Improved producing cells

Abstract

Herein is reported a modified mammalian cell in which the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1, and ICAM-1 genes have been reduced or eliminated; and a method for the recombinant production of a heterologous polypeptide using the modified mammalian cell according to the invention. Further reported is the use of a reduction in expression of the gene for increasing volume productivity, increasing cell volume, increasing viability and increasing culture times that are not likely for cell division.

Description

[0001] The present invention belongs to the field of recombinant therapeutic peptide production. In more detail, improved mammalian (e.g., Chinese hamster ovary (CHO)) production cells and their use for recombinant production of therapeutic proteins are reported herein, wherein the improvement has been achieved by reducing or eliminating the expression of a limited number of endogenous genes in mammalian cells. Background Art

[0002] Mammalian host cell lines, especially CHO and HEK cell lines, are often used for the recombinant production of secreted proteins, such as supply proteins (e.g., antigens, receptors, etc.) and therapeutic molecules (e.g., antibodies, cytokines, etc.). Typically, these host cell lines are transfected with vectors containing expression cassettes encoding the corresponding therapeutic molecules. Stable transfectants are then selected by applying selection pressure. This produces a "cell pool" consisting of individual "clones". In a single cell cloning step, these clones are isolated and subsequently screened with different assays to identify high-producing cells.

[0003] Genetic engineering methods have been applied to host cell lines to improve their properties, such as (i) overexpression of endogenous proteins involved in the unfolded protein response pathway to improve protein folding and secretion (Gulis, G. et al., BMC biotechnology, 14 (2014) 26), (ii) overexpression of anti-apoptotic proteins to increase cell viability and prolong fermentation processes (Lee, JS, et al. Biotechnol. Bioeng. 110 (2013) 2195-2207), (iii) expression of miRNA and / or s Overexpression of hRNA molecules to improve cell growth and productivity (Fischer, S., et al., J. Biotechnol. 212 (2015) 32-43), (iv) overexpression of glycosidases to modulate the glycosylation pattern of therapeutic molecules (Ferrara, C., et al., Biotechnol. Bioeng. 93 (2006) 851-861) and others (Fischer, S., et al., Biotechnol. Adv. 33 (2015) 1878-1896).

[0004] In addition, reduction or elimination of expression of certain endogenous proteins has been shown to improve cell properties. Examples are (i) reduction or elimination of expression of BAX / BAK proteins leading to increased resistance to apoptosis (Cost, GJ, et al., Biotechnol. Bioeng. 105 (2010) 330-340), (ii) reduction or elimination of expression of PUTS to produce non-fucosylated proteins (Yamane-Ohnuki, N., et al., Biotechnol. Bioeng. 87 (2004) 614-622), (iii) reduction or elimination of expression of GS using a GS selection system to improve selection efficiency (Fan, L., et al., Biotechnol. Bioeng. 109 (2012) 1007-1015) and others (Fischer, S., et al., Biotechnol. Adv. 33 (2015) 1878-1896). Although zinc fingers or TALEN proteins have been used in the past, CRISPR / Cas9 has recently been established for universal and simple targeting of genomic sequences to reduce or eliminate the expression of the target. For example, miRNA-744 was targeted in CHO cells using CRISPR / Cas9 by using multiple gRNAs to enable sequence excision (Raab, N., et al., Biotechnol. J. (2019) 1800477).

[0005] WO 2020 / 260327 reports the use of CRISPR / Cas to inactivate the SIRT-1 gene.

[0006] Bernier, M. et al. reported the negative regulation of SIRT1 protein on STAT3 respiration (J. Biol. Chem. 286 (2011) 19270-19279)

[0007] In WO 2009 / 151591 the use of zinc finger nucleases to inactivate the BAX and BAK genes was reported.

[0008] WO 2022 / 063877 reports the use of CRISPR / Cas to inactivate the MYC gene. Summary of the invention

[0009] Modified mammalian cells with improved properties and their uses are reported herein. Among other things, one of the improved properties of the mammalian cells according to the invention is an increased volumetric productivity compared to mammalian cells not modified according to the invention. Modifications according to the invention include, but are not limited to, reduction or elimination of expression of one or more or all of the BAK, BAX, ICAM-1, SIRT-1 and MYC genes.

[0010] The following independent aspects and dependent embodiments describe the subject matter of the invention:

[0011] 1. A modified mammalian cell in which the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has been reduced or eliminated.

[0012] 2. The modified mammalian cell according to aspect 1, wherein:

[0013] MYC, SIRT-1, and ICAM-1 genes, or

[0014] MYC, BAX, BAK, and SIRT-1 genes, or

[0015] MYC, BAX, BAK, ICAM-1, and SIRT-1 genes

[0016] The expression has been reduced or eliminated.

[0017] 3. The modified mammalian cell according to any one of Aspect 1 or Example 2, wherein the expression of MYC, SIRT-1 and ICAM-1 genes has been reduced or eliminated.

[0018] 4. The modified mammalian cell of any one of Aspect 1 or Embodiment 2, wherein the expression of MYC, BAX, BAK and SIRT-1 genes has been reduced or eliminated.

[0019] 5. The modified mammalian cell of any one of Aspect 1 or Embodiment 2, wherein the expression of MYC, BAX, BAK, ICAM-1 and SIRT-1 genes has been reduced or eliminated.

[0020] 6. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 5, wherein the reduction or elimination of expression is elimination by gene knockout.

[0021] 7. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 5, wherein the reduction or elimination of expression is elimination by gene elimination.

[0022] 8. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 5, wherein the reduction or elimination of expression is by CRISPR / Cas-mediated gene knockout.

[0023] 9. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 5, wherein the reduction or elimination of expression is by CRISPR / Cas-mediated gene inactivation.

[0024] 10. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 9, wherein the modified mammalian cell is a modified CHO cell.

[0025] 11. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 9, wherein the modified mammalian cell is a modified HEK cell.

[0026] 12. The modified mammalian cell of any one of Aspect 1 or Embodiments 2 to 11, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites.

[0027] 13. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 12, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, each of the targeted integration landing sites comprising two or three recombinase recognition sequences, wherein in the case of two or more landing sites, the recombinase recognition sequences of each landing site are incompatible with each other.

[0028] 14. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 13, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one of the targeted integration landing sites comprises the recombinase recognition sequences L3, LoxFas and 2L.

[0029] 15. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 14, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding heterologous proteins have been integrated into one targeted integration landing site.

[0030] 16. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 15, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding monospecific or multispecific antibodies have been integrated into one targeted integration landing site.

[0031] 17. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 15, wherein said reduction or elimination of the expression of MYC, BAK, BAX, ICAM-1 or / and SIRT-1 genes has been achieved after stable introduction of one or more nucleic acids encoding heterologous proteins.

[0032] 18. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 17, wherein said reduction or elimination of the expression of MYC, BAK, BAX, ICAM-1 or / and SIRT-1 genes has been achieved after stable introduction of one or more nucleic acids encoding monospecific or multispecific antibodies.

[0033] 19. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 18, wherein the modified mammalian cell has increased productivity compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0034] 20. A modified mammalian cell according to any one of aspect 1 or embodiments 2 to 19, wherein the productivity of the modified mammalian cell is increased by 10% or more compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0035] 21. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 20, wherein the productivity of the modified mammalian cell is increased by 25% or more compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0036] 22. A modified mammalian cell according to any one of Aspect 1 or Embodiments 2 to 21, wherein the productivity of the modified mammalian cell is increased by 35% or more compared to a mammalian cell with the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0037] 23. The modified mammalian cell of any one of embodiments 19 to 22, wherein said productivity is recombinant expression of a heterologous protein.

[0038] 24. The modified mammalian cell of any one of embodiments 19 to 22, wherein the productivity is recombinant expression of a monospecific or multispecific antibody.

[0039] 25. The modified mammalian cell of any one of embodiments 19 to 24, wherein the productivity is increased compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1, and ICAM-1 genes is wild-type expression of the MYC gene and one or more of the BAK, BAX, SIRT-1, and ICAM-1 genes.

[0040] 26. The modified mammalian cell of any one of embodiments 6, 8, and 10 to 25, wherein the knockout is at least a heterozygous knockout.

[0041] 27. The modified mammalian cell of any one of embodiments 6, 8, and 10 to 25, wherein the knockout is a homozygous knockout.

[0042] 28. A modified mammalian cell according to any one of Aspect 1 and Embodiments 2 to 27, wherein the modified mammalian cell has an increased cell diameter compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0043] 29. The modified mammalian cell of any one of aspect 1 and embodiments 2 to 28, wherein the cell diameter of the modified mammalian cell is increased by at least 0.5 μm compared to a mammalian cell with the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0044] 30. The modified mammalian cell of any one of aspect 1 and embodiments 2 to 29, wherein the cell diameter of the modified mammalian cell is increased by at least 1 μm compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0045] 31. The modified mammalian cell of any one of Aspect 1 and Embodiments 2 to 27, wherein the modified mammalian cell has an increased cell volume compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0046] 32. The modified mammalian cell of any one of aspect 1 and embodiments 2 to 27 and 31, wherein the cell volume of the modified mammalian cell is increased by at least 10% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0047] 33. A modified mammalian cell according to any one of aspect 1 and embodiments 2 to 27 and 31 to 32, wherein the cell volume of the modified mammalian cell is increased by at least 15% compared to a mammalian cell with the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0048] 34. A method for recombinantly producing a protein, the method comprising the steps of:

[0049] a) culturing the modified mammalian cell according to any one of aspect 1 or embodiments 2 to 33 in a culture medium under conditions suitable for expression of the protein, the modified mammalian cell comprising one or more nucleic acids encoding the protein,

[0050] b) recovering said protein from said modified mammalian cell or said culture medium,

[0051] c) optionally purifying the protein using one or more chromatography steps,

[0052] and thereby recombinantly producing the protein.

[0053] 35. The method of aspect 34, wherein the culturing lasts for 6 to 16 days.

[0054] 36. The method of any one of Aspect 34 or Embodiment 35, wherein the culturing continues for 12 to 15 days.

[0055] 37. The method of any one of aspect 34 or embodiments 35 to 36, wherein the culturing continues for about 14 days.

[0056] 38. The method of any one of aspect 34 or embodiments 35 to 37, wherein the culturing is initiated at a cell density of 5*10E6 cells / ml or higher.

[0057] 39. The method of any one of aspect 34 or embodiments 35 to 38, wherein the culturing is initiated at a cell density of 10*10E6 cells / ml or higher.

[0058] 40. The method of any one of aspect 34 or embodiments 35 to 39, wherein the culturing is a fed-batch culturing.

[0059] 41. The method of aspect 34 or any one of embodiments 35 to 40, wherein the culture is a fed-batch culture with feeding on at least day 1, day 4, day 7 and day 10.

[0060] 42. The method of aspect 34 or any one of embodiments 35 to 41, wherein the cultivation is a fed-batch cultivation with daily feeding.

[0061] 43. Use of reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a mammalian cell expressing a recombinant polypeptide for increasing the volumetric productivity of the mammalian cell.

[0062] 44. Use of reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in mammalian cells for increasing cell volume.

[0063] 45. Use of reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a mammalian cell expressing a recombinant polypeptide for increasing the activity of a biological process.

[0064] 46. ​​Use of reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a mammalian cell expressing a recombinant polypeptide for increasing / extending the culture time of the mammalian cell without cell division.

[0065] 47. The use according to any one of aspects 43 to 46, wherein

[0066] MYC, SIRT-1, and ICAM-1 genes, or

[0067] MYC, BAX, BAK, and SIRT-1 genes, or

[0068] MYC, BAX, BAK, ICAM-1, and SIRT-1 genes

[0069] The expression has been reduced or eliminated.

[0070] 48. The use according to any one of aspects 43 to 46, wherein the expression of MYC, SIRT-1 and ICAM-1 genes has been reduced or eliminated.

[0071] 49. The use according to any one of aspects 43 to 46, wherein the expression of MYC, BAX, BAK and SIRT-1 genes has been reduced or eliminated.

[0072] 50. The use according to any one of aspects 43 to 46, wherein the expression of MYC, BAX, BAK, ICAM-1 and SIRT-1 genes has been reduced or eliminated.

[0073] 51. The use according to any one of aspects 43 to 46 or embodiments 47 to 50, wherein the expression has been permanently reduced or eliminated.

[0074] 52. A cell, a method or a use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 51, wherein the reduction or elimination of expression is permanent.

[0075] 53. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 40% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0076] 54. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 50% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0077] 55. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 60% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0078] 56. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 80% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0079] 57. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 90% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0080] 58. A cell, method or use according to any one of Aspect 1 or Aspect 34 or Aspects 43 to 46 or any one of Embodiments 2 to 33 or Embodiments 35 to 42 or Embodiments 47 to 52, wherein the reduction or elimination of expression is at least about 95% compared to a mammalian cell of the same genotype, wherein the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has not been reduced or eliminated.

[0081] In addition to the various embodiments explicitly depicted and claimed, the subject matter encompassed by the present invention is also directed to other embodiments having other combinations of features disclosed and claimed herein. Thus, the specific features presented herein, particularly as aspects or embodiments, may be combined with one another in other ways within the scope of the disclosed subject matter, such that the disclosed subject matter includes any suitable combination of features disclosed herein. For purposes of illustration and description, descriptions of specific embodiments of the disclosed subject matter have been presented. It is not intended to be exhaustive or to limit the disclosed subject matter to those embodiments disclosed.

[0082] An aspect as used herein relates to an independent subject matter of the invention, and an embodiment as used herein provides a more detailed implementation of one or more or all of the independent aspects. DETAILED DESCRIPTION

[0083] The present invention is based, at least in part, on the discovery that the volumetric productivity of recombinant polypeptides in mammalian cells can be increased by reducing or eliminating the expression of one or more or all of the BAK, BAX, ICAM-1, SIRT-1, and MYC genes.

[0084] I. General Definitions

[0085] Methods and techniques that can be used to practice the subject matter of the present invention are described in, for example, Ausubel, FM (ed.), Current Protocols in Molecular Biology, Volumes I to III (1997); Glover, ND and Hames, BD, eds., DNA Cloning: A Practical Approach, Volumes I and II (1985), Oxford University Press; Freshney, RI (ed.), Animal Cell Culture—a practical approach, IRL Press Limited (1986); Watson, JD et al., Recombinant DNA, Second Edition, CHSL Press (1992); Winnacker, EL, From Genes to Clones; NY, VCH Publishers (1987); Celis, J., ed., Cell Biology, Second Edition, Academic Press (1998); Freshney, RI, Culture of Animal Cells: A Manual of Basic Technique, Second Edition, Alan R. Liss, Inc., NY (1987). Derivatives of nucleic acids can be generated using recombinant DNA technology. Such derivatives can be modified, for example, by substitution, alteration, exchange, deletion or insertion at one or several nucleotide positions. Modification or derivatization can be performed, for example, by means of site-directed mutagenesis. Such modifications can be easily performed by those skilled in the art (see, for example, Sambrook, J. et al., Molecular Cloning: A laboratory manual (1999) Cold Spring Harbor Laboratory Press, New York, USA; Hames, BD and Higgins, SG, Nucleic acid hybridization-a practical approach (1985) IRL Press, Oxford, England).

