Glutelin CAPS (cleaved amplified polymorphic sequence) labeled primer group closely related to wheat weak gluten strength and application thereof

Abstract

The invention discloses a glutelin CAPS (cleaved amplified polymorphic sequence) marker primer group closely related to wheat weak gluten strength and application of the glutelin CAPS marker primer group, and belongs to the field of crop breeding and molecular biology. The primer group consists of forward and reverse primers with nucleotide sequences respectively shown as SEQ ID NO.1 and SEQ ID NO.6, the CAPS labeled primer group can be used for carrying out genetic typing identification on Glu-B1x7C514T, and experiments show that in the process of carrying out weak gluten wheat breeding by utilizing the Glu-B1x7C514T, the primer group is used for carrying out PCR amplification on genomes of all generations, and the amplification product is subjected to BstEII enzyme digestion and electrophoresis, so that the genetic typing identification of the Glu-B1x7C514T is realized. If the genotype of the wheat to be detected is consistent with a wheat genome electrophoretic band with a Glu-B1x7C514T genotype, judging that the genotype of the wheat to be detected has the Glu-B1x7C514T, and the wheat genotype has high possibility of having weak gluten strength; the CAPS marker primer group can be used for molecular marker-assisted selective breeding, and the breeding efficiency of weak gluten wheat is improved.

Description

Technical Field

[0001] The invention relates to the fields of crop breeding and molecular biology, in particular to a gluten CAPS marker primer set closely related to the strength of wheat weak gluten and an application thereof. Background Art

[0002] Weak-gluten wheat generally has the characteristics of low grain hardness, low flour water absorption rate and low gluten strength. It is the main raw material for biscuit and pastry flour. The food industry has high requirements for its weak gluten quality and stability. Grain hardness is a quality trait controlled by the main gene, which is relatively easy to select in the breeding process. Flour water absorption rate is affected by factors such as protein content, pentosan content and damaged starch rate caused by different grain hardness. Studies have shown that under high-yield cultivation conditions, the grain hardness and water absorption rate of most weak-gluten wheat varieties (lines) promoted in large areas in my country meet GB / T 17320-2013 (variety quality classification standard), but the protein content, wet gluten content and dough stability time cannot meet GB / T 17320-2013 and GB / T17893-1999 (commercial wheat circulation field standard) (Zhang Pingping et al., Acta Agronomica Sinica, 2020, 46(4): 491-502). Protein content is highly positively correlated with wet gluten content, and most studies believe that the correlation between protein content and the processing quality of weak-gluten wheat is low (Zhang Pingping et al., Acta Crop Sinica, 2020, 46(4): 491-502; Zhang, QJ, et al., Crop Science, 2007, 47: 656-664). Therefore, how to reduce gluten strength has become the key to the breeding and production of high-quality weak-gluten wheat.

[0003] High molecular weight glutenin subunits (HMW-GS) account for only 10% of the total storage protein in wheat grains, but have an important influence on gluten strength. Their encoding genes are located at the Glu-A1, Glu-B1 and Glu-D1 sites (collectively referred to as the Glu-1 site) of the first homologous group. Each site encodes 1 to 2 HMW-GS. Common wheat has 4 to 5 HMW-GS, which appear as HMW-GS protein bands with different mobilities in standard SDS polyacrylamide gel electrophoresis (SDS-PAGE) (Gianibelli, MC et al., Cereal chemistry, 2001, 78: 635-646). In recent years, a few studies have shown that the loss of certain Glu-1 sites or HMW-GS not only directly leads to a decrease in the HMW-GS content in flour, but also directly reduces the stability of the gluten network and gluten strength in the dough, which may be a way to improve the processing quality of weak gluten wheat (Zhang, X., et al., Journal of integrative agriculture, 2018, 17: 1066-1073; Zhang, PP, et al., Journal of the science of food and agriculture, 2014, 94: 2801-2806). However, different HMW-GS have different amino acid sequences and structures, and their expression levels in grains are also different, which have different effects on wheat dough strength, dough extensibility and processing quality (Zhang, PP, et al., Journal of the Science of Food and Agriculture, 2014, 94: 2801-2806; Jondiko, TO, et al., Cereal Chemistry, 2012, 89: 155-161). At present, there is still no systematic study on how to apply HMW-GS deletion in weak-gluten wheat breeding.

