A method for achieving targeted gene editing of the offspring of Exopalaemon carinicauda or Litopenaeus vannamei

Abstract

The present invention relates to a method and application for realizing targeted gene editing of the offspring of Exopalaemon carinicauda or Litopenaeus vannamei. This method directly injects Cas9 RNP ( sgRNA a mixture formed by mixing with Cas9 ribonucleoprotein) into the body of Exopalaemon carinicauda or Litopenaeus vannamei with developing ovaries by intramuscular injection. The sgRNA used is a guide IAG designed based on the EcIAG or LvIAG gene of Exopalaemon carinicauda or Litopenaeus vannamei: RNA : EcIAG-gRNA or LvIAG-gRNA . After mixing different gRNA with Cas9 protein respectively, they are injected into the maternal body of Exopalaemon carinicauda or Litopenaeus vannamei by intramuscular injection. Cas9 RNP can enter the oocytes of the ovary through blood circulation to realize the editing of the target gene on its genome. After the edited oocytes develop into eggs, the offspring edited mutants are formed through fertilization.

Description

Technical Field

[0001] The present invention relates to the technical field of shrimp and crab genetic engineering, and particularly relates to a technology for gene editing of shrimp and crab and its application. Background Art

[0002] Gene editing is currently one of the important means to achieve genetic changes in species. Using this technology, it is possible to achieve the knock-in, knockout of key genes regulating economic traits, and the change of genotypes, so as to improve target traits. The gene editing technology has developed rapidly in model animals and higher animals. In aquatic animals, there are more studies on fish. However, in crustaceans, the gene editing technology has developed relatively slowly, and there are bottleneck problems such as difficult operation, low efficiency, low embryo survival rate, and low gene editing efficiency in gene introduction. There are only successful reports in a very few species such as Exopalaemon carinicauda. At present, in crustaceans, the successful application of gene editing mainly depends on injecting gene editing materials into single-celled fertilized eggs by microinjection, so as to achieve gene editing of individuals. The method of microinjection has great limitations. The narrow fertilization time window, the uncontrollable fertilization process, and the difficult operation of fertilized eggs are all important factors restricting the efficiency of microinjection. In Anopheles gambiae ( Anopheles gambiae ), researchers established a receptor-mediated cargo ovarian transport system method (ReMOT) by virtue of the recognition between vitellogenin and vitellogenin receptor. In this method, the polypeptide sequence P2C that can be recognized by the vitellogenin receptor is recombinantly expressed with Cas9, and the recombinant protein is mixed with gRNA and then directly injected into female adults to achieve targeted gene editing of eggs. This method established a gene editing technology for Anopheles gambiae that does not rely on microinjection (Chaverra-Rodriguez, D., Macias, V.M., Hughes, G.L. et al. Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing. Nat Commun, 2018, 9:3008. Doi: 10.1038 / s41467-018-05425-9).

[0003] Exopalaemon carinicauda ( Exopalaemon carinicauda ) and Litopenaeus vannamei ( Litopenaeus vannamei) Both belong to the Decapoda of the Crustacea subphylum and are marine shrimps with relatively high economic value. Like other shrimps and crabs, vitellogenin (Vg) is the main precursor lipoprotein of yolk during the ovarian development of Exopalaemon carinicauda and Litopenaeus vannamei. The hepatopancreas is an important target tissue for synthesizing Vg. The secreted Vg is transported to the ovary through the open blood circulation and absorbed into the developing oocytes through receptor-mediated endocytosis. Based on the characteristics of ovarian development in shrimps and crabs, we directly injected Cas9 RNP ( sgRNA a mixture formed by mixing with Cas9 ribonucleoprotein) into Exopalaemon carinicauda and Litopenaeus vannamei during ovarian development by intramuscular injection. Subsequently, mating with male individuals can achieve the editing of target genes in some offspring individuals, and a gene editing technology for Exopalaemon carinicauda and Litopenaeus vannamei based on direct maternal injection has been successfully established. This method is simpler and more convenient to operate than the microinjection method and can be used to operate on a large number of eggs. This method can also be applied to other crustaceans with similar ovarian development processes. Summary of the Invention

[0004] The object of this invention patent is to provide a method for achieving gene editing of offspring by intramuscular injection of Cas9RNP into the mother body of Exopalaemon carinicauda or Litopenaeus vannamei. By directly injecting Cas9 RNP into the body of Exopalaemon carinicauda or Litopenaeus vannamei whose ovaries are developing through intramuscular injection, Cas9 RNP can enter the ovary along with the blood circulation and enter the oocytes along with ovarian development, achieving the editing of target genes on its genome. After the edited oocytes develop into eggs, fertilization forms offspring-edited mutants.