[0086] It must be noted that, as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth. Likewise, the terms "a", "one or more", and "at least one" may be used interchangeably herein. It should also be noted that the terms "comprising", "including", and "having" may be used interchangeably.

[0087] The term "about" means a range of + / -20% of the value that follows. In certain embodiments, the term "about" means a range of + / -10% of the value that follows. In certain embodiments, the term "about" means a range of + / -5% of the value that follows.

[0088] As used herein, the terms "comprises," "including," "having," "having," "may," "contains," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude the possibility of additional actions or structures. The term "comprising" also encompasses the term "including..." The present invention also contemplates other embodiments "comprising," "consisting of," and "consisting essentially of" the embodiments or elements set forth herein, whether or not explicitly set forth.

[0089] As used herein, the term "recombinant mammalian cell" refers to a mammalian cell comprising an exogenous nucleotide sequence capable of expressing a polypeptide. Such recombinant mammalian cells are cells into which one or more exogenous nucleic acids have been introduced, including the offspring of such cells. Therefore, the term "mammalian cell comprising a nucleic acid encoding a heterologous polypeptide" refers to a cell comprising an exogenous nucleotide sequence integrated into the mammalian cell genome and capable of expressing a heterologous polypeptide. In certain embodiments, the mammalian cell comprising an exogenous nucleotide sequence is a cell comprising an exogenous nucleotide sequence integrated at a single site within the locus of the host cell genome, wherein the exogenous nucleotide sequence comprises a first recombination recognition sequence and a second recombination recognition sequence flanking at least one first selection marker, and a third recombination recognition sequence between the first recombination recognition sequence and the second recombination recognition sequence, and all recombination recognition sequences are different.

[0090] As used herein, the term "recombinant cell" refers to a genetically modified cell, e.g., a cell that expresses a heterologous polypeptide of interest and can be used to produce the heterologous polypeptide of interest on any scale. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" refers to a cell in which the coding sequence for the heterologous polypeptide of interest has been introduced into the host cell genome. For example, a "recombinant mammalian cell comprising an exogenous nucleotide sequence" that has undergone recombinase-mediated cassette exchange (RMCE) whereby the coding sequence for the polypeptide of interest has been introduced into the host cell genome is a "recombinant cell."

[0091] "Mammalian cells comprising exogenous nucleotide sequences" and "recombinant cells" are both "transformed cells". The term includes the primary transformed cell and progeny derived therefrom, without regard to the number of passages. Progeny may, for example, not be completely identical to the nucleic acid content of the parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are encompassed.

[0092] An "isolated" nucleic acid refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that normally contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0093] An "isolated" polypeptide or antibody is one that has been separated from a component of its natural environment.

[0094] The term "integration site" refers to a nucleic acid sequence in a cell genome into which an exogenous nucleotide sequence has been inserted. In certain embodiments, the integration site is between two adjacent nucleotides in the cell genome. In certain embodiments, the integration site comprises a nucleotide sequence. In certain embodiments, the integration site is located in a specific locus of the genome of a mammalian cell. In certain embodiments, the integration site is in an endogenous gene of a mammalian cell.

[0095] As used herein, the terms "vector" or "plasmid" (used interchangeably) refer to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. The term includes vectors that are self-replicating nucleic acid structures, as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operably linked. Such vectors are referred to herein as "expression vectors."

[0096] As used herein, the term "selection marker" refers to a gene that allows specific selection or exclusion of cells carrying the gene in the presence of a corresponding selective agent. For example, but not limited to, a selection marker can allow positive selection of host cells transformed with the selection marker gene in the presence of a corresponding selective agent (selective culture conditions); untransformed host cells will not be able to grow or survive under the selective culture conditions. Selection markers can be positive, negative or bifunctional. Positive selection markers can allow selection of cells carrying the marker, while negative selection markers can allow selective elimination of cells carrying the marker. Selection markers can confer resistance to drugs, or compensate for metabolic or catabolism defects in host cells. In prokaryotic cells, genes that confer resistance to ampicillin, tetracycline, kanamycin or chloramphenicol, as well as other genes, can be used. Resistance genes that can be used as selectable markers in eukaryotic cells include, but are not limited to, genes for aminoglycoside phosphotransferases (APHs) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid. Additional marker genes are described in WO 92 / 08796 and WO 94 / 28143.

[0097] In addition to facilitating selection in the presence of a corresponding selective agent, a selectable marker may alternatively be a molecule not normally present in cells, such as green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean, and T-Sapphire. Cells expressing such a molecule can be distinguished from cells not containing the gene, for example, by detecting fluorescence emitted by the encoded polypeptide or the absence of such fluorescence, respectively.

[0098] As used herein, the term "operably connected" refers to the juxtaposition of two or more components, wherein the relationship of these components allows them to play a role in an expected manner. For example, if a promoter and / or an enhancer are used to regulate the transcription of a coding sequence, the promoter and / or the enhancer are operably connected to the coding sequence. In certain embodiments, the DNA sequence of "operably connected" is connected and adjacent on a single chromosome. In certain embodiments, for example, when two protein coding regions (such as a secretory leader and a polypeptide) must be joined, these sequences are connected, adjacent, and in the same reading frame. In certain embodiments, the promoter that is operably connected is located upstream of the coding sequence and can be adjacent to the coding sequence. In certain embodiments, for example, about the enhancer sequence that regulates the expression of the coding sequence, these two components can be operably connected, but are not adjacent. If an enhancer increases the transcription of a coding sequence, the enhancer is operably connected to the coding sequence. The enhancer that is operably connected can be located upstream, inside or downstream of the coding sequence, and can be located at a position quite far away from the promoter of the coding sequence. Operable linkage can be accomplished by recombinant methods known in the art, for example using PCR methods and / or by ligating at convenient restriction sites. If there are no convenient restriction sites, synthetic oligonucleotide adapters or linkers can be used according to conventional practice. An internal ribosome entry site (IRES) is operably linked to an open reading frame (ORF) if it allows translation of the ORF to be initiated at an internal position independent of the 5' end.

[0099] As used herein, the term "exogenous" refers to a nucleotide sequence that is not derived from a specific cell, but is introduced into the cell by a DNA delivery method (e.g., by a transfection method, an electroporation method, or a transformation method). Therefore, an exogenous nucleotide sequence is an artificial sequence, wherein the artificiality can be derived from, for example, a combination of subsequences from different sources (e.g., a combination of a recombinase recognition sequence with an SV40 promoter and a coding sequence for a green fluorescent protein is an artificial nucleic acid) or from a sequence (e.g., only encoding the extracellular domain of a membrane-bound receptor or a sequence of a cDNA) or a partial deletion, or a nuclear base mutation. The term "endogenous" refers to a nucleotide sequence derived from a cell. An "exogenous" nucleotide sequence can have an "endogenous" counterpart with the same base composition, but wherein the "exogenous" sequence is, for example, introduced into a cell via recombinant DNA technology.

[0100] As used herein, the term "heterologous" refers to a polypeptide that is not derived from a specific cell, but rather a corresponding encoding nucleic acid has been introduced into the cell by a DNA delivery method (e.g., by a transfection method, an electroporation method, or a transformation method). Thus, a heterologous polypeptide is a polypeptide that is artificial to the cell expressing it, irrespective of whether the polypeptide is a naturally occurring polypeptide derived from a different cell / organism or a synthetic polypeptide.

[0101] The term "sirtuin-1" refers to an enzyme that is part of signal transduction in mammals, namely the NAD-dependent deacetylase sirtuin-1. Sirtuin-1 is encoded by the SIRT-1 gene. Chinese hamster sirtuin-1 has the UniProtKB entry A0A3L7IF96. The effects of inactivating the SIRT-1 gene have been described in WO 2020 / 260327, which is expressly incorporated herein by reference.

[0102] The term "myc proto-oncogene protein" refers to a regulatory gene family encoding transcription factors. The family includes proteins c-myc (encoded by the MYC gene), l-myc (encoded by the MYCL gene) and n-myc (encoded by the MYCN gene). The genomic location of the Chinese hamster myc proto-oncogene protein in the CHO genome (PICR genome) (see https: / / www.ncbi.nlm.nih.gov / assembly / GCF_003668045.3 / ) is RAZU01000002.1 (8,114,040-8,118,048). The effect of MYC inactivation has been described in WO 2022 / 063877, which is expressly incorporated herein by reference.

[0103] The term "bcl-2-related X protein" refers to the pro-apoptotic Bcl-2 family member encoded by the BAX gene (also known as Bcl214).

[0104] The term "bcl-2 homologous antagonist / killer" refers to the pro-apoptotic Bcl-2 family member encoded by the BAK gene (also known as BCL2 antagonist / killer 1, Bacl, Cdnl, Bcl2l7, and Bak-like).

[0105] The effects of inactivation of the BAX and BAK genes have been described in WO 2009 / 151591, which is expressly incorporated herein by reference.

[0106] The term "intercellular adhesion molecule 1" denotes a cell surface glycoprotein. Its binding partner is an integrin of the CD11a / CD18 or CD11b / CD18 type. It is also known as CD54 (cluster of differentiation 54). In humans, it is encoded by the ICAM-1 gene.

[0107] As used herein, the term "activity" with respect to protein activity refers to any activity of a protein, including but not limited to enzymatic activity, ligand binding, drug transport, ion transport, protein localization, receptor binding and / or structural activity. Such activity can be regulated by reducing or eliminating the expression of the protein, such as reducing or eliminating, thereby reducing or eliminating the presence of the protein. Such activity can also be regulated by altering the nucleic acid sequence encoding the protein, such as reducing or eliminating, such that the resulting modified protein exhibits reduced or eliminated activity relative to the wild-type protein.

[0108] As used herein, the term "expression" refers to transcription and translation occurring in a host cell. The expression level of a product gene in a host cell can be determined based on the amount of the corresponding mRNA present in the cell or the amount of the protein encoded by the product gene produced by the cell. For example, the mRNA transcribed from the product gene is ideally quantified by northern hybridization. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 7.3-7.57 (Cold Spring Harbor Laboratory Press, 1989). The protein encoded by the product gene can be quantified by a variety of methods, for example, by measuring the biological activity of the protein or by adopting a determination unrelated to this activity such as Western blotting or radioimmunoassay using an antibody that can react with the protein. Sambrook et al., Molecular Cloning: A Laboratory Manual, pp. 18.1-18.88 (Cold Spring Harbor Laboratory Press, 1989). When reference is made to reducing and / or eliminating the expression of one or more endogenous genes relative to the expression of the endogenous gene in an unmodified cell, such reduction and / or elimination of expression includes reducing and / or eliminating active endogenous genes, notwithstanding the presence of mRNA encoding all or part of the endogenous gene or the presence of endogenous protein translated from such mRNA.

[0109] II. Antibodies

[0110] General information on the nucleotide sequences of human immunoglobulin light and heavy chains is given in: Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th Edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991).

[0111] The term "antibody" herein is used in the broadest sense and encompasses various antibody structures, including but not limited to full length antibodies, monoclonal antibodies, multispecific antibodies (eg, bispecific antibodies), and antibody-antibody fragment fusions and combinations thereof.

[0112] The term "natural antibody" refers to naturally occurring immunoglobulin molecules with different structures. For example, a natural IgG antibody is a heterotetrameric glycoprotein of about 150,000 daltons, consisting of two identical light chains and two identical heavy chains bonded by disulfide bonds. From the N-terminus to the C-terminus, each heavy chain has a heavy chain variable region (VH), followed by three heavy chain constant domains (CH1, CH2 and CH3), whereby the hinge region is positioned between the first heavy chain constant domain and the second heavy chain constant domain. Similarly, from the N-terminus to the C-terminus, each light chain has a light chain variable region (VL), followed by a light chain constant domain (CL). The light chain of an antibody can be classified into one of two types based on the amino acid sequence of its constant domain, which are called kappa (κ) and lambda (λ).

[0113] The term "full-length antibody" refers to an antibody having a structure substantially similar to that of a natural antibody. A full-length antibody comprises two full-length antibody light chains and two full-length antibody heavy chains, each full-length antibody light chain comprising a light chain variable region and a light chain constant domain in the N-terminal to C-terminal direction, and each full-length antibody heavy chain comprising a heavy chain variable region, a first heavy chain constant domain, a hinge region, a second heavy chain constant domain, and a third heavy chain constant domain in the N-terminal to C-terminal direction. In contrast to natural antibodies, a full-length antibody may comprise additional immunoglobulin domains, such as one or more additional scFvs or heavy or light chain Fab fragments or scFabs conjugated to one or more ends of different chains of a full-length antibody, but each end is only conjugated to a single fragment. These conjugates are also covered by the term full-length antibody.

[0114] The "class" of an antibody refers to the type of constant domain or constant region (preferably Fc region) possessed by the heavy chain of the antibody. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and some of them can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively.

[0115] The term "heavy chain constant region" refers to the region containing constant domains in the immunoglobulin heavy chain, i.e., CH1 structure, hinge region, CH2 domain and CH3 domain. In certain embodiments, the human IgG constant region extends from Ala118 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). However, the C-terminal lysine (Lys447) of the constant region may be present or absent (numbered according to the Kabat EU index). The term "constant region" refers to a dimer comprising two heavy chain constant regions, which can be covalently linked to each other via hinge region cysteine ​​residues to form an interchain disulfide bond.

[0116] The term "heavy chain Fc region" refers to the C-terminal region of an immunoglobulin heavy chain, which contains at least a portion of a hinge region (middle and lower hinge region), a CH2 domain, and a CH3 domain. In certain embodiments, the human IgG heavy chain Fc region extends from Asp221 or from Cys226 or from Pro230 to the carboxyl terminus of the heavy chain (numbered according to the Kabat EU index). Therefore, the Fc region is smaller than the constant region, but is substantially the same as the C-terminal portion. However, the C-terminal lysine (Lys447) in the heavy chain Fc region may be present or absent (numbered according to the Kabat EU index). The term "Fc region" refers to a dimer comprising two heavy chain Fc regions, which may be covalently linked to each other by hinge region cysteine ​​residues to form an interchain disulfide bond.

[0117] The constant region of an antibody, more precisely the Fc region (and this is also true for the constant region), is directly involved in complement activation, C1q binding, C3 activation and Fc receptor binding. Although the effect of an antibody on the complement system depends on certain conditions, binding to C1q is caused by a defined binding site in the Fc region. Such binding sites are known in the prior art and are described, for example, by Lukas, TJ et al., J. Immunol. 127 (1981) 2555-2560; Brunhouse, R. and Cebra, JJ, Mol. Immunol. 16 (1979) 907-917; Burton, DR et al., Nature 288 (1980) 338-344; Thommesen, JE et al., Mol. Immunol. 37 (2000) 995-1004; Idusogie, EE et al., J. Immunol. 164 (2000) 4178-4184; Hezareh, M. et al., J. Virol. 75 (2001) 12161-12168; Morgan, A. et al., Immunology 86 (1995) 319-324; and EP 0 307 434. Such binding sites are, for example, L234, L235, D270, N297, E318, K320, K322, P331 and P329 (numbering according to the Kabat EU index). Antibodies of the subclasses IgG1, IgG2 and IgG3 generally exhibit complement activation, C1q binding and C3 activation, whereas IgG4 does not activate the complement system, does not bind C1q and does not activate C3.