[0004] Chemical mutagenesis to induce functional gene silencing is an important method for creating trait loss. Ethyl methyl sulfonate (EMS) chemical mutagenesis has been widely used to create wheat mutants. This method can produce a large number of single nucleotide mutations (SNPs) in the genome, most of which are C / G to T / A conversions. Some conversions can cause gene function loss (Feiz, L., et al., Theoretical and applied genetics, 2009, 118: 247-257; Sikora, P., et al., International journal of plant genomics, 2011, 13: doi: 10.1155 / 2011 / 314829).

[0005] Studies have shown that the Glu-B1 site in the Glu-1 site has the most abundant allelic variation, with about 11 types (Gianibelli, MC et al., Cereal chemistry, 2001, 78: 635-646). Among them, the three allelic variations of Glu-B1a, Glu-B1b and Glu-B1c encode high molecular weight glutenin subunit combinations Glu-B1x7, Glu-B1x7+y8 and Glu-B1x7+y9, respectively. Glu-B1x7 is the most frequently encoded subunit type at the Glu-B1 site (Zhang Ping et al., 2014, 30(5): 959-965; Chen Jie et al., Molecular Plant Breeding, https: / / kns.cnki.net / kcms / detail / 46.1068.S.20210820.0949.004.html). Further quantitative studies on HMW-GS showed that the content of single HMW-GS encoded by the Glu-1 site and the total amount of HMW-GS were significantly positively correlated with gluten strength, among which Glu-B1x had the highest content, and its expression level was closely related to gluten strength (Wieser and Zimmermann, European food research and technology, 2000, 210: 324-330; Zhang, PP, et al., Cereal chemistry, 2007, 84: 370-378). The applicant previously used EMS chemical mutagenesis to create a mutant line MU21-1 with Glu-B1x7 subunit deletion in wheat grains using the Ningmai 9 wheat variety as material. The mutant line has the nonsense mutant gene Glu-B1x7C514T of Glu-B1x7WT. Glu-B1x7C514T can significantly reduce gluten strength in the Ningmai 9 background (Zhang Pingping et al., Journal of Nuclear Agricultural Sciences, 2018, 32(4):708-714). However, the HMW-GS encoding gene is a dominant gene. Therefore, in the process of weak-gluten wheat breeding using Glu-B1x7C514T, conventional SDS-PAGE detection cannot be used to select heterozygous offspring with HMW-GS deletion, which affects the selection efficiency of offspring agronomic traits. Summary of the invention

[0007] In view of the problem of low breeding efficiency of weak-gluten wheat with the Glu-B1x7C514T gene and the technical demand for molecular marker-assisted selection in the breeding of weak-gluten wheat, the present invention provides a gluten CAPS marker primer set that is closely related to the weak gluten strength of wheat. The primer set can accurately identify Glu-B1x7C514T, is beneficial to the selection of wheat genotypes with weak gluten strength, and improves the breeding efficiency of weak-gluten wheat.

[0008] The present invention is achieved through the following technical solutions.

[0009] First, the present application discloses a gluten CAPS marker primer set closely related to the strength of wheat weak gluten, which consists of a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6. This set of primers can be used to detect wheat samples with the Glu-B1x7C514T gene.

[0010] Secondly, the present application provides the application of the above-mentioned gluten CAPS marker primer set that is closely related to the strength of wheat weak gluten in detecting the strength of wheat weak gluten.

