expression of the coding gene of the protein or regulate the content of the protein in at least one of the following six aspects: 1) regulation at the transcription level of the coding gene; 2) regulation after transcription of the coding gene (that is, regulation of splicing or processing of the primary transcript of the coding gene); 3) regulation of RNA transport of the coding gene (that is, regulation of transport of the mRNA of the coding gene from the nucleus to the cytoplasm); 4) regulation of translation of the coding gene; 5) regulation of mRNA degradation of the coding gene; 6) post-translational regulation of the gene (that is, regulation of the activity of the protein translated from the coding gene).

[0017] The substance may be an agent for knocking out the gene, such as an agent for knocking out the gene by homologous recombination, or an agent for knocking out the gene by CRISPR / Cas9. The agent for inhibiting or reducing the expression of the gene may include a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0018] Further, the substance is a CRISPR / Cas9 system that inhibits the expression of the nucleic acid molecule encoding the protein TaVRS3; The CRISPR / Cas9 system includes an sgRNA targeting TaVRS3, The target of the sgRNA is positions 1301-1319 of sequence 1 in the sequence list.

[0019] The CRISPR / Cas9 system includes a CRISPR / Cas9 expression vector, which in the embodiment of the present invention is specifically pLGY-E003-Tavrs3 - sgRNA, a plasmid obtained by inserting the fragment (sequence 7) into the BsaI restriction site of the pLGY-E003 plasmid (containing the cas9 encoding gene), which expresses Tavrs3 - sgRNA.

[0020] In a third aspect, the present invention provides a method for regulating agronomic traits of plants, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant, thereby regulating the agronomic traits of the plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding a protein TaVRS3 in a target plant, thereby regulating agronomic traits of the plant; The plant agronomic traits are spike type, spikelet number, spikelet number, grain weight, floret number and / or yield; The target plant contains a nucleic acid encoding protein TaVRS3; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence list; B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0021] In a fourth aspect, the present invention provides a method for cultivating a transgenic plant with multiple spikelets, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant is a plant with multiple spikelets; The protein TaVRS3 is as follows B1) or B2) or B3): B1) a protein consisting of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0022] The multiple spikelet is a spikelet that can produce two fertile spikelets on one cob node.

[0023] In a fifth aspect, the present invention provides a method for cultivating transgenic plants with increased spikelet number, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of spikelets than the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0024] In a sixth aspect, the present invention provides a method for cultivating transgenic plants with increased grain number per ear, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of grains per ear than the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0025] In a seventh aspect, the present invention provides a method for cultivating transgenic plants with increased grain weight, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The grains of the transgenic plant are heavier than those of the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0026] In an eighth aspect, the present invention provides a method for cultivating transgenic plants with increased floret number, which is as follows (D1) or (D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein TAVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of florets than the target plant; The protein TaVRS3 is as follows B1) or B2) or B3): B1) a protein consisting of the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

[0027] In the above, the plant is any one of the following G1) to G5): G1) dicotyledonous plant; G2) monocotyledonous plant; G3) grass plant; G4) wheat; G5) wheat variety Fielder.

[0028] The present invention experiments prove that protein genes can be edited simultaneously in wild-type wheat Fielder TaVrs-B3 and TaVrs-D3 , which can significantly increase the number of spikelets, florets and grains per spike. Therefore, the protein TaVrs3 has important application value in regulating wheat spike traits and has broad prospects in breeding wheat varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 T7E1 enzyme digestion method was used to detect TaVrs3 gene knockout mutants.

[0030] Figure 2 for Taurus3 Genotype analysis of knockout mutants.

[0031] Figure 3 for TaVrs3 Analysis of spikelet type and agronomic traits of gene knockout mutants; *** indicates P<0.001, bar=3cm. Pseudocolor indicates multiple spikelets. DETAILED DESCRIPTION

[0032] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0033] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0034] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0035] In the following examples, wheat A genome Taurus3The gene sequence is sequence 1, and the amino acid sequence of the encoded protein is sequence 2; in the wheat B genome Taurus3 The gene sequence is sequence 3, and the amino acid sequence of the encoded protein is sequence 4; Taurus3 The gene sequence is sequence 5, and the amino acid sequence of the encoded protein is sequence 6.