[0118] "Fc region of an antibody" is a term well known to skilled artisans, and is defined based on the cleavage of an antibody by papain.

[0119] The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous antibody population, that is, except for possible variant antibodies (e.g., containing naturally occurring mutations or produced during the production of monoclonal antibody preparations, such variants are usually presented in small amounts), each antibody comprising the population is identical and / or binds to the same epitope. Contrary to polyclonal antibody preparations that typically include different antibodies for different determinants (epitopes), each monoclonal antibody in a monoclonal antibody preparation is directed to a single determinant on an antigen. Therefore, the modifier "monoclonal" indicates that the characteristic of an antibody is obtained from a substantially homogeneous antibody population, and should not be interpreted as requiring antibodies to be produced by any particular method. For example, monoclonal antibodies can be prepared by a variety of techniques, including but not limited to hybridoma methods, recombinant DNA methods, phage display methods, and methods utilizing transgenic animals comprising all or part of a human immunoglobulin locus.

[0120] The term "valency" as used in this application indicates the presence of a specified number of binding sites in an antibody. Thus, the terms "bivalent", "tetravalent", and "hexavalent" indicate the presence of two binding sites, four binding sites, and six binding sites in an antibody, respectively.

[0121] "Monospecific antibody" refers to an antibody with a single binding specificity, i.e., specifically binding to one antigen. Monospecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2) or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Monospecific antibodies do not need to be monovalent, i.e., monospecific antibodies may contain more than one binding site that specifically binds to one antigen. For example, natural antibodies are monospecific but bivalent.

[0122] "Multispecific antibody" means having binding specificity for at least two different epitopes or two different antigens on the same antigen. Multispecific antibodies can be prepared as full-length antibodies or antibody fragments (e.g., F(ab')2 bispecific antibodies) or combinations thereof (e.g., full-length antibodies plus additional scFv or Fab fragments). Multispecific antibodies are at least bivalent, i.e., contain two antigen binding sites. In addition, multispecific antibodies are at least bispecific. Therefore, bivalent bispecific antibodies are the simplest form of multispecific antibodies. Engineered antibodies with two, three or more (e.g., four) functional antigen binding sites have also been reported (see, e.g., US2002 / 0004587).

[0123] In certain embodiments of all aspects and embodiments of the subject matter of the present invention, cells according to the present invention express antibodies. In certain embodiments, the antibody is a multispecific antibody, such as at least a bispecific antibody. In certain embodiments, one of the binding specificities is directed to a first antigen, and the other is directed to a different second antigen. In certain embodiments, the multispecific antibody can bind to two different epitopes of the same antigen. Multispecific antibodies can also be used to localize cytotoxic agents to cells expressing one or more antigens.

[0124] Multispecific antibodies can be prepared as full-length antibodies or antibody-antibody fragment fusions.

[0125] Techniques for making multispecific antibodies include, but are not limited to, recombinant co-expression of two immunoglobulin heavy chain-light chain pairs of different specificities (see Milstein, C. and Cuello, AC, Nature 305 (1983) 537-540, WO 93 / 08829, and Traunecker, A. et al., EMBO J. 10 (1991) 3655-3659) and “knob-in-hole” engineering (see, e.g., US 5,731,168). Multispecific antibodies can also be prepared by engineering electrostatic manipulation effects for preparing antibody Fc-heterodimer molecules (see, e.g., WO 2009 / 089004); cross-linking two or more antibodies or fragments (see, e.g., US 4,676,980, and Brennan, M. et al., Science, 229 (1985) 81-83); using leucine zippers to produce bispecific antibodies (see, e.g., Kostelny, S. A. et al., J. Immunol. 148 (1992) 1547-1553); using common light chain technology to avoid light chain mispairing problems (see, e.g., WO 98 / 50431); using specific techniques for preparing bispecific antibody fragments (see, e.g., Holliger, P. et al., Proc. Natl. Acad. Sci. USA 90 (1993) 6444-6448); and trispecific antibodies were prepared as described in Tutt, A. et al., J. Immunol. 147 (1991) 60-69.

[0126] Also included herein are engineered antibodies with three or more antigen binding sites, including, for example, "octopus antibodies" or DVD-Ig (see, for example, WO 2001 / 77342 and WO 2008 / 024715). Other examples of multispecific antibodies with three or more antigen binding sites can be found in WO 2010 / 115589, WO 2010 / 112193, WO 2010 / 136172, WO 2010 / 145792 and WO 2013 / 026831. Bispecific antibodies or their antigen-binding fragments also include "double-acting Fab" or "DAF" (see, for example, US2008 / 0069820 and WO 2015 / 095539).

[0127] Multispecific antibodies can also be provided in an asymmetric format with domain crossing, i.e. by exchanging VH / VL domains (see, e.g., WO 2009 / 080252 and WO 2015 / 150447), CH1 / CL domains (see, e.g., WO 2009 / 080253) or complete Fab arms (see, e.g., WO 2009 / 080251, WO 2016 / 016299, see also Schaefer et al., Proc. Natl. Acad. Sci. USA 108 (2011) 1187-1191, and Klein et al., MAbs 8 (2016) 1010-1020) in one or more binding arms with the same antigen specificity. In certain embodiments of all aspects and embodiments of the invention, the cell according to the invention expresses a multispecific antibody comprising a Cross-Fab fragment. The term "Cross-Fab fragment" means a Fab fragment in which the variable or constant regions of the heavy and light chains are exchanged. The cross-Fab fragment contains a polypeptide chain consisting of a light chain variable region (VL) and a heavy chain constant region 1 (CH1), and a polypeptide chain consisting of a heavy chain variable region (VH) and a light chain constant region (CL). Asymmetric Fab arms can also be engineered by introducing charged or uncharged amino acid mutations into the domain interface to guide the correct pairing of Fab heavy chain fragments and cognate light chains. See, for example, WO2016 / 172485.

[0128] The antibody or fragment may also be a multispecific antibody as described in WO 2009 / 080254, WO 2010 / 112193, WO 2010 / 115589, WO 2010 / 136172, WO 2010 / 145792, or WO 2010 / 145793.

[0129] The antibody or fragment thereof may also be a multispecific antibody as disclosed in WO 2012 / 163520.

[0130] Various other molecular formats of multispecific antibodies are known in the art and can be produced using the cells according to the invention (see, for example, Spiess et al., Mol. Immunol. 67 (2015) 95-106).

[0131] Bispecific antibodies are generally antibody molecules that specifically bind to two different, non-overlapping epitopes on the same antigen or to two epitopes on different antigens.

[0132] In a preferred embodiment of all aspects and embodiments, the cell according to the invention expresses a composite (multispecific) antibody selected from the group of (composite) (multispecific) antibodies consisting of:

[0133] Full-length antibodies with domain swapping

[0134] (i.e., a multispecific IgG antibody comprising a first Fab fragment and a second Fab fragment, wherein in the first Fab fragment

[0135] a) only the CH1 domain and the CL domain are replaced with each other (i.e., the light chain of the first Fab fragment comprises the VL domain and the CH1 domain, and the heavy chain of the first Fab fragment comprises the VH domain and the CL domain); b) only the VH domain and the VL domain are replaced with each other (i.e., the light chain of the first Fab fragment comprises the VH domain and the CL domain, and the heavy chain of the first Fab fragment comprises the VL domain and the CH1 domain); or

[0136] c) the CH1 and CL domains are replaced with each other and the VH and VL domains are replaced with each other (i.e. the light chain of the first Fab fragment comprises the VH and CH1 domains, and the heavy chain of the first Fab fragment comprises the VL and CL domains); and

[0137] The second Fab fragment comprises a light chain and a heavy chain, the light chain comprises a VL and a CL domain, and the heavy chain comprises a VH and a CH1 domain;

[0138] The full length antibody with domain exchange may comprise a first heavy chain comprising a CH3 domain and a second heavy chain comprising a CH3 domain, wherein the two CH3 domains are engineered in a complementary manner by respective amino acid substitutions so as to support heterodimerization of the first heavy chain with the modified second heavy chain, e.g., as disclosed in WO 96 / 27011, WO 98 / 050431, EP 1870459, WO 2007 / 110205, WO 2007 / 147901, WO 2009 / 089004, WO 2010 / 129304, WO 2011 / 90754, WO 2011 / 143545, WO 2012 / 058768, WO 2013 / 157954 or WO 2013 / 096291 (incorporated herein by reference);

[0139] Full-length antibody with domain swapping and additional heavy chain C-terminal binding site (BS)

[0140] (i.e., a multispecific IgG antibody comprising

[0141] a) a full-length antibody comprising two pairs each of a full-length antibody light chain and a full-length antibody heavy chain, wherein the binding site formed by each of the pairs of full-length heavy chain and full-length light chain specifically binds to a first antigen, and

[0142] b) an additional Fab fragment, wherein the additional Fab fragment is fused to the C-terminus of one heavy chain of the full-length antibody, wherein the binding site of the additional Fab fragment specifically binds to a second antigen,

[0143] wherein the additional Fab fragment that specifically binds to a second antigen i) comprises a domain crossover such that a) the light chain variable domain (VL) and the heavy chain variable domain (VH) are replaced with each other, or b) the light chain constant domain (CL) and the heavy chain constant domain (CH1) are replaced with each other, or ii) is a single chain Fab fragment;

[0144] One-armed single-chain antibody

[0145] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0146] -Light chain (variable light chain domain + light chain kappa constant domain)

[0147] - Combined light chain / heavy chain (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation)

[0148] -Heavy chain (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation); two-armed single-chain antibody

[0149] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0150] - Combined light chain / heavy chain 1 (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation)

[0151] - Combined light chain / heavy chain 2 (variable light chain domain + light chain constant domain + peptide linker + variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation));

[0152] Common light chain bispecific antibodies

[0153] (i.e., an antibody comprising a first binding site that specifically binds to a first epitope or antigen and a second binding site that specifically binds to a second epitope or antigen, wherein the individual chains are as follows

[0154] -Light chain (variable light chain domain + light chain constant domain)

[0155] -Heavy chain 1 (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with hole mutation)

[0156] - Heavy chain 2 (variable heavy chain domain + CH1 + hinge + CH2 + CH3 with knob mutation));

[0157] T cell bispecific antibodies (TCB)

[0158] (i.e., a full-length antibody having: an additional heavy chain N-terminal binding site with domain swapping, comprising

[0159] - a first Fab fragment and a second Fab fragment, wherein each binding site of the first Fab fragment and the second Fab fragment specifically binds to a first antigen,

[0160] - a third Fab fragment, wherein the binding site of the third Fab fragment specifically binds to the second antigen, and wherein the third Fab fragment comprises a domain crossover such that the variable light chain domain (VL) and the variable heavy chain domain (VH) are replaced with each other, and

[0161] - an Fc region comprising a first Fc region polypeptide and a second Fc region polypeptide,

[0162] wherein the first Fab fragment and the second Fab fragment each comprise a heavy chain fragment and a full-length light chain,

[0163] wherein the C-terminus of the heavy chain fragment of the first Fab fragment is fused to the N-terminus of the first Fc region polypeptide,

[0164] wherein the C-terminus of the heavy chain fragment of the second Fab fragment is fused to the N-terminus of the variable light chain domain of the third Fab fragment, and the C-terminus of the CH1 domain of the third Fab fragment is fused to the N-terminus of the second Fc region polypeptide);

[0165] Antibody-polymer fusion

[0166] (i.e., a multimeric fusion protein comprising

[0167] (a) an antibody heavy chain and an antibody light chain, and

[0168] (b) a first fusion polypeptide comprising, in the N-terminal to C-terminal direction, a first portion of a non-antibody multimeric polypeptide, an antibody heavy chain CH1 domain or an antibody light chain constant domain, an antibody hinge region, an antibody heavy chain CH2 domain, and an antibody heavy chain CH3 domain; and a second fusion polypeptide comprising, in the N-terminal to C-terminal direction, a second portion of the non-antibody multimeric polypeptide and, in the case where the first polypeptide comprises an antibody heavy chain CH1 domain, an antibody light chain constant domain, or in the case where the first polypeptide comprises an antibody light chain constant domain, an antibody heavy chain CH1 domain,

[0169] in

[0170] (i) the antibody heavy chain of (a) and the first fusion polypeptide of (b), (ii) the antibody heavy chain of (a) and the antibody light chain of (a), and (iii) the first fusion polypeptide of (b) and the second fusion polypeptide of (b) are each independently covalently linked to each other via at least one disulfide bond,

[0171] in

[0172] The variable domains of the antibody heavy chain and antibody light chain form a binding site that specifically binds to an antigen).

[0173] "Knob-in-hole" dimerization modules and their use in antibody engineering are described in Carter P., Ridgway JBB, Presta LG: Immunotechnology, Vol. 2, No. 1, February 1996, pp. 73-73(1).

[0174] The CH3 domain in the antibody heavy chain can be altered by the "knob-into-holes" technology, which is described in detail with several examples in, for example, WO 96 / 027011, Ridgway, JB et al., Protein Eng. 9 (1996) 617-621 and Merchant, AM et al., Nat. Biotechnol. 16 (1998) 677-681. In this method, the interaction surfaces of the two CH3 domains are altered to increase the heterodimerization of the two CH3 domains and thereby increase the heterodimerization of the polypeptides containing them. One of the two CH3 domains (of the two heavy chains) can be a "knob" and the other a "hole". The introduction of disulfide bridges further stabilizes the heterodimers (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681; Atwell, S. et al., J. Mol. Biol. 270 (1997) 26-35) and increases the yield.

[0175] The mutation T366W in the CH3 domain (of the antibody heavy chain) is denoted as a "knob mutation" or "mutated knob", while the mutations T366S, L368A, Y407V in the CH3 domain (of the antibody heavy chain) are denoted as "hole mutations" or "mutated hole" (numbering according to the Kabat EU index). Additional interchain disulfide bridges located between the CH3 domains can also be used by introducing the S354C mutation into the CH3 domain of the heavy chain with a "knob mutation" (denoted as "knob-cys-mutation" or "mutated knob-cys") or by introducing the Y349C mutation into the CH3 domain of the heavy chain with a "hole mutation" (denoted as "hole-cys-mutation" or "mutated hole-cys") (numbering according to the Kabat EU index) (Merchant, AM et al., Nature Biotech. 16 (1998) 677-681).