[0011] That is, the sample wheat leaf DNA is used as a template, and the forward primer (SEQ ID NO.1) and the reverse primer (SEQ ID NO.6) are used as primers to perform PCR amplification, and then the amplified product is digested with BstEII, and then detected by agarose gel electrophoresis; at the same time, wheat genomic DNA with a homozygous Glu-B1x7C514T genotype (such as MU21-1 wheat) is used as a positive control; if the PCR amplification product of the wheat to be tested and the PCR amplification product of the wheat in the control group can both be digested with BstEII, and the digestion products show the same band pattern in the agarose gel electrophoresis detection, it is considered that the wheat to be tested has the homozygous Glu-B1x7C514T genotype; if only one of the digestion product fragments is identical to the fragment of the positive control, If the sizes are the same, it indicates that the wheat sample has a genotype that is heterozygous for the Glu-B1x7C514T gene and the Glu-B1x7WT gene; the wheat genotype to be tested with the homozygous genotype of Glu-B1x7C514T is expected to have weak gluten strength, and its gluten strength is lower than that of wheat without the homozygous genotype of Glu-B1x7C514T; in actual breeding, if the sample wheat genotype is a high-generation wheat line, it is expected to have weak gluten strength; if the sample wheat genotype is a low-generation wheat line, it can be used as the focus of field selection of weak-gluten wheat varieties. The detection method can be used to improve the success rate of breeding of weak-gluten wheat.

[0012] PCR reaction program: Step 1: 95°C, 3 min; Step 2: 94°C, 30 s, 62-64°C, 15 s, 72°C, 30 s, for a total of 30-35 cycles; Step 3: 72°C, 7 min; Step 4: maintain at 10°C.

[0013] PCR reaction system: the total volume is 10 μL, including 0.4 μL of wheat sample genomic DNA with a concentration of 20-100 ng / μL, 1.0 μL of 10×PCR buffer, 0.2 μL of 10 mM dNTP Mix, 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 0.05 μL of TaqDNA polymerase, and ddH2O to make up the balance; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

[0014] PCR product digestion system: Add PCR buffer 1.3μL, Nuclease-free H2O 1.4μL, 20,000 units / mL Add 0.3 μL of endonuclease, mix well and perform enzyme digestion at 37°C for no less than 1 hour.

[0015] Agarose gel electrophoresis detection: The above enzyme digestion products were detected by agarose gel electrophoresis with a concentration of 2.0%, a voltage of 120V, and an electrophoresis time of 40min.

[0016] Further preferably, the above-mentioned wheat sample is wheat with wild genotype Glu-B1x7WT, Glu-B1x7C514T, or with heterozygous genotype Glu-B1x7WT / Glu-B1x7C514T, such as mutant line MU21-1 and its hybrid (hybridized with Ningmai 14, Ningmai 18, Yangmai 22, etc.) offspring lines.

[0017] Third, the present application provides a gluten CAPS marker primer kit which is closely related to the strength of wheat weak gluten, the kit comprising: a forward primer, a reverse primer, and a restriction endonuclease BstEII; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.6.

[0018] Furthermore, the above primer kit also includes a wheat genome template having Glu-B1x7C514T; further, the kit also includes components such as PCR buffer, dNTP Mix, TaqDNA polymerase, etc. required for conventional PCR detection.

[0019] Compared with the wild-type Glu-B1x7WT, the Glu-B1x7C514T gene has a single nucleotide polymorphism (SNP) conversion at position 514 in the coding region, that is, the nucleotide C / G is converted to T / A. The present application develops a co-dominant CAPS marker for Glu-B1x7C514T based on the SNP site and flanking sequence characteristics of the Glu-B1x7C514T gene. This marker is closely associated with weak gluten in wheat. The present application designs a unique primer design and uses electrophoresis detection to directly determine the genotype of the wheat sample, and then judges its gluten strength. It can not only greatly improve the efficiency of offspring selection, but also greatly improve the detection efficiency compared with the more complicated SDS-PAGE protein biochemical marker. The invention has the characteristics of less wheat grain samples required, low equipment and consumables costs, and high field selection efficiency. It greatly reduces the equipment and labor costs for grain gluten quality detection and can be used as a molecular marker-assisted selection tool for weak gluten wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a sequence of about 300 bp upstream and downstream of the 514th SNP in the coding region of the Glu-B1x7C514T gene;

[0021] The first number of each line is the physical position of the first nucleotide in each line of nucleotide sequence in the gene coding region. The nucleotide sequence is shown in SEQ ID NO.7.