[0005] To achieve the above object, the technical solution of the present invention is as follows:

[0006] A method for achieving target gene editing of offspring of Exopalaemon carinicauda or Litopenaeus vannamei, the method realizes the editing of target genes of offspring individuals by giving intramuscular injection of Cas9 RNP to the mother body of Exopalaemon carinicauda or Litopenaeus vannamei, and then mating with male individuals. The Cas9 RNP is a mixture of Cas9 protein and guide RNA , wherein the guide RNA is the guide EcIAG of the male sex differentiation control gene of Exopalaemon carinicauda RNA , or is the guide LvIAG of the male sex differentiation control gene of Litopenaeus vannamei RNA .

[0007] Furthermore, the target gene is the male sex differentiation control gene EcIAG of Exopalaemon carinicauda or the male sex differentiation control gene LvIAG of Litopenaeus vannamei.

[0008] Further, the mass concentration of Cas9 protein and the guide RNA in the mixture are both greater than 0.5 μg / μL, preferably 1-5 μg / μL; the injection volume of Cas9 RNP is 8-20 μL (preferably 10-15 μL).

[0009] The female parent is a female shrimp with the ovary in the II or III stage of development of Exopalaemon carinicauda or Litopenaeus vannamei.

[0010] The injection site of the female parent by intramuscular injection is the base of the first pair of swimming legs of Exopalaemon carinicauda or Litopenaeus vannamei.

[0011] The nucleotide sequence of the male sex differentiation control gene of Exopalaemon carinicauda EcIAG is shown as SEQ ID No.1 in the list. The guide EcIAG of the male sex differentiation control gene of Exopalaemon carinicauda RNA is EcIAG-gRNA1 and EcIAG-gRNA2 wherein EcIAG-gRNA1 the ribonucleotide sequence of EcIAG-gRNA2 is shown as SEQ ID No.2 in the sequence listing, and RNA the ribonucleotide sequence of EcIAG-gRNA1 and EcIAG-gRNA2 is EcIAG- gRNA1 and EcIAG-gRNA2 are mixed in any mass ratio, preferably EcIAG-gRNA1 and EcIAG-gRNA2 are in a mass ratio of 1:1.

[0012] The nucleotide sequence of the male sex differentiation control gene of Litopenaeus vannamei LvIAG is shown as SEQ ID No.4 in the list; the guide LvIAG of the male sex differentiation control gene of Litopenaeus vannamei RNA is LvIAG-gRNA1 and LvIAG-gRNA2 wherein LvIAG-gRNA1 the ribonucleotide sequence of LvIAG-gRNA2 is shown as SEQ ID No.5 in the sequence listing, and RNA the ribonucleotide sequence of LvIAG-gRNA1 and LvIAG-gRNA2 is EcIAG- gRNA1 and EcIAG-gRNA2 are mixed in any mass ratio, preferably LvIAG-gRNA1 and LvIAG-gRNA2 are in a mass ratio of 1:1.

[0013] This method can also be applied to delivering other biological macromolecules such as proteins and plasmids to the oocytes of Exopalaemon carinicauda or Litopenaeus vannamei at this ovarian development stage; it can also be applied to the offspring target gene editing of other decapod crustaceans such as shrimps and crabs with similar ovarian development processes.

[0014] Compared with the prior art, the advantages of this invention application are as follows:

[0015] 1. Currently, effective gene editing technologies have not been established for most crustaceans such as shrimps. This invention has realized gene editing in shrimps for the first time, providing important technical guidance for gene editing in other crustaceans;

[0016] 2. The existing gene editing technology for Exopalaemon carinicauda is based on the microinjection method to introduce the editing system into fertilized eggs. The method is time-consuming, and the fertilized eggs after microinjection have extremely high mortality rates during embryonic development. In addition, it relies on expensive microinjection instruments and skilled microinjection operation experience; while the method established in this invention only requires a single microinjection of adults to achieve gene editing of offspring individuals, with simple operation, high success rate, and strong reproducibility. Brief Description of the Drawings

[0017] Figure 1 To detect whether the expressed Cas9 recombinant protein is expressed in the supernatant by electrophoresis.

[0018] Figure 2 For the in vitro activity detection experiment of the purified recombinant protein Cas9.

[0019] Figure 3 For the sequencing peak map of the embryonic stage with gene editing in individual No. 3 injected in September 2023.

[0020] Figure 4 For the monoclonal sequencing result of individual No. 3 injected in September 2023.

[0021] Figure 5 For the sequencing peak map of the embryonic stage with gene editing in individual No. 1 injected in November 2023.

[0022] Figure 6 For the monoclonal sequencing result of individual No. 1 injected in November 2023.

[0023] Figure 7 For the electrophoresis result of the agarose gel of the embryo with gene editing in individual No. 1 injected in May 2024.

[0024] Figure 8 For the monoclonal sequencing result of the fertilized eggs of individual No. 1 injected in May 2024.