[0176] As used herein, the term "domain crossing" means that in an antibody heavy chain VH-CH1 fragment and its corresponding cognate antibody light chain pair, i.e. in an antibody Fab (fragment antigen binding), the domain sequence deviates from the sequence in a native antibody in that at least one heavy chain domain is replaced by its corresponding light chain domain, or vice versa. There are three general types of domain crossings: (i) crossings of CH1 and CL domains, which results from domain crossings in the light chain to produce a VL-CH1 domain sequence, and from domain crossings in the heavy chain fragment to produce a VH-CL domain sequence (or a full-length antibody heavy chain having a VH-CL-hinge-CH2-CH3 domain sequence); (ii) domain crossings of VH and VL domains, which results from domain crossings in the light chain to produce a VH-CL domain sequence, and from domain crossings in the heavy chain fragment to produce a VL-CH1 domain sequence; and (iii) domain crossings of a complete light chain (VL-CL) and a complete VH-CH1 heavy chain fragment ("Fab crossing"), which results from domain crossings to produce a light chain having a VH-CH1 domain sequence, and from domain crossings to produce a heavy chain fragment having a VL-CL domain sequence (all of the aforementioned domain sequences are presented in the N-terminal to C-terminal direction).

[0177] As used herein, the term "replacement of one another" with respect to the corresponding heavy chain domain and light chain domain refers to the aforementioned domain intersection. Thus, when the CH1 domain and the CL domain "replacement of one another", it refers to the domain intersection mentioned under item (i) and the resulting heavy chain and light chain domain sequences. Thus, when VH and VL "replacement of one another", it refers to the domain intersection mentioned in item (ii); and when the CH1 and CL domains "replacement of one another" and the VH and VL domains "replacement of one another", it refers to the domain intersection mentioned in item (iii). For example, bispecific antibodies comprising domain exchange are reported in WO 2009 / 080251, WO 2009 / 080252, WO 2009 / 080253, WO 2009 / 080254 and Schaefer, W. et al., Proc. Natl. Acad. Sci USA 108 (2011) 11187-11192. Such antibodies are often referred to as CrossMab.

[0178] In a preferred embodiment of all aspects and embodiments of the present invention, the cell according to the present invention expresses a multispecific antibody, the multispecific antibody comprising at least one Fab fragment, the Fab fragment comprising a domain intersection of CH1 and CL domains, or a domain intersection of VH and VL domains, or a domain intersection of VH-CH1 and VL-VL domains. In a multispecific antibody with domain intersection, Fabs that specifically bind to the same antigen are constructed to have the same domain sequence. Therefore, in the case where more than one Fab with domain intersection is included in the multispecific antibody, the Fabs specifically bind to the same antigen.

[0179] A "humanized" antibody refers to an antibody comprising amino acid residues from non-human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will substantially comprise at least one variable domain, typically two variable domains, wherein all or substantially all HVRs (e.g., CDRs) correspond to HVRs of non-human antibodies, and all or substantially all FRs correspond to FRs of human antibodies. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. An antibody in "humanized form," such as a non-human antibody, refers to an antibody that has undergone humanization.

[0180] As used herein, the term "recombinant antibody" refers to all antibodies (chimeric, humanized and human antibodies) prepared, expressed, created or isolated by recombinant means, such as using cells according to the invention. This includes antibodies isolated from recombinant cells, such as NS0, HEK, BHK, amniocytes or CHO cells modified according to the invention.

[0181] As used herein, the term "antibody fragment" refers to a molecule other than an intact antibody, which comprises a portion of an intact antibody and binds to the same epitope on the same antigen as the intact antibody, i.e., it is a functional fragment. Examples of antibody fragments include, but are not limited to, Fv; Fab; Fab'; Fab'-SH; F(ab')2; bispecific Fab, diabody, linear antibody, single-chain antibody molecule (e.g., scFv or scFab).

[0182] III. Recombinant Methods and Compositions

[0183] In one aspect of the invention, a method for preparing a polypeptide or protein using a cell according to the invention is provided. The method comprises the following steps: culturing a cell according to the invention comprising one or more nucleic acids encoding a polypeptide or protein under conditions suitable for expressing the polypeptide or protein, and recovering the polypeptide or protein from the cell (or cell culture medium), and optionally purifying the polypeptide or protein with one or more chromatography steps.

[0184] Antibodies can be produced using recombinant methods and compositions, for example, as described in US 4,816,567. For these methods, one or more isolated nucleic acids encoding the antibodies are provided.

[0185] In one aspect of the invention, a method for preparing an antibody is provided, wherein the method comprises culturing a cell according to the invention comprising one or more nucleic acids encoding the antibody under conditions suitable for expression of the antibody, and optionally recovering the antibody from the cell (or cell culture medium).

[0186] For recombinant production of polypeptide or protein, such as, for example, antibody, nucleic acid encoding polypeptide or protein is separated and inserted into one or more vectors for further cloning and / or expression in cells according to the present invention. Conventional procedures can be used to easily separate and sequence-check such nucleic acids (e.g., by using oligonucleotide probes that can be specifically bound to the heavy chain and light chain of the encoding antibody), or to produce such nucleic acids by recombinant methods or by chemical synthesis.

[0187] Generally speaking, for the recombinant large-scale production of a target polypeptide or protein (such as, for example, a therapeutic antibody), cells that stably express and secrete the polypeptide or protein are required. Such cells are referred to as "recombinant cells" or "recombinant production cells," and the process for producing such cells is referred to as "cell line development."

[0188] In the first step of the cell line development process, a suitable host cell (such as, for example, a CHO cell modified according to the present invention) is transfected with a nucleic acid sequence suitable for expressing the target polypeptide or protein. In the second step, based on the co-expression of a selection marker co-transfected with a nucleic acid encoding the target polypeptide or protein, cells that stably express the target polypeptide or protein are selected.

[0189] The nucleic acid (i.e., coding sequence) encoding the polypeptide is represented as a structural gene. Such a structural gene is pure coding information. Therefore, additional regulatory elements are required for its expression. Therefore, the structural gene is usually integrated in a so-called expression cassette. The minimum regulatory elements required for the expression cassette to work in mammalian cells are a promoter that works in the mammalian cell, which is located upstream of the structural gene, i.e., 5', and a polyadenylation signal sequence that works in the mammalian cell, which is located downstream of the structural gene, i.e., 3'. The promoter, structural gene, and polyadenylation signal sequence are arranged in an operably linked form.

[0190] In the case where the polypeptide of interest is a heteromultimeric protein composed of different (monomeric) polypeptides (such as, for example, an antibody or a composite antibody format), not only a single expression cassette is required, but a plurality of expression cassettes that differ from each other in the structural genes contained, i.e., at least one expression cassette is required for each of the different (monomeric) polypeptides of the heteromultimeric protein.

[0191] For example, a full-length antibody is a heteromultimeric protein comprising two copies of a light chain and two copies of a heavy chain. Therefore, a full-length antibody is composed of two different polypeptides. Therefore, the expression of a full-length antibody requires two expression cassettes, one for the light chain and the other for the heavy chain. For example, if the full-length antibody is a bispecific antibody, i.e., the antibody comprises two different binding sites that specifically bind to two different antigens, then the two light chains and the two heavy chains are also different from each other. Therefore, this bispecific full-length antibody is composed of four different polypeptides, and therefore requires four expression cassettes.

[0192] The expression cassette of the target polypeptide or protein is then integrated into one or more so-called "expression vectors". An "expression vector" is a nucleic acid that provides all the necessary elements required for amplifying the vector in prokaryotic cells and for expressing the contained structural genes in mammalian cells. Typically, an expression vector comprises a prokaryotic plasmid propagation unit, such as a prokaryotic plasmid propagation unit for Escherichia coli, which comprises an origin of replication and a prokaryotic selection marker, as well as a eukaryotic selection marker, and further expression cassettes required for expressing the target structural gene. An "expression vector" is a transport vehicle for introducing an expression cassette into a modified mammalian cell according to the present invention.

[0193] As outlined in the previous paragraph, the more complex the target polypeptide or protein is, the higher the number of different expression cassettes required is. Inherently, as the number of expression cassettes increases, the total size (i.e., the number of base pairs) of the nucleic acid integrated into the host cell genome also increases. The size of the expression vector also increases therewith. However, the actual upper limit of the vector size is within the range of about 15kbp, beyond which the processing and processing efficiency significantly decreases. This problem can be solved by using two or more expression vectors. Therefore, the expression cassette is divided into different expression vectors, each of which contains only some of the expression cassettes, so that the size (bp number) of each vector is reduced.

[0194] Cell line development (CLD) for generating recombinant cells expressing heterologous polypeptides or proteins (such as, for example, multispecific antibodies) employs randomly integrated (RI) or targeted integrated (TI) nucleic acids comprising the corresponding expression cassettes required for the expression and production of the heterologous polypeptide or protein of interest.

[0195] Using RI, generally, several vectors or fragments thereof are integrated into the genome of the cell at the same or different loci.

[0196] Typically, using TI, a single copy of a transgene containing different expression cassettes is integrated into a predetermined "hotspot" in the host cell genome.

[0197] Suitable host cells for the expression of (glycosylated) polypeptides or proteins, such as antibodies, are generally derived from multicellular organisms, such as, for example, vertebrates.

[0198] IV. Host Cells

[0199] Any mammalian cell can be modified according to the present invention. Such application of the modification according to the present invention is independent of whether the cell is an adherent growing cell or a suspension growing cell and the integration method (ie for RI as well as TI). Any mammalian cell can be used in the present invention.

[0200] Examples of mammalian cells that can be modified according to the invention are human amniocytes (e.g., CAP-T cells as described in Woelfel, J. et al., BMC Proc. 5 (2011) P133); monkey kidney cells (CV1); monkey kidney CV1 cells transformed by SV40 (COS-7); human embryonic kidney cells (e.g., HEK293 or HEK293T cells as described in Graham, FL et al., J. Gen Virol. 36 (1977) 59-74); miniature hamster kidney cells (BHK); mouse Sertoli cells (e.g., TM4 cells described in Mather, JP, Biol. Reprod. 23 (1980) 243-252); African green monkey kidney cells (VERO-76); human cervical carcinoma cells (HELA); canine kidney cells (MDCK); Buffalo rat hepatocytes (BRL 3A); human lung cells (W138); human liver cells (Hep G2); mouse mammary tumor cells (MMT 060562); TRI cells (as described, for example, in Mather, JP et al., Annals NY Acad. Sci. 383 (1982) 44-68); MRC 5 cells; and FS4 cells.

[0201] Particularly useful mammalian cells to be modified according to the present invention include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells (Urlaub, G. et al., Proc. Natl. Acad. Sci. USA 77 (1980) 4216-4220); and myeloma cells, such as Y0, NS0 and Sp2 / 0. For a review of certain mammalian host cell lines suitable for antibody production, see, for example, Yazaki, P. and Wu, AM, Methods in Molecular Biology, Vol. 248, Lo, BKC (ed.), Humana Press, Totowa, NJ (2004), pp. 255-268.

[0202] In certain embodiments of all aspects and embodiments of the invention, the mammalian cell modified according to the invention or used in the method or use according to the invention is a Chinese hamster ovary (CHO) cell (e.g., CHO K1, CHO DG44, etc.), a human embryonic kidney (HEK) cell, a lymphoid cell (e.g., Y0, NS0, Sp2 / 0 cell), or a human amniotic fluid cell (e.g., CAP-T, etc.). In one embodiment, the mammalian cell modified according to the invention or used in the method according to the invention is a CHO cell or a HEK cell.

[0203] In certain embodiments, the present invention relates to modified mammalian cells (e.g., CHO cells) in which the expression of one or more endogenous products (e.g., host cell proteins) of unmodified mammalian cells is reduced or eliminated. For example, but not limited to, methods for reducing or eliminating the expression of endogenous products in mammalian cells include: (1) modifying genes encoding endogenous products or components thereof, for example by introducing deletions, insertions, substitutions, or a combination thereof into the gene; (2) reducing or eliminating the transcription and / or stability of mRNA encoding endogenous products or components thereof; and (3) reducing or eliminating the translation of mRNA encoding endogenous products or components thereof. In a preferred embodiment, the reduction or elimination of protein expression is obtained by targeted genome editing. For example, CRISPR / Cas9-based genome editing can be used to modify one or more target genes, thereby reducing or eliminating the expression of one (or more) genes targeted for editing.

[0204] In certain embodiments, one or more targeted mammalian cell endogenous products of expression reduced or eliminated are selected based on their role in promoting apoptosis. Since apoptosis can reduce culture vigor and productivity, reducing or eliminating the expression of such proteins can have a positive impact on culture vigor and productivity production. For example, but not limited to, the mammalian cell protein selected based on its role in promoting apoptosis is BCL2-related X, apoptosis regulator (BAX) or BCL2 antagonist / killer factor 1 (BAK). In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of BAX. In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of BAK. In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of BAK and BAK.

[0205] In certain embodiments, the mammalian cell endogenous product of expression targeted for reduction or elimination is selected based on its effect of promoting coagulation and / or aggregation during cell culture. When mammalian cells are used to produce the recombinant product of interest, such coagulation and / or aggregation during cell culture can lead to a reduction in product titer due to the negative impact of coagulation and / or aggregation on the viability of mammalian cells. For example, but not limited to, the mammalian cell endogenous product selected based on its effect of promoting coagulation and / or aggregation during cell culture is intercellular adhesion molecule 1 (ICAM-1). In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1.

[0206] In certain embodiments, one or more targeted mammalian cell endogenous products of expression reduced or eliminated are selected based on their role in promoting inefficient cell growth. Mammalian cells express many endogenous products that are not essential for cell growth, survival and / or productivity. Since the expression of these endogenous products consumes a large amount of cellular energy and DNA / protein structural units, reducing or eliminating the expression of such endogenous products can make cell growth more efficient, and in the case where cells are used to produce the purpose recombinant product, those cell sources can be transformed to achieve the higher productivity of the purpose recombinant product. For example, but not limited to, the mammalian cell endogenous products selected based on their role in promoting effective cell growth and the higher productivity of the target recombinant product are BAX, BAK, ICAM-1, Sirtuin 1 (SIRT-1) or MYC proto-oncogene, BHLH transcription factor (MYC). In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of SIRT-1. In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of MYC. In certain embodiments, the mammalian cells of the present invention show the expression of reduction or elimination of SIRT-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1 and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1 and SIRT-1. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, SIRT-1, and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAK, SIRT-1, and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of ICAM-1, SIRT-1, and MYC. In certain embodiments, the mammalian cells of the present invention exhibit reduced or eliminated expression of BAX, BAK, SIRT-1, and MYC. In certain embodiments, the mammalian cells of the invention exhibit reduced or eliminated expression of BAX, ICAM-1, SIRT-1, and MYC. In certain embodiments, the mammalian cells of the invention exhibit reduced or eliminated expression of BAK, ICAM-1, SIRT-1, and MYC.In certain embodiments, the mammalian cells of the invention exhibit reduced or eliminated expression of BAX, BAK, MYC, SIRT-1, and ICAM.