[0036] Example 1. Construction of CRISPR / Cas9 expression vector 1. Construction of CRISPR / Cas9 expression vector 1. gRNA design According to the wheat A, B and D genome Taurus3 The gene editing gRNA sequence was designed using the CRISPRdirect (http: / / crispr.dbcls.jp / ) website, and its target site was sequence 1, positions 1301-1319, sequence 3, positions 1251-1269, or sequence 5, positions 1297-1315.

[0037] 2. Primer design Forward primer (5'-3') F: 5'-ccgaggtctcgggcgTCCCCGCAGAGGTCAGGAAgtttcagagctatgctggaaac-3' Reverse primer (5'-3') R: 5'-acctcggtctccaaacTTCCTGACCTCTGCGGGGAcaagtctgatgcagcaagc-3' 3. PCR amplification Using the intermediate vector pMETaU6.1 (Chen et al., WPA1 encodes a vWA domain proteinthat regulates wheat plant architecture. 2024:12 992-1000.) as a template, PCR amplification was performed with the above-designed primers, and a target band of about 800 bp was recovered, which was the PCR product.

[0038] The above amplification system is shown in Table 2 below: Table 2 shows the amplification system

[0039] The PCR program is as shown in Table 3: Table 3 shows the PCR program

[0040] 4. Ligation of PCR products and gene editing vectors The gene editing backbone vector pLGY-E003 (Chen et al., WPA1 encodes a vWAdomain protein that regulates wheat plant architecture. 2024:12 992-1000.) was digested with Bsa1 and the vector was recovered by gel cutting. The PCR product was cloned into the gene editing backbone vector pLGY-E003 (vector recovered by BsaI single digestion). The ligation reaction was carried out in a PCR instrument, and the specific reaction conditions were: 37℃ 5 min, 16℃ 10 min, a total of 60 cycles; then 16℃ 1h. The reaction system is shown in Table 4 below: Table 4 shows the connection system

[0041] 5. Obtaining CRISPR / Cas9 expression vector The ligation product was transformed into E. coli (5 μl product was transformed into 50 μl competent cells), and positive clones were screened on LB+Kan solid medium. Plasmids were extracted, positive clones were identified by PCR and sent for sequencing. The identification and sequencing primers were: F: AGCACGTCTTAACATTAGTCCC, R: AACTTAGACATGCAATGCTCA. The amplified fragment of the positive clone was: 1310 bp. The obtained positive clone bacterial solution was used to extract plasmids.

[0042] The extracted plasmid is a recombinant knockout plasmid named pLGY-E003-Tavrs3 - sgRNA.

[0043] pLGY-E003-Tavrs3 - sgRNA is a plasmid obtained by inserting the fragment (sequence 7) into the BsaI restriction site of the pLGY-E003 plasmid (containing the cas9 encoding gene), which expresses Tavrs3 - sgRNA.

[0044] In the above sequence 7, positions 1 to 15 are Bsa I restriction site and its protection bases, positions 16-34 are target sequences, positions 35-59 are regulatory sequences, positions 60-124 are gRNA scaffolds, positions 125-409 are regulatory sequences, positions 410-771 are wheat U6 promoters, positions 772-790 are target sequences, positions 791-806 are Bsa I restriction site and its protected bases.

[0045] 6. Agrobacterium transformation and positive clone screening The above plasmid pLGYE-3-Tavrs3 - The sgRNA was transformed into the EHA105 Agrobacterium strain, and positive clones were screened on the solid medium of LB+Kan+Rif. Colony PCR (primers F: AGCACGTCTTAACATTAGTCCC, R: AACTTAGACATGCAATGCTCA, and the one with 1310 bp was positive) was performed to identify the positive colonies, which were named recombinant bacteria EHA105 / pLGY-E003-Tavrs3. - sgRNA.