[0025] Figure 9 For Litopenaeus vannameiLvIAG Detection results of gene-edited offspring Specific implementation manners

[0026] Method for realizing gene editing of offspring by injecting Cas9 RNP into the muscle of the parent body of Exopalaemon carinicauda or Litopenaeus vannamei

[0027] The target gene of Exopalaemon carinicauda used is the male sex differentiation control gene EcIAG (Source patent: Male sex differentiation control gene of Exopalaemon carinicauda EcIAG and guide RNA and application) The sequences are as follows:

[0028] (1) EcIAG Information of (SEQ ID No.1) (see Sequence Listing)

[0029] (a) Sequence characteristics

[0030] *Length: 579 base pairs

[0031] *Type: Nucleotide

[0032] *Strand type: Double-stranded

[0033] *Topology: Linear

[0034] (b) Molecular type: Nucleic acid

[0035] Sequence description: SEQ ID No.1

[0036] ATGTCAACCTGTAATATCGGAGTCAAGAAGGTGTTCTTTTGTGTTTTGTTGGCGTTATGCTTGATGCAGCCTTCTTCCGGCTACACCATTGAATGTCTTTCTGTTGACTTTGATTGTGGCGATATTCCGCAAACCCTTGCATCAGTTTGCAGGGTATACAAACCATTCGTCCCCTTCAATCAACCCTTCATTACCAAAAGGCGGCGTTCTGTGAGCAACTCCACCCAACTTCCAATTGAGTGTTCCTCGCCCTTCTTCCACCCACGAGCCACCCACCTGACGAAGGCAAAGGCTGACGAAGGCAGTGTCATGGCGTTGGAGATGCCAAGTGAGATTCGAGACATGTTTATAAGTCAGGAGAAAGCAAACATGATGCTTCAGTCGAATCGCAGACTCCGACGGCATGGGCAAAGAAATACGCCGAGGGATGAATGTTGTGCCGTCAAAGATTGCTGCACCTTTGAGGAAGTCGCCGAATATTGTGTTGAAGTGCGTCCCGGAGCCCTAACCTGCGAAAGACCACAGGACGGTTCCTCGCCTATGGTCCCCAATTGCACACCTGCCGTTCCGGAGAGCTAG;

[0037] (2) EcIAG-gRNA1 (SEQ ID No.2) information

[0038] (a) Sequence characteristics

[0039] * Length: 57 bases

[0040] * Type: Nucleotide

[0041] * Strand type: Single-stranded

[0042] * Topology: Linear

[0043] (b) Molecular type: Ribonucleic acid

[0044] Sequence description: SEQ ID No.2

[0045] TAATACGACTCACTATAGTCAACAGAAAGACATTCAAGTTTTAGAGCTAGAAATAGC;

[0046] (3)EcIAG-gRNA2 Information of (SEQ ID No.3)

[0047] (a) Sequence characteristics

[0048] * Length: 57 bases

[0049] * Type: Nucleotide

[0050] * Strand type: Single-stranded

[0051] * Topology: Linear

[0052] (b) Molecular type: Ribonucleic acid

[0053] Sequence description: SEQ ID No.3

[0054] TAATACGACTCACTATAGGTTGATTGAAGGGGACGAAGTTTTAGAGCTAGAAATAGC。

[0055] The target gene of Litopenaeus vannamei used is the male sex differentiation control gene LvIAG (NCBI Accession No.KM066114), the sequence is as follows:

[0056] (1) LvIAG Information of (SEQ ID No.4) (see Sequence Listing)

[0057] (a) Sequence characteristics

[0058] * Length: 507 base pairs

[0059] * Type: Nucleotide

[0060] * Strand type: Double-stranded

[0061] * Topology: Linear

[0062] (b) Molecular type: Nucleic acid

[0063] Sequence description: SEQ ID No.4

[0064] ATGAACCAACTCGCTGCCTCACGCACTCACGGCCTCGACGTGCCTGCTCAACTGTTACTCGGATTGCTGATGCTTCTCTCGCTGACTTCGACGTCGATCGGCTACAACGTCACAGGGATTCCTGTGGACTTCGACTGCGGTGACATCGGCGACACCATGAGCCAGATCTGCAAGACGTTCCCCACGGCCAGGCCCCACGTGAGAGTGTCAAGGTCAGCCGATACCGACGACCTCTGGCAGGACGCGGGGGCAGGTCAGACAACGCCCCCTGACCTGCTCCCCCGCCGGCACCGCCTCCACCCCAGGGCCCTGAATCCAACGTGGAATCTCGAAAGGGACCTGATCAGAGACATCCTAGTGAGCCCCGAAGCCGCGCACGCCCTCGTCAGGACGCCCCGGGGCCGCGCGAAGAGGTCCTACAACGTGCAGGACGAGTGCTGCAACCACGTGAGCCAGCGGATGTGTGTGGCGGAGGAGATCCTGGAGTATTGCGAGGACCCGTACTTC;

[0065] (2) LvIAG-gRNA1 Information of (SEQ ID No.5)

[0066] (a) Sequence characteristics

[0067] * Length: 59 bases

[0068] * Type: Nucleotide

[0069] * Strand type: Single-stranded

[0070] * Topology: Linear

[0071] (b) Molecular type: Ribonucleic acid

[0072] Sequence description: SEQ ID No.5

[0073] TAATACGACTCACTATAGGCGATACCGACGACCTCTGGCGTTTTAGAGCTAGAAATAGC;

[0074] (3) LvIAG-gRNA2 Information of (SEQ ID No.6)

[0075] (a) Sequence characteristics

[0076] *Length: 59 bases

[0077] *Type: Nucleotide

[0078] *Strand type: Single-stranded

[0079] *Topology: Linear

[0080] (b) Molecular type: Ribonucleic acid

[0081] Sequence description: SEQ ID No.6

[0082] TAATACGACTCACTATAGGACGTTGGATTCAGGGCCCTGGTTTTAGAGCTAGAAATAGC。

[0083] The techniques used in the following examples mainly include: protein expression and purification, PCR amplification and detection, monoclonal sequencing, gRNA synthesis and other molecular biology techniques.