[0022] Figure 2 The results of annealing temperature screening of specific primers for the fragment containing nucleotide 514 in the coding region of wheat Glu-B1x7 gene;

[0023] Lane 1 is DL500 marker, and the fragment sizes from top to bottom are 500bp, 400bp, 300bp, 250bp, 200bp, 100bp, and 50bp, respectively; the PCR forward and reverse primer combinations of lanes 2 to 6 are PCR products of SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, SEQ ID NO.4 / SEQ ID NO.6, and SEQ ID NO.5 / SEQ ID NO.6, respectively, and the annealing temperature is 58°C; the PCR forward and reverse primer combinations of lanes 7 to 11 are PCR products of SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, SEQ ID NO.4 / SEQ ID NO.6, and SEQ ID NO.5 / SEQ ID NO.6, respectively, and the annealing temperature is 60°C; the PCR forward and reverse primer combinations of lanes 12 to 16 are SEQ ID NO.1 / SEQ ID The PCR products of lanes 17 to 21 are SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, SEQ ID NO.4 / SEQ ID NO.6, and SEQ ID NO.5 / SEQ ID NO.6, and the annealing temperature is 62°C; the forward and reverse primer combinations of PCR in lanes 17 to 21 are SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, SEQ ID NO.4 / SEQ ID NO.6, and SEQ ID NO.5 / SEQ ID NO.6, and the annealing temperature is 64°C.

[0024] Figure 3 The BstEII digestion product is obtained by PCR amplification of the fragment containing the 514th nucleotide in the coding region of wheat Glu-B1x7C514T gene using specific forward and reverse primer sets SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, and SEQ ID NO.4 / SEQ ID NO.6;

[0025] Lane 1 is DL500 marker, and the fragment sizes from top to bottom are 500bp, 400bp, 300bp, 250bp, 200bp, 100bp, and 50bp, respectively; Lane 2 is PCR of wild-type Glu-B1x7WT using specific forward and reverse primer sets SEQ ID NO.1 / SEQID NO.6, as a non-enzyme-cleaved control; Lanes 3 to 6 are Glu-B1x7C514T amplified by PCR using specific forward and reverse primer sets SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, and SEQ ID NO.4 / SEQ ID NO.6, and the amplified products were digested with BstEII, among which SEQ ID NO.1 / SEQ IDNO.6 had the best enzyme digestion effect, and was finally screened as the CAPS marker primer set.

[0026] Figure 4 It is a schematic diagram of the typing results of the F4 generation plants of the hybrid combinations of MU21-1 / Ningmai 14, MU21-1 / Ningmai 18, and MU21-1 / Yangmai 22 using the primer set of SEQ ID NO.1 / SEQ ID NO.6 and BstEII enzyme CAPS marker;

[0027] Among them, lane 1 is DL500 marker, and the fragment sizes from top to bottom are 500bp, 400bp, 300bp, 250bp, 200bp, 100bp, and 50bp, respectively; the genotype of lane 2 is Ningmai 9 (with wild type Glu-B1x7WT); the genotype of lane 3 is MU21-1 (with Glu-B1x7C514T); the genotypes of lanes 4 to 9 are 6 F4 lines of the hybrid combination of MU21-1 / Ningmai 14; the genotypes of lanes 10 to 15 are 6 F4 lines of the hybrid combination of MU21-1 / Ningmai 18; the genotypes of lanes 16 to 21 are 6 F4 lines of the hybrid combination of MU21-1 / Yangmai 22. DETAILED DESCRIPTION

[0028] The following is the nucleotide sequence involved in the embodiment:

[0029] SEQ ID NO.1: 5'-CAGCAGGGGTCATACTATCCA-3';

[0030] SEQ ID NO.2: 5'-CGCAGCAGGGGTCATACTA-3';

[0031] SEQ ID NO.3: 5'-TCGCAGCAGGGGTCATACTA-3';

[0032] SEQ ID NO.4:5'-GCAGCAGGGGTCATACTATCC-3':

[0033] SEQ ID NO.5:5'-ACTATCCAGGCCAAGCTTCT-3':