[0207] In certain embodiments, the host cells of the present invention are modified to reduce or eliminate the expression of one or more host cell endogenous products relative to the expression of the host cell endogenous products in an unmodified (ie, "reference") host cell. Such a "reference" host cell has the same genotype as the modified cell, except for the gene expressing the endogenous product. In certain embodiments, the reference host cell is a host cell in which the expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) is not reduced or eliminated. In certain embodiments, the reference host cell is a cell comprising at least one or two wild-type alleles of genes encoding BAX; BAK; ICAM-1; SIRT-1; and / or MYC. For example, but not limited to, the reference host cell is a host cell having two wild-type alleles of genes encoding BAX; BAK; ICAM-1; SIRT-1; and / or MYC. In certain embodiments, the reference host cell is a wild-type (WT) host cell. In certain embodiments, the modification of reducing or eliminating the expression of one or more host cell endogenous products is carried out before the introduction of the exogenous nucleic acid encoding the recombinant product of interest. In certain embodiments, the modification of reducing or eliminating the expression of one or more host cell endogenous products is carried out after the introduction of the exogenous nucleic acid encoding the recombinant product of interest.

[0208] In certain embodiments, the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2% or less than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell). In certain embodiments, the expression of one or more endogenous products in a cell that has been modified to reduce or eliminate expression of the endogenous product is less than about 90%, less than about 80%, less than about 70%, less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, less than about 10%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0209] In certain embodiments, the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a host cell that has been modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the corresponding endogenous product in a reference host cell (e.g., a WT host cell). In certain embodiments, the expression of one or more endogenous products in a host cell that has been modified to reduce or eliminate expression of the endogenous product is at least about 90%, at least about 80%, at least about 70%, at least about 60%, at least about 50%, at least about 40%, at least about 30%, at least about 20%, at least about 10%, at least about 5%, at least about 4%, at least about 3%, at least about 2%, or at least about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT mammalian cell).

[0210] In certain embodiments, expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) in a cell that has been modified to reduce or eliminate expression of the endogenous product is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, or no more than about 1% of the expression of the corresponding endogenous product in a reference host cell (e.g., a WT host cell). In certain embodiments, expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) in a cell that has been modified to reduce or eliminate expression of the endogenous product is no more than about 40% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT mammalian cell). In certain embodiments, the expression of one or more endogenous products in a cell that has been modified to reduce or eliminate expression of the endogenous product is no more than about 90%, no more than about 80%, no more than about 70%, no more than about 60%, no more than about 50%, no more than about 40%, no more than about 30%, no more than about 20%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, or no more than about 1% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0211] In certain embodiments, the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell). between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70 %, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 1% and about 4 0%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.In certain embodiments, the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is between about 1% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell). between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 1% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 1% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70 %, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 1% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 1% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 1% and about 4 0%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 1% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 1% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 1% and about 10%, between about 5% and about 10%, between about 5% and about 20%, between about 5% and about 30%, and between about 5% and about 40%.

[0212] In certain embodiments, expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in a cell that has been modified to reduce or eliminate expression of the endogenous product is between about 5% and about 40% of the expression of the corresponding endogenous product in a reference cell (e.g., a WT host cell).

[0213] In certain embodiments, the expression level of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in different reference cells (e.g., cells containing at least one or two wild-type alleles of the corresponding gene) can vary.

[0214] In certain embodiments, a genetic engineering system is used to reduce or eliminate the expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC expression). Various genetic engineering systems known in the art can be used for the methods disclosed herein. Non-limiting examples of such systems include CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, and other tools that reduce or eliminate protein expression by gene silencing, such as small interfering RNA (siRNA), short hairpin RNA (shRNA), and microRNA (miRNA). Any CRISPR / Cas system known in the art, including traditional, enhanced, or modified Cas systems, and other bacterial-based genome excision tools such as Cpf-1, can be used with the methods disclosed herein.

[0215] In certain embodiments, a portion of one or more genes (e.g., genes encoding endogenous products such as BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) is deleted to reduce or eliminate the expression of the corresponding endogenous products in the host cell. In certain embodiments, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of the gene is deleted. In certain embodiments, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, no more than about 65%, no more than about 70%, no more than about 75%, no more than about 80%, no more than about 85%, or no more than about 90% of the gene is deleted.In certain embodiments, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 15% and about 90%, between about 20% and about 8 ...0% and about 80%, between about 20% and about 80%, between about 20% and about 80%, between about 20% and about 80%, between about 20% and about 80%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and between about 30% and about 80%, between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about between about 2% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50%, between about 10% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 4 The gene is deleted in an amount between about 0%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5% of the gene is deleted.

[0216] In certain embodiments, at least one exon of a gene encoding a BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide is at least partially deleted in the host cell.As used herein, "partially deleted" means, for example, at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50%, no more than about 55%, no more than about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, no more than about 2%, no more than about 5%, no more than about 10%, no more than about 15%, no more than about 20%, no more than about 25%, no more than about 30%, no more than about 35%, no more than about 40%, no more than about 45%, no more than about 50 ... More than about 55%, no more than about 60%, no more than about 65%, no more than about 70%, no more than about 75%, no more than about 80%, no more than about 85%, no more than about 90%, no more than about 95%, between about 2% and about 90%, between about 10% and about 90%, between about 20% and about 90%, between about 25% and about 90%, between about 30% and about 90%, between about 40% and about 90%, between about 50% and about 90%, between about 60% and about 90%, between about 70% and about 90%, between about 80% and about 90%, between about 85% and about 90%, between about 2% and about 80%, between about 10% and about 80%, between about 20% and about 80%, between about 30% and about 80% , between about 40% and about 80%, between about 50% and about 80%, between about 60% and about 80%, between about 70% and about 80%, between about 75% and about 80%, between about 2% and about 70%, between about 10% and about 70%, between about 20% and about 70%, between about 30% and about 70%, between about 40% and about 70%, between about 50% and about 70%, between about 60% and about 70%, between about 65% and about 70%, between about 2% and about 60%, between about 10% and about 60%, between about 20% and about 60%, between about 30% and about 60%, between about 40% and about 60%, between about 50% and about 60%, between about 55% and about 60%, between about 2% and about 50% Between about 1% and about 50%, between about 20% and about 50%, between about 30% and about 50%, between about 40% and about 50%, between about 45% and about 50%, between about 2% and about 40%, between about 10% and about 40%, between about 20% and about 40%, between about 30% and about 40%, between about 35% and about 40%, between about 2% and about 30%, between about 10% and about 30%, between about 20% and about 30%, between about 25% and about 30%, between about 2% and about 20%, between about 5% and about 20%, between about 10% and about 20%, between about 15% and about 20%, between about 2% and about 10%, between about 5% and about 10%, or between about 2% and about 5% of the region is missing.

[0217] In a preferred non-limiting embodiment, the CRISPR / Cas9 system is used to reduce or eliminate the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in host cells. The clustered regularly interspaced short palindromic repeat (CRISPR) system is a genome editing tool found in prokaryotic cells. When used for genome editing, the system includes Cas9 (a protein that can modify DNA using crRNA as its guide), CRISPR RNA (crRNA, which contains: RNA, which is used by Cas9 to guide it to the correct fragment of host DNA; and a region that binds to tracrRNA (usually in the form of a hairpin loop) and forms an active complex with Cas9), and trans-activating crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9). The terms "guide RNA" and "gRNA" refer to any nucleic acid that promotes RNA-guided nucleases (such as Cas9) to specifically associate (or "target") with target sequences (such as genomes or episomal sequences in cells). gRNAs can be unimolecular (comprising a single RNA molecule, and alternatively referred to as chimeric) or modular (comprising more than one and typically two separate RNA molecules, such as a crRNA and a tracrRNA, which are typically associated with each other, e.g., by duplexing).

[0218] The CRISPR / Cas9 strategy can use vectors to transfect mammalian cells. Guide RNA (gRNA) can be designed for each application because this is the sequence that Cas9 uses to identify and bind directly to the target DNA in mammalian cells. Multiple crRNAs and the tracrRNA can be packaged together to form a single guide RNA (sgRNA). The sgRNA can be connected to the Cas9 gene and made into a vector for transfection into mammalian cells.

[0219] In certain embodiments, the CRISPR / Cas9 system for reducing or eliminating the expression of one or more endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) comprises a Cas9 molecule and one or more gRNAs comprising a targeting domain complementary to a target sequence of a gene encoding an endogenous product or a component thereof. In certain embodiments, the target gene is a gene region encoding an endogenous product (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide). The target sequence can be any exon or intron region within a gene.

[0220] In certain embodiments, gRNA is applied to mammalian cells in a single vector, and Cas9 molecules are applied to host cells in a second vector. In certain embodiments, gRNA and Cas9 molecules are applied to host cells in a single vector. Alternatively, each gRNA and Cas9 molecule can be applied by an independent vector. In certain embodiments, the CRISPR / Cas9 system can be delivered to host cells as a ribonucleoprotein complex (RNP) comprising the Cas9 protein compounded with one or more gRNAs, for example, by electroporation delivery (see, for example, DeWitt et al., Methods 121-122: 9-15 (2017) about other methods of delivering RNP to cells). In certain embodiments, the CRISPR / Cas9 system is applied to host cells to cause reduction or elimination of endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) expression.

[0221] In certain embodiments, the genetic engineering system is a ZFN system for reducing or eliminating the expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in mammalian cells. ZFN can be used as a restriction endonuclease, which is produced by combining a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target a specific DNA sequence, thereby targeting the zinc finger nuclease to the desired sequence within the genome. The DNA binding domain of each ZFN typically includes a plurality of separate zinc finger repeats, and each zinc finger repeat can recognize multiple base pairs. The most common method for generating new zinc finger domains is to combine smaller zinc finger "modules" of known specificity. The most common cleavage domain in ZFN is the non-specific cleavage domain from the type IIs restriction endonuclease FokI. ZFN regulates protein expression by generating a double-strand break (DSB) in the target DNA sequence, which will be repaired by non-homologous end joining (NHEJ) in the absence of a homologous template. This repair can result in the deletion or insertion of base pairs, creating a frameshift and preventing the production of harmful proteins (Durai et al., Nucleic Acids Res.; 33(18):5978–90 (2005)). Multiple pairs of ZFNs can also be used to completely remove entire large segments of genomic sequence (Lee et al., Genome Res.; 20(1):81–9 (2010)).

[0222] In certain embodiments, the genetic engineering system is a TALEN system for reducing or eliminating the expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide) in mammalian cells. TALEN is a restriction endonuclease that can be engineered to cut a specific DNA sequence. The operating principle of the TALEN system is similar to that of ZFN. TALEN is produced by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effector (TALE) consists of 33 to 34 amino acid repeating motifs, has two variable positions, and has a strong recognition ability for specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domain can be engineered to bind to the desired DNA sequence, thereby guiding the nuclease to cut at a specific position in the genome (Boch et al., Nature Biotechnology; 29 (2): 135-6 (2011)). In certain embodiments, the target gene encodes BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide.

[0223] In certain embodiments, the expression of one or more specific endogenous products (e.g., BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptides) can be reduced or eliminated using oligonucleotides having sequences complementary to corresponding nucleic acids (e.g., mRNAs). Non-limiting examples of such oligonucleotides include small interfering RNA (siRNA), short hairpin RNA (shRNA), and micro RNA (miRNA). In certain embodiments, such oligonucleotides can be homologous to at least a portion of a BAX; BAK; ICAM-1; SIRT-1; and / or MYC polypeptide nucleic acid sequence, wherein the portion has a homology of at least about 75% or at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 98% relative to the corresponding nucleic acid sequence. In certain non-limiting embodiments, the complementary portion may constitute at least 10 nucleotides, or at least 15 nucleotides, or at least 20 nucleotides, or at least 25 nucleotides, or at least 30 nucleotides, and the antisense nucleic acid, shRNA, mRNA, or siRNA molecule may be at most 15, or at most 20, or at most 25, or at most 30, or at most 35, or at most 40, or at most 45, or at most 50, or at most 75, or at most 100 nucleotides in length. The antisense nucleic acid, shRNA, mRNA, or siRNA molecule may comprise DNA or atypical or non-naturally occurring residues, such as, but not limited to, phosphorothioate residues.

[0224] The genetic engineering system disclosed herein can be delivered to mammalian cells using viral vectors (e.g., retroviral vectors such as γ-retroviral vectors and lentiviral vectors). A combination of a retroviral vector and an appropriate packaging line is suitable, wherein the capsid protein will have the function of infecting human cells. Various cell lines that produce amphoteric viruses are known, including but not limited to PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5: 431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6: 2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85: 6460-6464). Non-amphitropic particles are also suitable, for example, particles pseudotyped with VSVG, RD114 or GALV envelopes and any other particles known in the art. Possible transduction methods also include direct co-cultivation of cells with producer cells, for example, by the method of Bregni et al. (1992) Blood 80:1418-1422, or cultivation with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations, for example, by the method of Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992) J. Clin. Invest. 89:1817.

[0225] Other transduction virus vectors can be used to modify mammalian cells disclosed herein. In certain embodiments, the selected vectors exhibit efficient infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus, and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes virus, such as Epstein-Barr virus (see also, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 247:411-429, 1985). 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995). Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346).

[0226] Non-viral methods can also be used for genetic engineering of mammalian cells disclosed herein. For example, nucleic acid molecules can be introduced into mammalian cells by administering the nucleic acid in the presence of lipofection (Feigner et al. Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al. Neuroscience Letters 17:259, 1990; Brigham et al. Am. J. Med. Sci. 298:278, 1989; Staubinger et al. Methods in Enzymology 101:512, 1983), asialoglycomucin-polylysine conjugation (Wu et al. Journal of Biological Chemistry 263:14621, 1988; Wu et al. Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al. Science 247:1465, 1990). Other non-viral methods for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Non-viral gene delivery systems based on polyethyleneimine (PEI) (Ferri et al., Polymers (Basel). October 2021; 13 (19): 3307) can also be used in combination with the compositions and methods of the present invention. Liposomes may also be useful for delivering nucleic acid molecules into mammalian cells. Transplanting normal genes into affected tissues of subjects can also be accomplished by transferring normal nucleic acids ex vivo into culturable cell types (e.g., autologous or allogeneic primary cells or their progeny), and then injecting the cells (or their progeny) into target tissues or systemic injections.

[0227] V. Targeted Integration

[0228] Targeted integration (TI) allows the integration of exogenous nucleotide sequences into a predetermined site in the genome of mammalian cells.

[0229] In certain embodiments, the use of TI host cells to introduce exogenous nucleic acids encoding target recombinant products will provide robust, stable cell culture performance and a lower risk of sequence variants in the resulting target recombinant products. TI host cells and strategies for their use are described in detail in U.S. Patent Application Publication No. US 2021 / 0002669, the contents of which are incorporated by reference in their entirety.