[0084] Example 1 Expression, Purification and Activity Detection of Cas9 Protein

[0085] (1) Cas9 protein expression

[0086] The expression vector used is the pET-28b-Cas9-His plasmid (Addgene, Plasmid #47327), and expression is carried out using competent cell Transetta(DE3).

[0087] The pET-28b-Cas9-His plasmid was transformed into competent cell Transetta(TransGen Biotech) as follows:

[0088] a) Take 50 μL of Transetta(DE3) competent cells melted on ice bath, add 3 μL of the extracted pET-28b-Cas9-His plasmid, gently shake well, and place on ice bath for 30 minutes;

[0089] b) Heat shock in a 42 °C water bath for 45 s, then quickly transfer the tube to an ice bath for 2 minutes without shaking the centrifuge tube during this process;

[0090] c) Add 500 μL of antibiotic-free LB liquid medium to the centrifuge tube, mix well and incubate at 37 °C, 200 rpm for 1 hour to resuscitate the bacteria;

[0091] d) Add 60 μL of the transformed Transetta (DE3) competent cells onto the LB agar medium containing 0.1% (mass concentration) kanamycin (Kana+), spread the cells evenly, and culture overnight (14 - 16 h) at 37°C;

[0092] e) Pick monoclonal colonies: Use a sterilized toothpick to pick a single colony into 500 μL of LB liquid medium containing kanamycin, and culture with shaking at 37°C for 6 h;

[0093] f) Inoculate 50 μL of the bacterial strain solution into 5 mL of LB liquid medium containing kanamycin, and culture with shaking overnight at 37°C;

[0094] g) Take 200 μL of the bacterial strain solution into 200 mL of LB liquid medium containing kanamycin, and culture with shaking at 37°C until the OD600 of the bacterial liquid reaches 0.6;

[0095] h) Add isopropylthiogalactoside (IPTG) to the above bacterial liquid to a final concentration of 0.75 mM, and induce at 18°C for 24 hours. Centrifuge at 8000 rpm for 4 min, and discard the supernatant.

[0096] (2) Cas9 Protein Purification and Activity Detection

[0097] a) After washing the collected precipitate twice with PBS, resuspend it in 20 ml of PBS, and ultrasonically disrupt it for 30 minutes, working for 2 seconds and pausing for 2 seconds until it becomes clear;

[0098] b) Centrifuge at 12000 rpm for 15 min at 4°C, carefully transfer the supernatant (the clarified sample) to a clean test tube without disturbing the precipitate. Filter the supernatant through a 0.22 μm filter membrane and store it at 4°C for later use;

[0099] c) The target protein is expressed in the supernatant as Figure 1 shown. Refer to the instruction manual of TALON® Metal Affinity for purifying the protein;

[0100] d) After measuring the concentration, perform protein activity detection. Use a kit (GenScript, GenCrispr sgRNA Screening Kit, L00689) for in vitro activity detection. As Figure 2 shown, the expressed protein has activity;

[0101] e) The obtained Cas9 protein is stored at 4°C.

[0102] Example 2 gRNA Synthesis

[0103] The target gene used is the male sex differentiation control gene of Exopalaemon carinicauda EcIAG(Source Patent: Gene Controlling Male Sex Differentiation in Exopalaemon carinicauda EcIAG and guidance RNA and Application, Patent No. CN116622717A) and the gene controlling male sex differentiation in Litopenaeus vannamei LvIAG , EcIAG-gRNA The synthesis method refers to the above patent. The following is the process of guiding the gene controlling sex differentiation in Litopenaeus vannamei LvIAG guidance RNA (gRNA) synthesis process.

[0104] (1) gRNA Construction of framework plasmid

[0105] First, according to gRNA structure, design and synthesize gRNA framework sequence:

[0106] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT (SEQ ID No.7);

[0107] Then ligate the framework sequence into the TA cloning site of pMD19-T vector (TaKaRa, D102A) to obtain gRNA framework plasmid pMD19-gRNA.