[0034] SEQ ID NO.6:5'-GTCCTGGCTGCTGTGAAGTT-3':

[0035] SEQ ID NO.7:

[0036] TGTGGTGCCGTCCAAGGCCGGATCCTTCTACCCCAGCGAGACTACGCCTT

[0037] CGCAGCAACTCCAACAAATGATATTTTGGGGAATACCTGCACTACTAAGA

[0038] AGGTATTACCCAAGTGTAACTTCTTCGCAGCAGGGGTCATACTATCCAGG

[0039] CCAAGCTTCTCCCCAACAGTCAGGACAAGGACAGCAGCCAGGACAAGAAC

[0040] AGCAACCAGGACAAGGGCAACAAGATCAGCAGCCAGGACAAAGACAACAA

[0041] GGATACTACCCAACTTCTCCGCAACAGCCAGGACAAGGGCAACAACTGGG

[0042] ACAAGGGCAACCAGGGTACTACCCAACTTCAGCAGCCAGGACAAAAAGC

[0043] AGCAGGCAGGACAAGGGCAACAATCAAGGACAAGGACAACAAGGGTACTAC

[0044] CCAACTTCCCCGCAACAGTCAGGACAAGGGCAACAACCGGGACAAGGGCA

[0045] ACCAGGGTACTACCCAACTTCTCCGCAGCAGTCAGGACAATGGCAGCAAC

[0046] CAGGACAAGGGCAACAACCAGGACAAGGGCAGCAATCAGGACAAGGGCAA

[0047] CAAGGTCAGCAGCCAGGACAAGGGCAACGACCAGGACAAGGACAACAAGG

[0048] GTACTACCCAATTTCTCCGCAACAGCCGGGACAAGGGCAACAATCAGGAC

[0049] The wheat varieties involved in the examples are all provided by Jiangsu Academy of Agricultural Sciences and are all conventional / commercially available wheat varieties.

[0050] Example 1 Design of CAPS marker primers for Glu-B1x7C514T gene

[0051] In conventional molecular marker detection, KASP markers have higher flux than CAPS markers, but the success of their development depends on whether the flanking sequence of the SNP meets the primer requirements. In the applicant's preliminary experiments, the SNP associated with MU21-1 wheat with the Glu-B1x7C514T gene could not be designed to obtain a suitable KASP primer set. Therefore, this example immediately developed a CAPS marker for this SNP.

[0052] First, the SNP and its flanking sequences were analyzed. The SNP site and its flanking nucleotide sequences could be recognized by the BstEII enzyme. Then, the sequence of about 300 bp upstream and downstream of the 514th SNP in the Glu-B1x7C514T coding region was extracted ( Figure 1 ). Subsequently, multiple sets of primers were designed within the approximately 600 bp fragment sequence, and the primer set with good amplification effect and restriction site located between the forward and reverse primers (possibly recognized by BstEII endonuclease) was selected.

[0053] In this embodiment, five forward primers were initially designed, and their nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 respectively; and one reverse primer has a nucleotide sequence shown in SEQ ID NO.6.

[0054] Example 2 Screening of Glu-B1x7C514TCAPS Marker PCR Annealing Temperature

[0055] In this example, the forward primers SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 in Example 1 were used to form 5 primer sets with the reverse primer SEQ ID NO.6, respectively, to perform PCR amplification on the MU21-1 wheat genome template having the homozygous Glu-B1x7C514T gene, and then the amplified products were subjected to 2.0% (mass concentration) agarose gel electrophoresis at a voltage of 120V for 40min. The electrophoresis results are shown in FIG. Figure 2 shown.

[0056] PCR reaction program: Step 1: 95°C, 3 min; Step 2: 94°C, 30 s, 62-64°C, 15 s, 72°C, 30 s, for a total of 30-35 cycles; Step 3: 72°C, 7 min; Step 4: 10°C, maintain in PCR instrument.