[0230] In certain embodiments employing targeted integration, the exogenous nucleotide sequence is integrated at a site within a specific locus of the genome of the TI host cell. In certain embodiments, the locus into which the exogenous nucleotide sequence is integrated is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to the following sequences selected from the group consisting of Contig NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0231] In certain embodiments, the nucleotide sequence immediately adjacent to the 5' end of the integrated exogenous sequence is selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence immediately 5' to the integrated exogenous sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, Nucleotides 253831-491909 of W_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, or nucleotides 82214-97705 of NW_003615411.1.

[0232] In certain embodiments, the nucleotide sequence immediately adjacent to the 3' end of the integrated exogenous sequence is selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence immediately 3' to the integrated exogenous sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, and nucleotides 207920-207167 of NW_006874047.1. _006881296.1, nucleotides 491910-667813, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, or nucleotides 97706-105117 of NW_003615411.1.

[0233] In certain embodiments, the integrated exogenous sequence is flanked at the 5' end by a nucleotide sequence selected from the group consisting of nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1 and nucleotides 82214-97705 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the integrated exogenous sequence is flanked at the 3' end by a nucleotide sequence selected from the group consisting of nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1 and nucleotides 97706-105117 of NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence flanking the 5' end of the integrated exogenous nucleotide sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 41190-45269 of NW_006874047.1, nucleotides 63590-207911 of NW_006884592.1, Nucleotides 253831-491909 of NW_006881296.1, nucleotides 69303-79768 of NW_003616412.1, nucleotides 293481-315265 of NW_003615063.1, nucleotides 2650443-2662054 of NW_006882936.1, and nucleotides 82214-97705 of NW_003615411.1.In certain embodiments, the nucleotide sequence flanking the 3' end of the integrated exogenous nucleotide sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to nucleotides 45270-45490 of NW_006874047.1, nucleotides 207912-792374 of NW_006884592.1, Nucleotides 491910-667813 of NW_006881296.1, nucleotides 79769-100059 of NW_003616412.1, nucleotides 315266-362442 of NW_003615063.1, nucleotides 2662055-2701768 of NW_006882936.1, and nucleotides 97706-105117 of NW_003615411.1.

[0234] In certain embodiments, the integrated exogenous nucleotide sequence is operably linked to a nucleotide sequence selected from the group consisting of Contigs NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1, and sequences at least 50% homologous thereto. In certain embodiments, the nucleotide sequence operably linked to the exogenous nucleotide sequence is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 99.9% homologous to a sequence selected from the group consisting of: Contig NW_006874047.1, NW_006884592.1, NW_006881296.1, NW_003616412.1, NW_003615063.1, NW_006882936.1, and NW_003615411.1.

[0235] In targeted integration, site-specific recombination is used to introduce exogenous nucleic acids into specific loci in the genome of mammalian TI host cells. This is an enzymatic process in which the sequence at the integration site in the genome is exchanged for exogenous nucleic acids. One system for achieving such nucleic acid exchange is the Cre-lox system. The enzyme that catalyzes the exchange is the Cre recombinase. The sequence to be exchanged is defined by the position of two lox (P) sites in the genome and the exogenous nucleic acid. These lox (P) sites are recognized by the Cre recombinase. No more is needed, i.e. no ATP, etc. The Cre-lox system was originally discovered in bacteriophage P1.

[0236] In certain embodiments of all aspects and embodiments of the invention, the cell modified according to the invention has undergone targeted integration of a nucleic acid encoding a polypeptide or protein of interest prior to modification according to the invention.

[0237] In certain embodiments of all aspects and embodiments of the invention, the cell modified according to the invention has undergone targeted integration of a nucleic acid encoding a polypeptide or protein of interest following modification according to the invention.

[0238] In certain embodiments of all aspects and embodiments of the invention, targeted integration is mediated by a recombinase that recognizes one or more recombination recognition sequences (RRS) present in the genome of the mammalian cell and in the exogenous nucleotide sequence to be integrated into the genome of the mammalian cell.

[0239] In certain embodiments of all aspects and embodiments of the invention, the targeted integration is mediated by homologous recombination.

[0240] A "recombination recognition sequence" (RRS) is a nucleotide sequence that is recognized by a recombinase and is necessary and sufficient for a recombinase-mediated recombination event. An RRS can be used to define the position in a nucleotide sequence where a recombination event will occur.

[0241] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by the Cre recombinase.

[0242] In certain embodiments of all aspects and embodiments of the invention, the RRS is a LoxP site and the Cre recombinase mediates targeted integration by recombination.

[0243] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by the FLP recombinase.

[0244] In certain embodiments of all aspects and embodiments of the invention, the RRS is a FRT site and the FLP recombinase mediates targeted integration by recombination.

[0245] In certain embodiments of all aspects and embodiments of the invention, the RRS is recognized by the Bxb1 integrase.

[0246] In certain embodiments of all aspects and embodiments of the invention, the RRS is a Bxb1 attP or Bxb1 attB site and the Bxb1 integrase mediates targeted integration by recombination.

[0247] In certain embodiments of all aspects and embodiments of the invention, the RRS is composed of Integrase recognition.

[0248] In certain embodiments of all aspects and embodiments of the invention, the RRS is attP or attB site and Integrases mediate targeted integration via recombination.

[0249] Recombinant enzymes can be introduced into cells using expression vectors containing the coding sequence or mRNA for the enzyme either as a protein.

[0250] With regard to TI, any known or future mammalian cell comprising a landing site as described herein integrated at a single site within a genomic locus (including those modified according to the invention) can be used in the present invention. Such cells are denoted mammalian TI host cells.

[0251] In certain embodiments of all aspects and embodiments of the invention, the mammalian TI host cell is a hamster cell, a human cell, a rat cell, or a mouse cell comprising a landing site as described herein. In a preferred embodiment, the mammalian TI host cell is a CHO cell. In certain embodiments, the mammalian TI CHO host cell is a CHO K1 cell, a CHO K1SV cell, a CHODG44 cell, a CHO DUKXB-11 cell, a CHO K1S cell, or a CHO K1M cell comprising a landing site as described herein integrated at a single site within the genomic locus.

[0252] In certain embodiments of all aspects and embodiments of the invention, the mammalian TI host cell comprises an integration landing site, wherein the landing site comprises one or more recombination recognition sequences (RRS). The RRS can be produced by a recombinase (e.g., Cre recombinase, FLP recombinase, Bxb1 integrase or The one or more RRSs can be independently selected from the group consisting of: LoxP sequence, LoxP L3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence and attB sequence. If multiple RRSs must be present, the selection of each of these sequences depends on the other sequence within the limits of selecting a different RRS.

[0253] In certain embodiments of all aspects and embodiments of the present invention, the landing site includes one or more recombination recognition sequences (RRS), wherein the RRS can be recognized by a recombinase. In certain embodiments, the integrated landing site includes at least two RRS. In certain embodiments, the integrated landing site includes three RRS, wherein the third RRS is located between the first RRS and the second RRS. In certain preferred embodiments, all three RRS are different. In certain embodiments, the landing site includes the first RRS, the second RRS and the third RRS, and at least one selection marker between the first RRS and the second RRS, and the third RRS is different from the first RRS and / or the second RRS. In certain embodiments, the landing site also includes the second selection marker, and the first selection marker and the second selection marker are different. In certain embodiments, the landing site also includes the third selection marker and an internal ribosome entry site (IRES), wherein IRES is operably connected to the third selection marker. The third selection marker may be different from the first selection marker or the second selection marker.

[0254] An exemplary mammalian TI host cell suitable for modification according to the present invention and for use in the method according to the present invention is a CHO cell, which carries a landing site integrated at a single site within a locus in its genome, wherein the landing site comprises three heterologous-specific loxP sites for Cre recombinase-mediated DNA recombination.

[0255] In this example, the heterologous specific loxP sites are L3 (SEQ ID NO: 01), LoxFas (SEQ ID NO: 03) and 2L (SEQ ID NO: 02) (see, e.g., Lanza et al., Biotechnol. J. 7 (2012) 898-908; Wong et al., Nucleic Acids Res. 33 (2005) e147), wherein L3 and 2L flank the landing site at the 5' and 3' ends, respectively, and LoxFas is located between the L3 site and the 2L site. The landing site also comprises a bicistronic unit that links the expression of the selection marker to the expression of the fluorescent GFP protein via an IRES, thereby allowing for the stabilization of the landing site by positive selection, as well as selection for the absence of the site after transfection and Cre recombination (negative selection). Green fluorescent protein (GFP) was used to monitor the RMCE reaction.

[0256] This configuration of the landing site as outlined in the previous paragraph allows the simultaneous integration of two vectors, for example a so-called front vector carrying L3 and LoxFas sites, and a back vector comprising LoxFas and 2L sites. The functional elements of a selectable marker gene different from the one present in the landing site can be distributed between the two vectors: the promoter and the start codon can be located on the front vector, while the coding region and the poly A signal are located on the back vector. Only the correct recombinase-mediated integration of the nucleic acids from both vectors induces resistance to the corresponding selection agent.

[0257] Generally speaking, a mammalian TI host cell is a mammalian cell that comprises a landing site integrated at a single site within a locus of the mammalian cell genome, wherein the landing site comprises a first recombination recognition sequence and a second recombination recognition sequence flanked by at least one first selection marker, and a third recombination recognition sequence located between the first recombination recognition sequence and the second recombination recognition sequence, and all recombination recognition sequences are different.

[0258] The selectable marker can be selected from the group comprising aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid. The selection marker can also be a fluorescent protein selected from the group comprising green fluorescent protein (GFP), enhanced GFP (eGFP), synthetic GFP, yellow fluorescent protein (YFP), enhanced YFP (eYFP), cyan fluorescent protein (CFP), mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald6, CyPet, mCFPm, Cerulean and T-Sapphire.

[0259] Exogenous nucleotide sequences are nucleotide sequences that are not derived from specific cells, but can be introduced into the cells by DNA delivery methods (such as, by transfection methods, electroporation methods or transformation methods). In certain embodiments, mammalian TI host cells contain at least one landing site integrated into one or more integration sites in the genome of mammalian cells. In certain embodiments, the landing site is integrated into one or more integration sites within the specific locus of the genome of the mammalian cell.

[0260] In certain embodiments according to all aspects and embodiments of the present invention, the integration site includes at least one selection marker. In certain embodiments, the landing site of integration includes the first RRS, the second RRS and the third RRS, and at least one selection marker. In certain embodiments, the selection marker is located between the first RRS and the second RRS. In certain embodiments, two RRS are flanked by at least one selection marker, that is, the first RRS is located at the 5' (upstream) of the selection marker and the second RRS is located at the 3' (downstream) of the selection marker. In certain embodiments, the first RRS is adjacent to the 5' end of the selection marker, and the second RRS is adjacent to the 3' end of the selection marker. In certain embodiments, the landing site includes the first RRS, the second RRS and the third RRS, and at least one selection marker between the first RRS and the third RRS.

[0261] In certain embodiments according to all aspects and embodiments of the present invention, the selection marker is located between the first RRS and the second RRS, and the two flanking RRS are different. In certain preferred embodiments, the first flanking RRS is a LoxPL3 sequence and the second flanking RRS is a LoxP 2L sequence. In certain embodiments, the LoxP L3 sequence is located at the 5' end of the selection marker and the LoxP 2L sequence is located at the 3' end of the selection marker. In certain embodiments, the first flanking RRS is a wild-type FRT sequence and the second flanking RRS is a mutant FRT sequence. In certain embodiments, the first flanking RRS is a Bxb1 attP sequence and the second flanking RRS is a Bxb1 attB sequence.

[0262] In some embodiments, the first side-connected RRS is attP sequence, and the second flanking RRS is attB sequence. In certain embodiments, the two RRS are positioned in the same orientation. In certain embodiments, the two RRS are both in a forward or reverse orientation. In certain embodiments, the two RRS are positioned in opposite orientations.

[0263] In certain embodiments according to all aspects and embodiments of the present invention, the integrated landing site comprises a first selection marker and a second selection marker flanking two RRS, wherein the first selection marker is different from the second selection marker. In certain embodiments, the two selection markers are independently selected from the group consisting of: glutamine synthetase selection marker, thymidine kinase selection marker, HYG selection marker and puromycin resistance selection marker. In certain embodiments, the integrated landing site comprises a thymidine kinase selection marker and a HYG selection marker. In certain embodiments, the first selection marker is selected from the group comprising aminoglycoside phosphotransferase (APH) (e.g., hygromycin phosphotransferase (HYG), neomycin and G418 APH), dihydrofolate reductase (DHFR), thymidine kinase (TK), glutamine synthetase (GS), asparagine synthetase, tryptophan synthetase (indole), histidinol dehydrogenase (histidinol D), and genes encoding resistance to puromycin, blasticidin, bleomycin, phleomycin, chloramphenicol, Zeocin and mycophenolic acid, and the second selection marker is selected from the group comprising GFP, eGFP, synthetic GFP, YFP, eYFP, CFP, mPlum, mCherry, tdTomato, mStrawberry, J-red, DsRed monomer, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, mCFPm, Cerulean and T-Sapphire fluorescent protein. In certain embodiments, the first selection marker is a glutamine synthetase selection marker and the second selection marker is a GFP fluorescent protein.In certain embodiments, the two RRS flanking the two selection markers are different.

[0264] In certain embodiments, the selection marker is operably linked to a promoter sequence. In certain embodiments, the selection marker is operably linked to an SV40 promoter. In certain embodiments, the selection marker is operably linked to a human cytomegalovirus (CMV) promoter.

[0265] The Cre-lox system operates in different cell types, such as mammals, plants, bacteria, and yeast.

[0266] In certain embodiments according to all aspects and embodiments of the present invention, the exogenous nucleic acid encoding the heterologous polypeptide or protein has been integrated into the mammalian TI host cell by single recombinase or double recombinase mediated cassette exchange (RMCE), thereby obtaining a recombinant mammalian cell, such as a recombinant CHO cell, in which the defined and specific expression cassette sequence has been integrated into a single locus of the genome, thereby resulting in the efficient expression and production of the heterologous polypeptide.

[0267] The Cre-LoxP site-specific recombination system has been widely used in many biological experimental systems. Cre recombinase is a 38-kDa site-specific DNA recombinase that recognizes a 34bp LoxP sequence. Cre recombinase is derived from bacteriophage P1 and belongs to the tyrosine family site-specific recombinase. Cre recombinase can mediate intramolecular and intermolecular recombination between LoxP sequences. The LoxP sequence consists of an 8bp non-palindromic core region and two 13bp inverted repeat sequences flanked by it. Cre recombinase binds to the 13bp repeat sequence, thereby mediating the recombination within the 8bp core region. Cre-LoxP-mediated recombination occurs with high efficiency and does not require any other host factors. If two LoxP sequences are placed in the same nucleotide sequence in the same orientation, the Cre recombinase-mediated recombination will excise the DNA sequence between the two LoxP sequences to form a covalent closed loop. If two LoxP sequences are placed in the same nucleotide sequence in an inverted position, the Cre recombinase-mediated recombination will reverse the orientation of the DNA sequence between the two sequences. If the two LoxP sequences are on two different DNA molecules, and if one DNA molecule is a circular molecule, Cre recombinase-mediated recombination will result in the integration of the circular DNA sequence.