[0108] (2) gRNA For the synthesis of the template, use the online tool CRISPRdirect (http: / / crispr.dbcls.jp / ) to select the gRNA sites of the LvIAG gene, design the corresponding LvIAG-gRNA1-F and LvIAG-gRNA2-F , and at the same time design the gRNA-R of the reverse primer;

[0109] LvIAG-gRNA1-F : TAATACGACTCACTATAGGCGATACCGACGACCTCTGGCGTTTTAGAGCTAGAAATAGC (SEQ ID No.5),

[0110] LvIAG-gRNA2-F : TAATACGACTCACTATAGGACGTTGGATTCAGGGCCCTGGTTTTAGAGCTAGAAATAGC (SEQ ID No.6),

[0111] gRNA-R : AAAAAAGCACCGACTCGGTGCCA (SEQ ID No.8);

[0112] Using gRNA the framework plasmid pMD19-gRNA as a template, respectively using LvIAG-gRNA1-F and LvIAG-gRNA2-F as forward primers, and gRNA-R as the reverse primer, PCR amplification was carried out using ExTaq polymerase (Takara, RR001A). The PCR amplification system is shown in Table 1.

[0113] Table 1 The PCR amplification system is as follows:

[0114] Ingredient Dosage ExTaq (Taq polymerase) 25 μL pMD19-gRNA (plasmid) 10 ng LvIAG-gRNA-F (forward primer) 1 μL gRNA-R (reverse primer) 1 μL <![CDATA[DEPC-H2O (DEPC water)]]> To 50 μL

[0115] PCR cycling program: pre-denaturation at 98°C for 5 min; 98°C for 10 sec, 55°C for 5 sec, 72°C for 30 sec, 35 cycles; extension at 72°C for 10 min; incubation at 16°C. After detecting the amplified gRNA template size by agarose gel electrophoresis of the PCR product, it was subsequently used as gRNA an in vitro transcription template.

[0116] (3) gRNA In vitro transcription and purification of

[0117] Using the T7 in vitro transcription kit TranscriptAid T7 High Yield Transcription Kit (Thermo, K0441) to perform in vitro transcription on the gRNA PCR product of gRNA, to synthesize ；

[0118] Table 2 The in vitro transcription system is as follows:

[0119] Ingredient Dosage 5×TranscriptAid Buffer (buffer) 4 μL ATP / TTP / CTP / UTP mix (nucleotide mixture) 2 μL×4 TranscriptAid Enzyme Mix (transcriptase) 2 μL Template 1 μg DEPC-H2O (DEPC water) To 20 μL

[0120] The transcription system was reacted at 42°C for 2 h; 2 μL of DNase (QIAGEN, 79254) was added and digested at 37°C for 15 min to remove the DNA template; 2 μL of 0.5 M EDTA (pH 8.0) was added and reacted at 65°C for 10 min to terminate the reaction; 1 μL was taken for electrophoresis detection. Using the phenol / chloroform extraction method (Lee S. Toni, et al., Optimization of phenol-chloroform RNA extraction, MethodsX, 2018, 5:599-608) to obtain gRNA LvIAG-gRNA1 and LvIAG-gRNA2 from the digested system.

[0121] Example 3 Gene editing experiment on the offspring of Exopalaemon carinicauda

[0122] (1) Injection of female Exopalaemon carinicauda muscle and collection of offspring embryos

[0123] Mate female Exopalaemon carinicauda injected with 10 μL Cas9 RNP with wild-type male Exopalaemon carinicauda (see (5) for the specific muscle injection experiment procedure). After fertilization, collect embryos when the fertilized eggs develop to the blastula stage (this is the 5th day after fertilization), store them in absolute ethanol, and randomly select 24 embryos from each shrimp to detect the gene editing efficiency.

[0124] (2)Embryo EcIAG PCR amplification

[0125] Extract genomic DNA from randomly selected embryos using the method of lysis buffer microextraction (Gao et al., CRISPR / Cas9-mediated mutation on an insulin-like peptide encoding gene affects the growth of the ridgetail white prawn Exopalaemon carinicauda, Front Endocrinol, 2022, 13:986491.), and perform PCR amplification on the genomic regions flanking the two EcIAG of sgRNA CRISPR targets. The PCR amplification system is shown in Table 3;

[0126] The PCR primers used are as follows:

[0127] EcIAG-exon2-F: GACTGATCTTATGTATCGACATTGA (SEQ ID No.9),

[0128] EcIAG-exon2-R: CTGCATCACTAACTTTTGGTAAT (SEQ ID No.10),

[0129] Table 3 The PCR amplification system is as follows:

[0130] Ingredient Dosage / μL 2×Reaction Mix (reaction solution) 12.5 Golden DNA polymerase (DNA polymerase) 0.25 DNA template 1 EcIAG-exon2-F (forward primer) 0.5 EcIAG-exon2-R (Reverse Primer) 0.5 DEPC-H2O (DEPC Water) 10.25 Total Volume 25

[0131] The PCR amplification conditions are as follows:

[0132] Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 25 s, 35 cycles; extension at 72°C for 10 min; incubation at 16°C;

[0133] Use agarose gel electrophoresis to preliminarily judge whether there is an editing effect. Use the Sanger sequencing method to sequence the products obtained by amplifying the target sequence, view the sequencing chromatogram with Chromas software, calculate the editing efficiency according to the chromatogram results. To further determine the mutation type, next, according to the sequencing chromatogram, select the PCR amplification products of the samples that may have an editing effect for monoclonal detection.