[0057] PCR reaction system: contains 0.4 μL of wheat sample genomic DNA with a concentration of 20-100 ng / μL, 1.0 μL of 10×PCR buffer, 0.2 μL of 10 mM dNTPMix, 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 0.05 μL of TaqDNA polymerase, and add ddH2O to make up to 10 μL.

[0058] The MU21-1 genome template was extracted using the DNAsecure new plant genome DNA extraction kit produced by Tiangen Biochemical Technology (Beijing) Co., Ltd. The electrophoresis test results are as follows Figure 2 Electrophoresis detection found that when the annealing temperature was ≤60°C, the amplification products of the five primer sets of SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6, SEQ ID NO.4 / SEQ ID NO.6 and SEQ ID NO.5 / SEQ ID NO.6 were all non-specific amplifications; when the annealing temperature was raised to 62°C to 64°C, they all showed specific amplifications, but the concentration of the PCR amplification product of SEQ ID NO.5 / SEQ ID NO.6 was low, and the amplification efficiency was low. Therefore, SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6 and SEQ ID NO.4 / SEQ ID NO.6 were used as target primer sets.

[0059] Example 3 Enzyme Digestion Verification of Glu-B1x7C514T CAPS Labeling

[0060] In this example, four sets of forward / reverse primers (SEQ ID NO.1 / SEQ ID NO.6, SEQ ID NO.2 / SEQ ID NO.6, SEQ ID NO.3 / SEQ ID NO.6 and SEQ ID NO.4 / SEQ ID NO.6) screened in Example 2 were used to perform PCR amplification on the Ningmai No. 9 genome template having the wild-type Glu-B1x7WT gene and the MU21-1 genome template having the homozygous Glu-B1x7C514T gene, and then the PCR amplification product of wheat of Glu-B1x7C514T was digested by BstEII; the PCR amplification product and the digestion product were detected by 2.0% (mass concentration) agarose gel electrophoresis, the voltage was 120V, the electrophoresis time was 40min, and the electrophoresis detection results obtained were as follows: Figure 3 As shown, it can be seen that the enzyme digestion effect of the SEQ ID NO.1 / SEQ ID NO.6 primer set is the best, and it is finally screened as the CAPS marker primer set. The CAPS marker combination of the SEQ ID NO.1 / SEQ ID NO.6 primer set and BstEII endonuclease can be used for the typing and identification of Glu-B1x7C514T.

[0061] The above PCR reaction procedure and PCR reaction system are the same as those in Example 2.

[0062] BstEII digestion: Add to the PCR amplification product of Glu-B1x7C514T gene PCR buffer 1.3μL, Nuclease-free H2O 1.4μL, 20,000 units / mL Add 0.3 μL of endonuclease, mix well and digest at 37°C for 1 h.

[0063] Example 4: Verification of Breeding Application of CAPS Markers

[0064] In order to verify that the CAPS marker combination composed of the primer set SEQ ID NO.1 / SEQ ID NO.6 and the BstEII endonuclease obtained by screening in Example 3 can be used for Glu-B1x7C514T typing and its effectiveness in weak gluten wheat breeding. In this example, MU21-1 with homozygous Glu-B1x7C514T was used as the male parent, and three soft wheats, Ningmai 14, Ningmai 18, and Yangmai 22, were used as the male parents to configure the hybrid combination, and agronomic traits were selected according to the pedigree method. The Glu-B1x7C514T wheat of a total of 56 rows in the F4 generation was typed and identified, the gluten quality of the F4 contemporary grains was analyzed, and compared with the gluten quality of Ningmai 14, Ningmai 18, and Yangmai 22 (Table 1, Table 2 and Table 3). Figure 4), among which the HMW-GS composition of MU21-1 is Glu-A1x1, Glu-B1x0+y8 and Glu-D1x2+y12, the HMW-GS composition of Ningmai 14 is Glu-A1x1, Glu-B1x7+y8 and Glu-D1x2+y12, the HMW-GS composition of Ningmai 18 is Glu-A1x1, Glu-B1x7+y8 and Glu-D1x2+y12, and the HMW-GS composition of Yangmai 22 is Glu-A1x0, Glu-B1x7+y9 and Glu-D1x2+y12.