[0268] The term "matched RRS" means that recombination has occurred between the two RRS. In certain embodiments, the two matched RRS are identical. In certain embodiments, both RRS are wild-type LoxP sequences. In certain embodiments, both RRS are mutant LoxP sequences. In certain embodiments, both RRS are wild-type FRT sequences. In certain embodiments, both RRS are mutant FRT sequences. In certain embodiments, the two matched RRS are different sequences but can be recognized by the same recombinase. In certain embodiments, the first matched RRS is a Bxb1 attP sequence and the second matched RRS is a Bxb1 attB sequence. In certain embodiments, the first matched RRS is attB sequence, and the second matching RRS is attB sequence.

[0269] When a dual vector combination is used, a "dual plasmid RMCE" strategy or "dual RMCE" is adopted in the method according to the present invention. For example, but not by way of limitation, the landing site of integration can contain three RRSs, such as the following arrangement: wherein the third RRS ("RRS3") is present between the first RRS ("RRS1") and the second RRS ("RRS2"), and the first vector contains two RRSs that match the first RRS and the third RRS on the integrated exogenous nucleotide sequence, and the second vector contains two RRSs that match the third RRS and the second RRS on the integrated exogenous nucleotide sequence.

[0270] The dual-plasmid RMCE strategy involves the use of three RRS sites to implement two independent RMCEs simultaneously. Therefore, the landing site in mammalian TI host cells using the dual-plasmid RMCE strategy includes a third RRS site (RRS3) that has no cross-activity with the first RRS site (RRS1) or the second RRS site (RRS2). The two plasmids to be targeted require the same flanking RRS sites for efficient targeting, with one plasmid (front) flanked by RRS1 and RRS3, and the other expression plasmid (rear) flanked by RRS3 and RRS2. Two selection markers are also required in this dual-plasmid RMCE. A selection marker expression cassette is divided into two parts. The front plasmid will contain a promoter, followed by a start codon and an RRS3 sequence. The rear plasmid will have an RRS3 sequence fused to the N-terminus of the selection marker coding region minus the start codon (ATG). It may be necessary to insert additional nucleotides between the RRS3 site and the selection marker sequence to ensure that the fusion protein undergoes in-frame translation (i.e., an operable connection). Only if both plasmids have been correctly inserted, will the complete expression cassette for the selection marker be assembled and thus render the cells resistant to the corresponding selection agent.

[0271] Double plasmid RMCE involves a double recombination crossover event between two heterologous specific RRSs within the target genomic locus and a donor DNA molecule, which is catalyzed by a recombinase. Double plasmid RMCE is designed to introduce copies of DNA sequences from the combined front vector and back vector into a predetermined locus of the mammalian TI host cell genome. RMCE can be implemented so that the prokaryotic vector sequence is not introduced into the genome of the mammalian TI host cell, thereby reducing and / or preventing unnecessary triggering of host immune or defense mechanisms. The RMCE procedure can be repeated with multiple DNA sequences.

[0272] In certain embodiments according to all aspects and embodiments of the present invention, targeted integration is achieved by two RMCEs, wherein two different DNA sequences are integrated into predetermined sites of the genome of a mammalian TI host cell that matches the RRS, wherein each DNA sequence comprises at least one expression cassette encoding a portion of a heterologous multimeric polypeptide and / or at least one selection marker or portion thereof flanking two heterospecific RRSs. In certain embodiments, targeted integration is achieved by multiple RMCEs, wherein DNA sequences from multiple vectors are all integrated into predetermined sites of the genome of a mammalian TI host cell, wherein each DNA sequence comprises at least one expression cassette encoding a portion of a heterologous multimeric polypeptide and / or at least one selection marker or portion thereof flanking two heterospecific RRSs. In certain embodiments, the selection marker may be partially encoded on a first vector and partially encoded on a second vector, such that the selection marker can be expressed only if both are correctly integrated by double RMCE.

[0273] It must be noted that in certain embodiments, reduction or elimination of expression (e.g., by knockout) can be performed prior to the introduction of exogenous nucleic acid encoding a heterologous polypeptide or protein, and can also be performed thereafter in stably transfected clones or a pool of stably transfected clones.

[0274] VI. Compositions and methods according to the present invention

[0275] The present invention is based at least in part on the discovery that the properties of mammalian cells in the recombinant production of heterologous polypeptides and proteins can be improved by reducing or eliminating the expression of one or more of the BAK, BAX, ICAM-1, SIRT-1 and MYC genes. Among other things, one of the improved properties is increased volumetric productivity compared to mammalian cells not modified according to the invention.

[0276] Without being bound by this theory, it is hypothesized that by reducing or eliminating the expression of the BAX and BAK genes, apoptosis resistance can be improved, by reducing or eliminating the expression of the ICAM-1 gene, cell clumping during culture can be reduced, by reducing or eliminating the expression of the SIRT-1 gene, productivity can be improved, and by reducing or eliminating the expression of the MYC-1 gene, cell volume can be increased, and thus cell-based volume productivity can be increased. These effects are maintained by combining the reduction or elimination of the expression of one or more or all of these genes.

[0277] The reduction or elimination of expression according to the present invention is not limited to specific mammalian cells. It can be applied to any cells, such as CHO cells, HEK cells, CAP cells or BHK cells.

[0278] Although CHO cells and CRISPR / Cas gene modification are used below to illustrate the subject matter of the present invention, this is merely presented to illustrate the subject matter of the present invention and should not be construed as limiting in any way.

[0279] In a preferred embodiment, CRISPR / Cas9 technology has been used to reduce or eliminate the expression of BAK, BAX, ICAM-1, SIRT-1 and MYC genes. Similarly, any other technology, such as zinc finger nucleases or TALENS, can be used to reduce or eliminate BAK, BAX, ICAM-1, SIRT-1 and MYC gene mRNA levels, and thus affect the reduction or elimination of BAK, BAX, ICAM-1, SIRT-1 and MYC gene transcriptional activity / expression.

[0280] CRISPR / Cas9 can be used to target the corresponding gene at one, two, three or more different sites.For example, but not limited to, three different sites in the coding sequence can be targeted using three different gRNAs using multiple ribonucleoprotein delivery.In certain embodiments, compared with CRISPR / Cas9 editing based on common plasmids, multiple ribonucleoprotein delivery shows higher gene editing efficacy and specificity.In certain embodiments, double-strand breaks at gene target sites induce insertion and deletion formation.In certain embodiments, for example, when multiple sites are targeted due to the use of multiple gRNAs, the deletion of the sequence (e.g., inserting exons) between the target sites causes the frameshift of the coding sequence (CDS) of the target protein.Sequencing the loci of the PCR amplification in the modified cell pool obtained according to the present invention reveals the interruption of the sequencing reaction at the first gRNA site, thereby indicating that the corresponding gene is successfully targeted.

[0281] In certain embodiments, sequencing of the PCR-amplified loci in the modified cell pool reveals an interruption of the sequencing reaction at the first gRNA site, indicating successful targeting of the gene. In certain embodiments, the cell pool will contain modifications at all target genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the pool of cells will comprise modifications at four of the five targeted genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the pool of cells will comprise modifications at three of the five targeted genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the pool of cells will comprise modifications at two of the five targeted genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool. In certain embodiments, the pool of cells will comprise a modification at one of the five targeted genes in at least about 2%, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the cells in the pool.

[0282] In fed-batch culture processes, it has been observed that the productivity of cells modified to have reduced or eliminated expression of the BAK, BAX, SIRT-1, and MYC genes increased by 40% or more.

[0283] In fed-batch culture processes, it has been observed that the productivity of cells modified to have reduced or eliminated expression of the BAK, BAX, SIRT-1, ICAM-1, and MYC genes was increased by 40% or more.

[0284] This effect was observed at the cell pool or clone level expressing antibodies of different binding specificities and different formats compared to unmodified cell pools or clones (data for 10-day and 14-day fed-batch cultures are presented in the table below, respectively). Control cells and modified cells have the same genotype, except for the additional reduction or elimination of expression of the identified gene, i.e. the modification has been introduced into cells stably expressing the respective antibody.

[0285]

[0286]

[0287]

[0288] Without being bound by this theory, it is hypothesized that homozygous knockouts have a more favorable effect on productivity increase than heterozygous knockouts.

[0289] The present invention is based at least in part on the finding that the effect of the modified combination according to the present invention is more pronounced when the culture time exceeds 10 days. Figure 1 Cells expressing mAb-A are shown in Figure 2 Cells expressing mAb-B are shown in FIG.

[0290] Thus, reduced or eliminated expression of BAK, BAX, SIRT-1, MYC, and ICAM-1 genes showed no growth defects, increased bioprocess viability, and increased volumetric productivity.

[0291] The increased volumetric productivity is based on a 1-2 μm increase in average cell diameter, resulting in a 15%-45% increase in volume. Figure 3 Cells expressing mAb-B are exemplarily shown in FIG.

[0292] Summary of culture results

[0293] mAb-A = Antibody-Multimer-Fusion

[0294] mAb-B = antibody with heavy chain C-terminal cytokine fusion

[0295] mAb-C = T cell bispecific antibody

[0296] mAb-D = T cell bispecific antibody with different binding specificity than mAb-C

[0297] mAb-E = full length antibody with domain swap

[0298] mAb-F = full length antibody with domain swap and additional heavy chain C-terminal binding site

[0299] mAb-G = full-length antibody with domain swap and additional heavy chain C-terminal binding site; binding specificity differs from mAb-F

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307]

[0308]

[0309]

[0310] ***

[0311] The following figures, sequences and examples are provided to aid the understanding of the present invention, the true scope of which is set forth in the appended claims. It should be understood that modifications can be made to the procedures set forth without departing from the spirit of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0312] Figure 1 Time-dependent titers of mAb-A expression in different cell lines: (1) = BAX / BAK-knockout; (2) = ICAM-1-knockout; (3) = control, non-knockout; (4) = MYC-knockout; (5) = BAX / BAK / ICAM-1 / MYC / SIRT-1-knockout; (6) = SIRT-1-knockout.

[0313] Figure 2Time-dependent titers of mAb-B expression in different cell lines: (1) = BAX / BAK-knockout; (2) = ICAM-1-knockout; (3) = control, non-knockout; (4) = MYC-knockout; (5) = BAX / BAK / ICAM-1 / MYC / SIRT-1-knockout; (6) = SIRT-1-knockout.

[0314] Figure 3 The average cell diameter of cells expressing mAb-B increased with culture time: (1) = control, non-knockout; (2) = MYC-knockout; (3) = BAX / BAK / ICAM-1 / MYC / SIRT-1-knockout.

[0315] Sequence Description

[0316] All gRNA sequences contain only the genomic targeting sequence of the gRNA.

[0317] SEQ ID NO:01: Exemplary sequence of L3 recombinase recognition sequence: AAGTCTCC

[0318] SEQ ID NO:02: Exemplary sequence of 2L recombinase recognition sequence: GCATACAT

[0319] SEQ ID NO: 03: Exemplary sequence of LoxFas recombinase recognition sequence: TACCTTTC

[0320] SEQ ID NO:04-06: Exemplary variants of the human CMV promoter:

[0321] SEQ ID NO:04:

[0322] GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATC

[0323] SEQ ID NO:05:

[0324] GTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAGCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCCGTTTAGTGAACGTCAGATCTAGCTCTGGGAGAGGAGCCCAGCACTAGAAGTCGGCGGTGTTTCCATTCGGTGATCAGCACTGAACACAGAGGAAGCTTGCC GCCACC

[0325] SEQ ID NO:06:

[0326]

[0327] SEQ ID NO:07: Exemplary SV40 polyadenylation signal sequence: AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTG

[0328] SEQ ID NO:08: Exemplary bGH polyadenylation signal sequence: TTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAA ATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG

[0329] SEQ ID NO:09: Exemplary hGT terminator sequence:

[0330] CAGGATAATATATGGTAGGGTTCATAGCCAGAGTAACCTTTTTTTTTAATTTTTATTTTATTTTATTTTTGAG

[0331] SEQ ID NO: 10: Exemplary SV40 promoter sequence:

[0332] AGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCATTCTC CGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCG

[0333] SEQ ID NO:11: Exemplary GFP nucleic acid sequence:

[0334] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGATCTAGATGA

[0335] SEQ ID NO:12 - 14: SIRT-1 guide RNA

[0336] SEQ ID NO:12: gRNA_SIRT1_1: TATCATCCAACTCAGGTGGA

[0337] SEQ ID NO:13:gRNA_SIRT1_2:GCAGCATCTCATGATTGGCA

[0338] SEQ ID NO:14:gRNA_SIRT1_3:GCATTCTTGAAGTAACTTCA

[0339] SEQ ID NO:15-16:SIRT-1PCR Fragment

[0340] SEQ ID NO:15:SIRT1_for:ATGGCAGTTTTAGACACC

[0341] SEQ ID NO:16:SIRT1_rev:CTTGGAACTCAGACAAGG

[0342] SEQ ID NO:17-19:MYC RNA

[0343] SEQ ID NO:17:gRNA_MYC_1:CTATGACCTCGACTACGACT

[0344] SEQ ID NO:18:gRNA_MYC_2:GGACGCAGCGACCGTCACAT

[0345] SEQ ID NO:19:gRNA_MYC_3:CACCATCTCCAGCTGATCCG

[0346] SEQ ID NO:20-21:MYC PCR Fragment

[0347] SEQ ID NO:20:MYC_for:CACACACACACTTGGAAG

[0348] SEQ ID NO:21:MYC_rev:CTTGATGAAGGTCTCGTC

[0349] SEQ ID NO:22-23AND36-37:ICAM-1 RNA

[0350] SEQ ID NO:22:gRNA_ICAM1_1:ACCTGCATGGATGCACCCCG

[0351] SEQ ID NO:23:gRNA_ICAM1_2:GCACCGTGCCCACCTCCAGG

[0352] SEQ ID NO:36:gRNA_ICAM1_3:TAACCGCCAGAGAAAGATC

[0353] SEQ ID NO:37:gRNA_ICAM1_4:ACCTGCATGGATGCACCCCG

[0354] SEQ ID NO:24-25:ICAM-1PCR Fragment

[0355] SEQ ID NO:24:ICAM1_for:CCAAGCTAGATGATGTGAG

[0356] SEQ ID NO:25:ICAM1_rev:GCCCTACCCTTTTAATAC

[0357] SEQ ID NO:26-28AND 38-39:BAK RNA

[0358] SEQ ID NO:26:gRNA_BAK_1:TACAGCATCTTGGGTCAGGT

[0359] SEQ ID NO:27:gRNA_BAK_2:GTCCATCTCGGGGTTGGCAG

[0360] SEQ ID NO:28:gRNA_BAK_3:AATCTTGGTGAAGAGTTCGT

[0361] SEQ ID NO:38:gRNA_BAK_4:TCATCACAGTCCTGCCTAGG

[0362] SEQ ID NO:39:gRNA_BAK_5:ATGGCGTCTGGACAAGGACC

[0363] SEQ ID NO:29-30:BAK PCR kit

[0364] SEQ ID NO:29:BAK_for:CGATCTGAGTTCACGAAC

[0365] SEQ ID NO:30:BAK_rev:CCATCAGGAACAAGAGAC

[0366] SEQ ID NO:31-33AND40-41:BAX RNA

[0367] SEQ ID NO:31:gRNA_BAX_1:ACAGGGGCCTTTTTGCTACA

[0368] SEQ ID NO:32: gRNA_BAX_2: GCTCATCTCCAATTCGCCTG

[0369] SEQ ID NO: 33: gRNA_BAX_3: ACGAGAGGTCTTCTTCCGTG

[0370] SEQ ID NO:40:gRNA_BAX_4:GGGTCGGGGGAGCAGCTCGG

[0371] SEQ ID NO:41:gRNA_BAX_5:GGGTCCCGAAGTATGAGAGG

[0372] SEQ ID NO:34-35: BAX PCR primers

[0373] SEQ ID NO: 34: BAX_for: ATCTTGTCTCCCTCGTAG

[0374] SEQ ID NO: 35: BAX_rev: TCCTGGACTTCTCTAACC

[0375] Examples

[0376] Example 1

[0377] General techniques

[0378] 1) Recombinant DNA technology

[0379] Standard methods were used to manipulate DNA, such as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor Laboratory, New York, (1989). Molecular biology reagents were used according to the manufacturers' instructions.