[0134] (3) Cloning detection of PCR products

[0135] Ligate the purified PCR products to the pMD19-T vector (TaKaRa, 6013), transform them into Escherichia coli DH5α competent cells (TransGen Biotech, CD201-01), spread the plates, culture overnight in a 37 °C incubator, pick monoclonal colonies, perform colony PCR amplification, screen positive clones and send them to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing. The detailed steps are as follows:

[0136] a) Ligation The ligation system is shown in Table 4.

[0137] Table 4 The ligation system is as follows:

[0138] Component Dosage / μL pMD19-T 1 PCR Product 4 Solution Ⅰ (Reagent I) 5 Total Volume 10

[0139] Ligate at 16 °C for 4 - 6 h.

[0140] b) Transformation of the ligation product into competent cells

[0141] Add the ligation product to 50 μL of competent cells, mix well, and incubate on ice for 30 min. Heat shock in a 42 °C water bath for 45 seconds, and place on ice for 2 minutes. Add 500 μL of antibiotic-free LB liquid medium, place on a shaker at 220 rpm, and culture at 37 °C for 2 hours.

[0142] c) Spread the plates. Take 40 - 50 μL of the bacterial solution and spread it evenly on a plate containing 0.1% (mass concentration) ampicillin antibiotic, and culture overnight in a 37 °C incubator.

[0143] d) Pick monoclonal colonies

[0144] Pick monoclonal colonies in a laminar flow hood into 20 μL of sterile water and vortex mix. Take 1 μL of the mixed solution and add it to a 19 μL PCR system: 10 μL of Premix Taq™ (Takara, RR901A), 0.5 μL each of M13 primers M13F / R, and 9 μL of DEPC-H2O. PCR reaction program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 40 s, 35 cycles; extension at 72°C for 10 min. Add 500 μL of ampicillin antibiotic with a mass concentration of 0.1% to the remaining 19 μL of sterile water and culture it in a shaker at 37°C and 220 rpm for 4 - 6 hours. According to the results of agarose gel electrophoresis detection of colony PCR, select the monoclonal bacterial solution with a band around 700 bp and send it to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing.

[0145] The sequences of M13 primers are as follows:

[0146] M13F: AGGGTTTTCCCAGTCACG (SEQ ID No.11),

[0147] M13R: GAGCGGATAACAATTTCACAC (SEQ ID No.12).

[0148] (4) Sequence analysis

[0149] Use NCBI (https: / / www.ncbi.nlm.nih.gov / ) to align and verify the correctness of the nucleotide sequence of the EcIAG gene obtained by sequencing with the nucleotide sequence obtained by transcriptome sequencing. The results show that the sequencing results are consistent. Use DNAman version 7 software for sequence alignment.

[0150] (5) Statistics of gene editing results of offspring individuals of Exopalaemon carinicauda

[0151] a) Injection statistics results in September 2023:

[0152] Preparation of Cas9 RNP, add the prepared Cas9 protein, EcIAG-gRNA1 and EcIAG-gRNA2 to PBS buffer (Solarbio, P1020) to form a mixture. The mass concentration of Cas9 protein in the mixture is 1 μg / μl, EcIAG-gRNA1 and EcIAG-gRNA2 The mass concentrations are 0.5 μg / μl respectively.

[0153] Select 10 female Exopalaemon carinicauda at ovarian development stage II, and intramuscularly inject 10 μL of each containing 10 μg of Cas9 protein and 10 μg of sgRNA (whereEcIAG-gRNA1 and EcIAG-gRNA2 respectively are 5 a mixture of µg), and the injection site for intramuscular injection was the base of the first pair of swimming legs of Exopalaemon carinicauda. After injection, they were co-cultured and mated with male Exopalaemon carinicauda respectively, and a total of 6 spawning Exopalaemon carinicauda were obtained. For each shrimp, 24 embryos developed to the blastula stage were randomly selected from the offspring for detection, and the sequencing peak map of the gene-edited embryo stage was as shown in Figure 3 shown. Among the eggs produced by the 6 shrimps detected, the eggs produced by 3 shrimps had editing effects, and the ones that played a role were EcIAG-sgRNA1 and EcIAG-sgRNA2 , and a large fragment deletion occurred between the two sgRNA , as shown in Figure 4 shown. The specific detection results are statistically shown in Table 5 below:

[0154] Table 5 Statistical table of the editing effects of eggs laid by 6 spawning Exopalaemon carinicauda

[0155] Individual Number Number of Detected Embryos Number of Successful Sequencing Number of Edited Editing Efficiency 1 24 22 0 0 2 24 23 8 34.8% 3 24 24 7 29.2% 4 24 23 7 30.4% 5 24 23 0 0 6 24 24 0 0 .