[0046] 2. T0 Generation Taurus3 Obtaining Gene-Edited Wheat 1. Conversion The recombinant strain EHA105 / pLGYE-3-Tavrs3 was transformed into - The sgRNA was infected into the scutellum of young embryos of wheat Fielder (recipient), and the embryos were transferred to an induction medium and cultured in the dark at 22-23°C to induce embryonic callus. The embryonic callus was then transferred to a rooting medium and cultured at 22-23°C for 3-4 weeks under 12h light / 12h dark conditions to obtain T0 generation regenerated seedlings with good root growth, i.e., T0 generation Taurus3 Genetically modified wheat.

[0047] The formula of the relevant culture medium involved is as follows: Callus induction medium (1L): 100mL MS Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 1mL MS vitamins (×1000), 100mg inositol, 0.5g glutamine, 100mg casein, 1.95g MES, 40g maltose, mix well and adjust the pH to 5.7, then add 2g of plant gel and sterilize at high temperature at 121℃ for 15 min; after the culture medium is cooled to 55℃, add the filtered and sterilized reagents according to the proportion of the mother liquor, including 0.25mg2,4-D, 1 mg Picloram, and 80mg Timentin.

[0048] Rooting medium (1L): 100mL L7 Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 5mL Vitamins / inositol (×200), 100mg inositol, 30g maltose, mix well and adjust the pH to 5.7, then add 2g of plant gel for high temperature sterilization. After the medium is cooled to 55°C, add the filtered and sterilized reagents according to the mother liquor ratio, including 0.05mg 2,4-D, 80mg Timentin, and 2.5mg Zeatin. The screening medium is based on the regeneration medium with 1.25 mg glufosinate added.

[0049] MS Macro salts (×10): 16.5 g / l ammonium nitrate, 19.0 g / l potassium nitrate, 1.7 g / l potassium dihydrogen phosphate, 3.7 g / l magnesium sulfate heptahydrate, 4.4 g / l calcium chloride dihydrate, mix well, 121°C, 15 min, store at 4°C.

[0050] L7 Macro salts (×10): 2.5 g / l ammonium nitrate, 15.0 g / l potassium nitrate, 2.0 g / l potassium dihydrogen phosphate, 3.5 g / l magnesium sulfate heptahydrate, 4.5 g / l calcium chloride dihydrate, mix well, 121°C, 15 min, store at 4°C.

[0051] L7 Micro salts (×1,000): 15.0 g / l manganese sulfate, 5.0 g / l boric acid, 7.5 g / l zinc sulfate heptahydrate, 0.75 g / l potassium iodide, 0.25 g / l sodium molybdate dihydrate, 0.025 g / l copper sulfate pentahydrate, 0.025 g / l cobalt chloride hexahydrate, filter sterilize, store at 4°C.

[0052] Vitamins / inositol (×200): 40.0 g / l inositol, 2.0 g / l vitamin B1 hydrochloride, 0.2 g / l vitamin B6, 0.2 g / l niacin, 0.2 g / l calcium pantothenate, 0.2 g / l vitamin C, filter sterilize, store at 4°C.

[0053] 2. T0 generation Taurus3 Detection of proposed transgenic wheat Randomly select 10 T0 generation plants Taurus3 The specific steps for PCR detection of proposed transgenic wheat are as follows: 1) CTAB genomic DNA extraction method was used to extract 10 T0 generations of Taurus3 Total DNA in leaves of transgenic wheat at seedling stage. The DNA content in leaves of each T0 generation transgenic wheat was about 200 ng / μL.

[0054] 2) Use PCR technology to obtain the fragment sequence including the gene editing target site in each T0 generation of transgenic wheat.

[0055] The PCR primers were forward primer: 5′-CTACTAGTACTCCCAAGTTAAG-3′ and reverse primer: 5′-GTCCACTCATAAAGAAAGTGACTGT-3′.