[0065] The field cultivation management was in accordance with the field production habits in the middle and lower reaches of the Yangtze River, that is, the total nitrogen (in terms of pure nitrogen) was 225 kg / hm, and the total nitrogen and phosphorus fertilizer (in terms of P2O5 and K2O) was 112.5 kg / hm. The genotyping CAPS primer set used was SEQ ID NO.1 / SEQ ID NO.6 and BstEII endonuclease, and the PCR reaction procedure, PCR reaction system, PCR product enzyme digestion system, and electrophoresis procedure used for genotyping were the same as those in Example 2.

[0066] In Tables 1 and 2, the grain protein content was determined by the AACC 39-11 wheat protein content analysis method using a Perten DA7200 near-infrared analyzer (Perten Instruments, Reno, NV, USA); the wet gluten content was determined by the AACC 38-12.02 wet gluten determination method using a Perten GM2200 gluten tester (Beijing Dongfu Jiuheng Instrument Technology Co., Ltd.); and the farinograph stabilization time was determined by the AACC 54-21 flour farinograph method using a JFZD farinograph (Beijing Dongfu Jiuheng Instrument Technology Co., Ltd.).

[0067] If the PCR amplification product of the F4 generation wheat to be tested and the PCR amplification product of the positive control wheat MU21-1 (homozygous Glu-B1x7C514T) can be digested by BstEII, and the digestion products show the same band pattern in agarose gel electrophoresis, then the wheat to be tested is considered to have the homozygous genotype of Glu-B1x7C514T, which is recorded as "C514T" in Table 1; if the digestion product of the PCR amplification product of the F4 generation wheat to be tested obtains two fragments, and only one of the fragments is homozygous with If the enzyme cleavage product fragments of the MU21-1 positive control wheat PCR amplification product are consistent in size, it indicates that the wheat sample has a genotype that is heterozygous for the Glu-B1x7C514T gene and the Glu-B1x7WT gene, which is recorded as "WT / C514T" in Table 1; if the enzyme cleavage product of the F4 generation wheat PCR amplification product to be tested is different from the MU21-1 positive control wheat PCR amplification product, it indicates that the wheat sample has the Glu-B1x7WT genotype, which is recorded as "WT" in Table 1.

[0068] Table 1 Glu-B1x7WT (WT) and Glu-B1x7C514T (C514T) typing and gluten quality of 56 F4 lines of hybrid combinations of MU21-1 / Ningmai 14, MU21-1 / Ningmai 18, and MU21-1 / Yangmai 22

[0069]

[0070]

[0071] Table 2 Comparison of the significance of farinograph stability time between Glu-B1x7WT (WT) and Glu-B1x7C514T (C514T) types in 56 F4 plants of the three hybrid combinations of MU21-1 / Ningmai 14, MU21-1 / Ningmai 18 and MU21-1 / Yangmai 22

[0072]

[0073] Note: Different lowercase letters in the same column indicate significant differences at the 0.05 level.

[0074] Dough stability time is a core indicator in wheat gluten quality evaluation, which is used to indicate the gluten strength and kneading resistance of the dough. The shorter the stability time, the weaker the gluten strength and the worse the kneading resistance of the dough. The national standard for weak-gluten wheat (GB / T17893-1999) used for the commercial circulation of weak-gluten wheat stipulates that the dough stability time of weak-gluten wheat commercial grains should be ≤2.5 minutes; the national wheat variety approval standard used for wheat variety approval (revised in 2024) stipulates that the dough stability time of weak-gluten wheat varieties should be less than 3.0 minutes. The test results in Tables 1 and 2 show that in the MU21-1 / Ningmai 14 combination, there were no significant differences in grain hardness, protein content and wet gluten content among the three types of Glu-B1x7WT, Glu-B1x7WT / Glu-B1x7C514T and Glu-B1x7C514T, but the average values ​​of the farinograph stability time showed significant differences, which were 3.31min, 2.09min and 1.37min, respectively, all lower than 3.82min of Ningmai 14. The stability time of the lines with the homozygous genotype of Glu-B1x7C514T was significantly reduced and reached the standard of weak gluten wheat. The same pattern was also shown in the two combinations of MU21-1 / Ningmai 18 and MU21-1 / Yangmai 22. The average stabilization time of the farinograph of Glu-B1x7C514T type in the MU21-1 / Ningmai 18 combination was 1.35 min, which was significantly lower than the average stabilization time of Glu-B1x7WT type by 3.93 min. The average stabilization time of the farinograph of Glu-B1x7C514T type in the MU21-1 / Yangmai 22 combination was 1.06 min, which was significantly lower than the average stabilization time of Glu-B1x7WT type by 2.70 min, and also significantly lower than the average stabilization time of Glu-B1x7WT / Glu-B1x7C514T type by 2.14 min.