[0156] b) Statistical results of injections in November 2023

[0157] This time, 6 female Exopalaemon carinicauda at the II stage of ovarian development were selected for injection. The preparation of Cas9 RNP was the same as above, and each was injected with 10 µl of a mixture containing 10 µg of Cas9 protein and 10 µg of sgRNA (where EcIAG-gRNA1 and EcIAG-gRNA2 respectively are 5 µg), and the injection site for intramuscular injection was the base of the first pair of swimming legs of Exopalaemon carinicauda. After injection, they were co-cultured and mated with male Exopalaemon carinicauda respectively, and a total of 4 spawning Exopalaemon carinicauda were obtained. For each shrimp, 24 embryos developed to the blastula stage were randomly selected from the offspring for detection, and the sequencing peak map of the gene-edited embryo stage was as shown in Figure 5 shown. Among the eggs produced by the 4 shrimps detected, the eggs produced by 2 shrimps had editing effects, and a large fragment deletion occurred between EcIAG-sgRNA1 and EcIAG-sgRNA2 , as shown in Figure 6 shown. The specific detection results are statistically shown in Table 6 below:

[0158] Table 6 Statistical table of the editing effects of eggs laid by 4 spawning Exopalaemon carinicauda

[0159] Individual Number Number of Detected Embryos Number of Successful Sequencing Number of Edited Editing Efficiency 1 24 20 1 5% 2 24 19 0 0 3 24 16 0 0 4 24 13 4 30.7% .

[0160] c) Statistical results of injections in May 2024

[0161] Ten female white shrimps in the ovarian development stage II were selected for injection. The preparation of Cas9 RNP was the same as above. Each shrimp was injected with 10µl containing 10µg Cas9 protein and 20µg sgRNA (in EcIAG-gRNA1 and EcIAG-gRNA2 They are 5 The mixture of 100 μg and 20 μg was injected intramuscularly at the base of the first pair of swimming legs of white shrimp. After injection, they were raised and mated with male white shrimp, and a total of 9 spawning white shrimp were obtained. 24 embryos that developed to blastocysts were randomly selected from the offspring of each shrimp for testing. The embryos with gene editing were analyzed by agarose gel electrophoresis. Figure 7 As shown. Among the 9 shrimp eggs tested, 4 shrimp eggs had editing effects. EcIAG-sgRNA1 ,like Figure 8 The specific test results are shown in Table 7 below:

[0162] Table 7 Statistics of editing effect of 9 spawning white shrimp

[0163] Individual Number Number of Detected Embryos Number of Successful Amplification Number of Edited Editing Efficiency 1 24 24 15 62.5% 2 24 24 0 0 3 24 24 8 33.3% 4 24 24 6 25% 5 24 24 0 0 6 24 24 0 0 7 24 24 1 4% 8 24 24 0 0 9 24 24 0 0 .

[0164] From the above results, it can be seen that the RNP injection method based on adult white shrimp is feasible, and gene editing of offspring can be achieved through adult injection. This method is simpler than the microinjection method, and can also be used to deliver other biomacromolecules to white shrimp oocytes during ovarian development, and can be applied to other crustaceans.

[0165] Example 4 Gene Editing Detection in Offspring of Litopenaeus vannamei

[0166] Preparation of Cas9 RNP, the prepared Cas9 protein, LvIAG-gRNA1 and LvIAG-gRNA2 Add to PBS buffer (Solebol, P1020) to form a mixture, the mass concentration of Cas9 protein in the mixture is 1µg / µl, LvIAG-gRNA1 and LvIAG-gRNA2 The mass concentrations were 0.5µg / µl;

[0167] The selection and injection method of female Penaeus vannamei was the same as that of white shrimp. A total of 4 female Penaeus vannamei were selected for intramuscular injection, and each was injected with 10µl containing 10µg Cas9 protein and 10µg sgRNA ( LvIAG-gRNA1 and LvIAG-gRNA2 They are 5 µg) were injected and then fed with male white shrimps. All four shrimps laid eggs, with each shrimp producing tens to hundreds of thousands of fertilized eggs. The fertilized eggs were hatched and developed to the nauplii stage for sampling.DNA Extract the nauplii using an extraction kit (Takara, catalog number 9182), DNA select 192 nauplii from each shrimp offspring for DNA extraction, and the extraction method refers to the kit instruction manual.

[0168] (1) LvIAG The first-round PCR amplification of the gene

[0169] The primers used for the first-round PCR amplification are forward and reverse primers containing adaptor and target gene sequences.

[0170] The forward primer sequence is Lv-IAG-barcode-F: ACACGACGCTCTTCCGATCTNNNNNNNNCCACAAAACACCACAACAAGC (SEQ ID No.13).

[0171] The reverse primer sequence is Lv-IAG-barcode-R: TGGAGTTCAGACGTGTGCTCTTCCGATCTAGCAATTACCTGACTCACCCT (SEQ ID No.14); The amplification system and amplification program are shown in Tables 8 and 9:

[0172] Table 8 First-round PCR amplification system:

[0173] Reagent Name Volume (μL) 2xMultiplex DNA Buffer (high specificity) 5 Primer F 0.5 Primer R 0.5 DNA 4 Multiplex DNA Polywerase (high specificity) 0.25

[0174] Table 9 First-round PCR amplification program settings:

[0175] .