[0056] The reaction system is 20 μL, consisting of 10 μL SYBR ® PremixExTaq TM , 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 1 μL T0 TaVrs3 The mixture consisted of wheat genomic DNA and 8.0 μL nuclease-free water.

[0057] Reaction procedure: 94°C pre-denaturation for 3 min; 95°C denaturation for 3 sec, 60°C annealing for 30 sec, 35 cycles.

[0058] 3) Detection of mutants by T7E1 enzyme digestion method.

[0059] The PCR product was digested with T7E1 and then the band type was detected by 2% agarose gel electrophoresis. The 1.2 kb one was for the plant without gene editing, and the 600 bp one was for the mutant after gene editing.

[0060] The results are as follows Figure 1 As shown, plants numbered 2-10 are gene-edited plants, and plant numbered 1 is wild-type wheat. It can be seen that plants numbered 2-10 are all gene-edited mutants, recorded as T0 generation. TaVrs3 Knockout wheat.

[0061] Replace the above T0 TaVrs3 The knockout wheat was self-pollinated for two consecutive generations to obtain the T2 generation TaVrs3 Knockout wheat.

[0062] Select T2 generation TaVrs3 Knockout wheat CR_m1 and CR_m2 The PCR product was sent for sequencing, and the results were as follows Figure 2 As shown, it can be seen that: CR_m1 as follows: Compared with wild-type wheat A TaVrs3 Gene( Figure 2 Zhongjizuo TaVrs3 -3A) compared to CR_m1 In the A genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m1-A) The sequence remains unchanged; The wild-type wheat B genome TaVrs3 Gene (denoted as TaVrs3 -3B) compared to CR_m1 The two homologous chromosomes in the B genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m1 -B) The corresponding region underwent the following changes: two bases AG were deleted at positions 1265-1266 of sequence 3; Compared with wild-type wheat D TaVrs3 Gene (denoted as TaVrs3 -3D) compared to CR_m1 The two homologous chromosomes in the C genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m1 -D) The corresponding region underwent the following changes: 2 bases GT were deleted at positions 1308-1309 of sequence 5; CR_m2 as follows: Compared with wild-type wheat A TaVrs3 Gene( Figure 2 Zhongjizuo TaVrs3 -3A) compared to CR_m2 In the A genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m2 -A) The sequence remains unchanged; The wild-type wheat B genome TaVrs3 Gene( Figure 2 Zhongjizuo TaVrs3 -3B) compared to CR_m2 The two homologous chromosomes in the B genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m2 -B) The corresponding region underwent the following changes: one base G was deleted at position 1266 of sequence 3; Compared with wild-type wheat D TaVrs3 Gene( Figure 2 Zhongjizuo TaVrs3 -3D) compared to CR_m2 The two homologous chromosomes in the D genome TaVrs3 Gene( Figure 2 Zhongjizuo CR_m2 -D) The corresponding region underwent the following changes: two bases AG were deleted at positions 1312-1313 of sequence 5; 3. T2 generation TaVrs3 Analysis of ear-type traits in gene knockout wheat The wheat to be tested is T2 generation TaVrs3 Knockout wheat CR_m1 and CR_m2 .

[0063] The wheat to be tested was planted in a greenhouse. 20 days after flowering, the number of spikelets per ear, the number of florets per ear, the number of grains per ear, and the grain weight per plant were investigated. The culture conditions were as follows: temperature 25°C, light 350 μmol photons m -2 s -1 , humidity 60-70%. Wild type wheat was used as control.

[0064] The results are as follows Figure 3 As shown in the left graph, it can be seen that the T2 generation TaVrs3 The knockout wheat has a multiple spikelet phenotype (i.e., two fertile spikelets can be produced in one cob node).

[0065] The number of spikelets per ear, the number of grains per ear, the number of florets per ear and the grain weight per plant were counted. The results are as follows Figure 3 As shown in the bar graph on the right, it can be seen that compared with wild-type wheat, the T2 generation TaVrs3 Knockout wheat CR_m1 and CR_m2 The number of spikelets per ear, the number of florets per ear, the number of grains per ear and the grain weight per plant were all increased.