[0075] It can be seen that the CAPS primer set designed in this embodiment can accurately type Glu-B1x7WT and Glu-B1x7C514T, and the gluten strength (expressed by the farinograph stability time in the present invention) of the genotype with Glu-B1x7C514T typing is significantly reduced.

[0076] The CAPS labeled primer kit consisting of the NO.6 primer set and BstEII endonuclease can be accurately used for

[0077] Glu-B1x7C514T typing, and can be used as an effective molecular marker for the selection of weak-gluten wheat varieties.

Claims

1. A gluten CAPS marker primer set closely related to the strength of wheat weak gluten, the primer set consisting of a forward primer with a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

6.

2. Use of the primer set as claimed in claim 1 in detecting the strength of wheat weak gluten.

3. The use according to claim 2, characterized in that: The application refers to using the wheat genome to be tested as a template and the forward primer and reverse primer as primers to perform PCR amplification; then performing BstEII restriction digestion on the amplified product, and then performing agarose gel electrophoresis detection on the restriction digestion product; and at the same time, using Glu-B1x7C514T The genomic DNA of wheat of the same genotype is used as a control; if the PCR amplification product of the wheat to be tested and the PCR amplification product of the control wheat can both be digested by BstEII, and the digestion products show the same band pattern in agarose gel electrophoresis, then the wheat to be tested is judged to have Glu-B1x7C514T Homozygous genotype; Glu-B1x7C514T The gluten strength of the tested wheat with homozygous genotype is lower than that of the wheat without homozygous genotype. Glu-B1x7C514T Homozygous wheat genotype.

4. The use according to claim 3, characterized in that: The wheat to be tested includes a wild-type genotype Glu- B1x7WT , Glu-B1x7C514T , or have a heterozygous genotype Glu-B1x7WT / Glu-B1x7C514T of wheat samples.

5. The use according to claim 3, characterized in that: The PCR amplification refers to a PCR reaction system: 0.4 μL of wheat sample genomic DNA with a concentration of 20 to 100 ng / μL, 1.0 μL of 10× PCR buffer, 0.2 μL of 10 mM dNTP Mix, 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 0.05 μL of TaqDNA polymerase, and ddH2O is added to make up to 10 μL; PCR reaction procedure: Step 1: 95°C, 3 min; The second step was: 94°C, 30 s, 62-64°C, 15 s, 72°C, 30 s, for a total of 30-35 cycles; the third step was: 72°C, 7 min; the fourth step was: hold at 10°C.

6. The use according to claim 3, characterized in that: The BstEII enzyme digestion refers to the following enzyme digestion system: 1.3 μL of 10×PCR buffer, 1.4 μL of Nuclease-free H2O, and 0.3 μL of BstEII endonuclease with a concentration of 20,000 units / mL are added to the amplified product, mixed well, and then digested at 37°C for no less than 1 h.

7. The use according to claim 3, characterized in that: The electrophoresis refers to the detection of agarose electrophoresis with a concentration of 2.0%, a voltage of 120 V, and an electrophoresis time of 40 min.

8. A gluten CAPS marker primer kit closely related to the strength of wheat weak gluten, the kit comprising a forward primer, a reverse primer, and a restriction endonuclease BstEII; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.

6.

9. The kit according to claim 7, characterized in that The kit also includes Glu-B1x7C514T The wheat genome template.

Images