[0176] (2) LvIAG The second-round PCR amplification of the gene

[0177] In the second-round PCR amplification, forward tags (barcodes) and reverse tags (indexes) are added to each sequence. The second-round forward primer contains an adaptor sequence and a barcode.

[0178] The forward primer sequence is: AATGATACGGCGACCACCGAGATCTACACAACGTGATACACTCTTTCCCTACACGACGCTCTTCCGATCTTGAACACG (SEQ ID No.15);

[0179] The reverse primer also contains an adapter sequence and an index sequence. The reverse primer sequence is: CAAGCAGAAGACGGCATACGAGATTAGCTTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG (SEQ ID No. 16); Using the first-round product as a template for amplification, the specific amplification system and amplification program are shown in Table 10 and Table 11:

[0180] Table 10 Second-round PCR amplification system:

[0181] Reagent Name Volume (μL) 2xMultiplex DNA Buffer (high specificity) 12.5 Barcode (Forward Label) 0.4 Index (Reverse Label) 0.4 First-round PCR Product 5 Multiplex DNA Polywerase (high specificity) 0.5

[0182] Table 11 Second-round PCR amplification program settings:

[0183] 。

[0184] (3) Use a gel extraction kit for gel extraction

[0185] Recover all products from the same individual into the same tube, use a gel extraction kit for recovery, then measure the concentration, and send it to Novogene for high-throughput sequencing.

[0186] (4) Use Fastp software to perform a preliminary analysis of the sequences

[0187] Use Fastp software to perform quality control on the obtained second-generation sequencing files, remove adapter sequences, polyG, and low-quality sequences, then merge the sequences at both ends, and output a fastq format file for subsequent analysis.

[0188] (5) Use blast software to align the sequencing data with the target fragment

[0189] Convert the merged file obtained in the previous step to the fasta format, use blast software for alignment, and output the results.

[0190] The analysis results show that the editing efficiencies of the offspring produced by 4 parent Litopenaeus vannamei after intramuscular injection are 2.1%, 8.7%, 6.3%, and 3.4% respectively. Some of the sequenced sequences show fragment deletion phenomena between LvIAG-gRNA1 and LvIAG-gRNA2 as shown in the sequence example Figure 9 indicating that this method has successfully achieved gene editing of the offspring individuals of Litopenaeus vannamei.

Claims

1. A method for editing target genes in offspring of white shrimp or Litopenaeus vannamei, characterized in that: The method involves injecting Cas9 RNP into the muscle of a white shrimp or a Penaeus vannamei mother, followed by mating with a male individual to edit the target gene of the offspring individual. Cas9 RNP is a Cas9 protein and guide RNA mixture; said guide RNA Genes controlling male sex differentiation in white shrimp E Guidance RNA , or the gene controlling male sex differentiation in Penaeus vannamei LqCy Guidance RNA ; Genes controlling male sex differentiation in white shrimp E The nucleotide sequence of the male sex differentiation control gene of Penaeus vannamei is shown in SEQ ID No.1 in the sequence list. LqCy The nucleotide sequence is shown in SEQ ID No.4 in the sequence listing, Genes controlling male sex differentiation in white shrimp E Guidance RNA for EcIAG-gRNA1 and EcIAG-gRNA2 ,in EcIAG-gRNA1 The ribonucleotide sequence is shown in SEQ ID No. 2 in the sequence table, EcIAG-gRNA2 The ribonucleotide sequence is shown in SEQ ID No. 3 in the sequence table, Genes controlling male sex differentiation in Litopenaeus vannamei LqCy Guidance RNA for LvIAG-gRNA1 and LvIAG-gRNA2 ,in, LvIAG-gRNA1 The ribonucleotide sequence of is shown in SEQ ID No.5 in the sequence table, LvIAG-gRNA2 The ribonucleotide sequence is shown as SEQ ID No.6 in the sequence listing.

2. The method for editing target genes in progeny according to claim 1, characterized in that: The target gene is a male sex differentiation control gene of white shrimp E Male sex differentiation control gene in Litopenaeus vannamei LqCy .

3. The method for editing target genes in progeny according to claim 1, characterized in that: The mixture contains Cas9 protein and guide RNA The mass concentration of Cas9 RNP was 1-5µg / µl, and the injection volume of Cas9 RNP was 8-20μL.

4. The method for editing target genes in progeny according to claim 1, characterized in that: The injection volume of the Cas9 RNP is 10-15 μL.

5. The method for editing target genes in progeny according to claim 1, characterized in that: The site of intramuscular injection in the mother is the base of the first pair of swimming legs of the white shrimp or the vannamei shrimp.

6. The method for editing target genes in progeny according to claim 1, characterized in that: The mother is a female shrimp of Litopenaeus chinensis or Litopenaeus vannamei whose ovaries are in the II or III developmental stage.

Images