[0066] The above results indicate that the protein TaVrs3 has important application value in regulating wheat spikelet traits (such as the number of spikelets, the number of florets, and the number of grains per spike).

[0067] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of any of the following substances A1) -A3) in any of the following substances E1-E6: E1) regulates plant panicle shape; E2) regulates the number of spikelets in plants; E3) Regulates the number of grains per ear in plants; E4) Regulates plant grain weight; E5) Regulate the number of florets in plants; E6) Regulate plant yield; A1) Protein TaVRS3; A2) a nucleic acid molecule encoding the protein TaVRS3; A3) a recombinant vector, expression cassette or recombinant bacterium containing a nucleic acid molecule encoding protein TaVRS3; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence list; B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

2. The use according to claim 1, characterized in that: The nucleic acid molecule encoding protein TAVRS3 is any one of the following C1)-C3); C1) The coding region includes the nucleic acid molecule shown in Sequence 1, Sequence 3 or Sequence 5 in the sequence list; C2) a nucleic acid molecule that hybridizes with the DNA sequence defined in C1) under stringent conditions and encodes a protein with the same function; C3) A nucleic acid molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequence defined in C1) and encodes a protein with the same function.

3. A substance that inhibits or reduces the activity or content of the protein TaVRS3 described in claim 1, or a substance that inhibits the expression of a nucleic acid molecule encoding the protein TaVRS3 described in claim 1, in any of the following uses: F1) causes the plant spikelets to form multiple spikelets; F2) Increase the number of spikelets in plants; F3) Increase the number of grains per ear; F4) Increase the number of florets on the plant; F5) Increase plant yield.

4. The use according to claim 3, characterized in that: The substance is a crisp system that inhibits the expression of the nucleic acid molecule encoding the protein TaVRS3; The crisp system includes sgRNA targeting TaVRS3, The target of the sgRNA is positions 1301-1319 of sequence 1 in the sequence list.

5. A method for regulating agronomic traits of plants, comprising: D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant, thereby regulating the agronomic traits of the plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding a protein TaVRS3 in a target plant, thereby regulating agronomic traits of the plant; The plant agronomic traits are spike type, spikelet number, spikelet number, grain weight, floret number and / or yield; The target plant contains a nucleic acid encoding protein TaVRS3; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence list; B2) a protein derived from B1) with the same function as the amino acid sequence shown in Sequence 2, Sequence 4 or Sequence 6 in the sequence list, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

6. A method for cultivating a transgenic plant with multiple spikelets, comprising the following steps (D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant is a plant with multiple spikelets; The protein TaVRS3 is as follows B1) or B2) or B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

7. A method for cultivating a transgenic plant with increased spikelet number, comprising the following steps (D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of spikelets than the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

8. A method for cultivating transgenic plants with increased grain number per ear, comprising the following steps (D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of grains per ear than the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

9. A method for cultivating transgenic plants with increased grain weight, comprising the following steps (D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding the protein TaVRS3 in a target plant to obtain a transgenic plant; The grains of the transgenic plant are heavier than those of the target plant; The protein TaVRS3 is as follows (B1) or (B2) or (B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

10. A method for cultivating a transgenic plant with increased floret number, comprising the following steps (D1) or D2): D1) The method comprises the following steps: reducing or inhibiting the content and / or activity of the protein TaVRS3 in the target plant to obtain a transgenic plant; D2) The method comprises the following steps: reducing or inhibiting the expression of a nucleic acid molecule encoding protein TAVRS3 in a target plant to obtain a transgenic plant; The transgenic plant has a greater number of florets than the target plant; The protein TaVRS3 is as follows B1) or B2) or B3): B1) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing; B2) a protein derived from B1) with the same function as the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6 in the sequence listing, wherein one or more amino acid residues are substituted and / or deleted and / or added; B3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of B1) or B2).

Images