[0380] 2) DNA sequence determination

[0381] DNA sequencing was performed at SequiServe GmbH (Vaterstetten, Germany) or Eurofins Genomics GmbH (Ebersberg, Germany) or Microsynth AG (Balgach, Switzerland).

[0382] 3) DNA and protein sequence analysis and sequence data management

[0383] The EMBOSS (European Molecular Biology Open Software Suite) software package and Geneious prime 2021 (Auckland, New Zealand) were used for sequence creation, mapping, analysis, annotation, and illustration.

[0384] 4) Gene and oligonucleotide synthesis

[0385] The required gene fragments were prepared by chemical synthesis at Geneart GmbH (Regensburg, Germany) or Twist Bioscience (San Francisco, the United States). The synthesized gene fragments were cloned into E. coli plasmids for propagation / amplification. The DNA sequence of the subcloned gene fragments was verified by DNA sequencing. Alternatively, short synthetic DNA fragments were assembled by annealing chemically synthesized oligonucleotides or via PCR. Each oligonucleotide was prepared by metabion GmbH (Planegg-Martinsried, Germany).

[0386] 5) Reagents

[0387] If not stated otherwise, all commercial chemicals, antibodies, and kits were used according to the manufacturers' protocols.

[0388] 6) Cultivation of TI host cell lines

[0389] TI CHO host cells were cultured in a humidified incubator at 37°C, 85% humidity and 5% CO2. They were cultured in a proprietary DMEM / F12 medium containing 300 μg / ml hygromycin B and 4 μg / ml of a second selection marker. The cells were split every 3 or 4 days at a total volume of 30 ml at a concentration of 0.3x10E6 cells / ml. For the culture, a 125 ml unbaffled conical shake flask was used. The cells were shaken at a speed of 150 rpm with an oscillation amplitude of 5 cm. Cell counts were determined using a Cedex HiRes CellCounter (Roche). The cells were kept in culture until they reached 60 days of age.

[0390] 7) Cloning

[0391] a) General:

[0392] Cloning using the R site depends on a DNA sequence next to the target gene (GOI) that is equivalent to the sequence located in the following fragment. Similarly, the assembly of fragments is possible by overlapping of equivalent sequences and subsequent sealing of the nicks in the assembled DNA by DNA ligase. Therefore, it is necessary to clone individual genes, especially preliminary vectors containing the correct R site. After successful cloning of these preliminary vectors, the target gene flanked by the R site is excised by restriction digestion by an enzyme that cuts directly next to the R site. The last step is to assemble all DNA fragments at once. In more detail, 5'-nuclease removes the 5' end of the overlapping region (R-site). Afterwards, annealing of the R site can be performed, and DNA polymerase extends the 3' end to fill the gap in the sequence. Finally, DNA ligase seals the gap between nucleotides. Add an assembly master mix containing different enzymes (such as exonucleases, DNA polymerases and ligases), and then incubate the reaction mixture at 50°C to assemble the individual fragments into a plasmid. Afterwards, the plasmid is used to transform competent E. coli cells.

[0393] For some vectors, a cloning strategy by restriction enzymes is used. By selecting a suitable restriction endonuclease, the target gene can be cut and then inserted into different vectors by connection. Therefore, it is preferred to use an enzyme that cuts at the multiple cloning site (MCS) and select it in a clever way so that the connection of the fragments can be carried out in the correct array. If the vector and the fragment are cut with the same restriction enzyme before, the sticky ends of the fragment and the vector fit together perfectly and can be connected by DNA ligase subsequently. After connection, the competent E. coli cells are transformed with the newly generated plasmid.

[0394] b) Cloning via restriction digestion:

[0395] To digest the plasmid with restriction enzymes, pipette the following components together onto ice:

[0396] Table: Restriction digestion reaction mixture

[0397]

[0398] If more enzymes were used in one digestion, 1 μl of each was used and the volume was adjusted by adding more or less PCR grade water. All enzymes were chosen on the basis that they were qualified for use with CutSmart buffer (100% activity) from New England Biolabs and had the same incubation temperature (37°C for all).

[0399] The incubation was performed using a thermomixer or thermal cycler, allowing the samples to incubate at a constant temperature (37°C). During the incubation, the samples were not agitated. The incubation time was set to 60 min. The samples were then mixed directly with the loading dye and loaded onto an agarose electrophoresis gel or stored at 4°C / ice for further use.

[0400] Prepare 1% agarose gel for gel electrophoresis. Therefore, weigh 1.5g of multi-purpose agarose into a 125 conical shake flask and fill with 150ml TAE buffer. Heat the mixture in a microwave until the agarose is completely dissolved. Add 0.5μg / ml ethidium bromide to the agarose solution. Thereafter cast the gel in a mold. After the agarose is set, place the mold into the electrophoresis chamber and fill the electrophoresis chamber with TAE buffer. Load the sample afterwards. In the first pocket (starting from the left), load the appropriate DNA molecular weight marker, followed by the sample. The gel is run at <130V for about 60 minutes. After electrophoresis, remove the gel from the chamber and analyze it in a UV-Imager.

[0401] The target band was excised and transferred to a 1.5 ml Eppendorf tube. For gel purification, the QIAquick Gel Extraction Kit from Qiagen was used according to the manufacturer's instructions. The DNA fragments were stored at -20 °C for further use.

[0402] The fragments for ligation are pipetted together in a vector-insert molar ratio of 1:2, 1:3 or 1:5, depending on the length of the insert and vector fragments and their relationship to each other. If the fragment that should be inserted into the vector is short, a ratio of 1:5 is used. If the insert is longer, a smaller amount of insert is used in the vector in question. An amount of 50 ng of vector is used in each ligation, and the amount of the specific insert is calculated using the NEBioCalculator. For ligation, the T4 DNA ligation kit from NEB is used. The table below describes an example of a ligation mixture.

[0403] Table: Ligation Reaction Mixture

[0404]

[0405] Pipette all components together onto ice, starting with mixing the DNA and water, adding the buffer, and finally the enzyme. Gently mix the reaction by pipetting up and down, microcentrifuge briefly, and then incubate at room temperature for 10 minutes. After incubation, heat inactivate the T4 ligase at 65°C for 10 minutes. Cool the sample on ice. In the final step, use 2 μl of the ligated plasmid to transform 10-beta competent E. coli cells (see below).

[0406] c) Cloning via R site assembly:

[0407] In order to assemble, all DNA fragments with R sites at the ends are pipetted on ice. When assembling more than 4 fragments, according to the manufacturer's advice, the equimolar ratio (0.05ng) ​​of all fragments is used. Half of the reaction mixture is presented by NEBuilderHiFi DNA assembly master mix. The total reaction volume is 40 μl, and is reached by filling PCR clean water. An exemplary pipetting scheme is described in the following table.

[0408] Table: Assembly reaction mixture

[0409]

[0410] After the reaction mixture was set up, the tubes were incubated in a thermocycler at a constant 50° C. for 60 minutes. After successful assembly, 2 μl of the assembled plasmid DNA was used to transform 10-β competent E. coli (see below).

[0411] d) Transformation of 10-β competent E. coli cells:

[0412] For transformation, 10-β competent E. coli cells were thawed on ice. Afterwards, 2 μl of plasmid DNA was directly transferred into the cell suspension. The tube was flicked and placed on ice for 30 minutes. Thereafter, the cells were placed in a warm heat block at 42°C and heat shocked for exactly 30 seconds. Next, the cells were cooled on ice for 2 minutes. 950 μl of NEB 10-β growth medium was added to the cell suspension. The cells were incubated at 37°C with shaking for one hour. Then, 50-100 μl was pipetted onto a preheated (37°C) LB-Amp agar plate and smeared with a disposable spatula. The plates were incubated at 37°C overnight. Only bacteria that successfully incorporated a plasmid carrying the ampicillin resistance gene could grow on these plates. Single colonies were picked the next day and cultured in LB-Amp medium for subsequent plasmid preparation.

[0413] e) Bacterial culture:

[0414] E. coli was cultured in LB medium (abbreviation of Luria Bertani) spiked with 1 ml / L of 100 mg / ml ampicillin to give an ampicillin concentration of 0.1 mg / ml. For different amounts of plasmid preparation, the following amounts were inoculated with a single bacterial colony.

[0415] Table: E. coli culture volume

[0416]

[0417] For small-scale preparation, fill each well of a 96-well 2 ml deep-well plate with 1.5 ml of LB-Amp medium. Pick colonies and insert toothpicks into the medium. When all colonies are picked, seal the plate with a sticky air porous membrane. Incubate the plate in a 37°C incubator at 200 rpm shaking speed for 23 hours.

[0418] For small-scale preparation, 3.6 ml of LB-Amp medium was filled in a 15 ml tube (with vented cap) and inoculated with bacterial colonies. During incubation, the toothpick was not removed but left in the tube. As with the 96-well plate, the tube was incubated at 37°C, 200 rpm for 23 hours.

[0419] For large-scale preparation, 200 ml of LB-Amp medium was filled into an autoclaved 1 L Erlenmeyer glass conical flask and inoculated with 1 ml of bacterial day culture approximately 5 hours later. The conical flask was closed with a paper stopper and incubated at 37°C, 200 rpm for 16 hours.

[0420] f) Plasmid preparation:

[0421] For miniprep, 50 μl of bacterial suspension is transferred to a 1 ml deep well plate. Afterwards, the bacterial cells are centrifuged in the plate at 3000 rpm, 4°C for 5 min. The supernatant is removed and the plate with the bacterial pellet is placed in the EpMotion. After approximately 90 minutes, the run is complete and the eluted plasmid DNA can be removed from the EpMotion for further use.

[0422] For the miniprep, remove the 15 ml tube from the incubator and divide 3.6 ml of the bacterial culture into two 2 ml Eppendorf tubes. Centrifuge the tubes at 6,800 x g for 3 minutes at room temperature in a benchtop microcentrifuge. Afterwards, perform the miniprep using the Qiagen QIAprep Spin Miniprep Kit according to the manufacturer's instructions. Measure the plasmid DNA concentration using a Nanodrop.

[0423] Large quantities were prepared using the Macherey-Nagel method according to the manufacturer's instructions. Xtra MaxiEF kit was used. DNA concentration was measured with Nanodrop.

[0424] g) Ethanol precipitation:

[0425] Mix a certain volume of DNA solution with 2.5 times the volume of 100% ethanol. Incubate the mixture at -20°C for 10 min. Then centrifuge the DNA at 14,000rpm, 4°C for 30 min. Carefully remove the supernatant and wash the pellet with 70% ethanol. Centrifuge the tube again at 14,000rpm, 4°C for 5 min. Carefully remove the supernatant by pipetting and dry the pellet. After the ethanol has evaporated, add an appropriate amount of endotoxin-free water. Give the DNA time to re-dissolve in water at 4°C overnight. Take a small portion and measure the DNA concentration using a Nanodrop device.

[0426] Example 2

[0427] Plasmid generation

[0428] Expression cassette composition

[0429] For the expression of antibody chains, a transcription unit containing the following functional elements was used:

[0430] - The immediate early enhancer and promoter from human cytomegalovirus, including intron A,

[0431] - human heavy chain immunoglobulin 5'-untranslated region (5'UTR),

[0432] - mouse immunoglobulin heavy chain signal sequence,

[0433] - a nucleic acid encoding the corresponding antibody chain,

[0434] - bovine growth hormone polyadenylation sequence (BGH pA), and

[0435] - Optionally, human gastrin terminator (hGT).

[0436] In addition to the expression unit / cassette comprising the desired gene to be expressed, a basic / standard mammalian expression plasmid also contains:

[0437] - an origin of replication from the vector pUC18, which allows replication of this plasmid in E. coli, and

[0438] -β-lactamase gene, which confers ampicillin resistance in Escherichia coli.

[0439] Pre-vector cloning and post-vector cloning

[0440] To construct a double plasmid antibody construct, the antibody HC and LC fragments were cloned into the front vector backbone containing L3 and LoxFas sequences and the rear vector containing LoxFas and 2L sequences and the pac selection marker. The Cre recombinase plasmid pOG231 (Wong, ET, et al., Nucl. Acids Res. 33 (2005) e147; O'Gorman, S., et al., Proc. Natl. Acad. Sci. USA 94 (1997) 14602-14607) was used for all RMCE processes.

[0441] cDNA encoding each antibody chain is produced by gene synthesis (Geneart, Life Technologies Inc.). At 37°C, gene synthesis vector and backbone vector are digested for 1h with HindIII-HF and EcoRI-HF (NEB), and separated by agarose gel electrophoresis. DNA fragments of insert and backbone are cut from agarose gel, and extracted by QIAquick gel extraction kit (Qiagen). Purified insert and backbone fragments are connected with an insert / backbone ratio of 3:1 via a quick ligation kit (Roche) according to the manufacturer's scheme. Then the ligation method is transformed into competent Escherichia coli DH5α via heat shock at 42°C for 30 seconds, and incubated at 37°C for 1h, after which they are plated on agar plates containing ampicillin for selection. At 37°C, the plates are incubated overnight.

[0442] The next day, colonies were picked and incubated overnight at 37°C with shaking for either miniprep or maxiprep, which were prepared using 5075 (Eppendorf) or QIAprep Spin Miniprep Kit (Qiagen) / NucleoBond Xtra Maxi EF Kit (Macherey & Nagel). All constructs were sequenced to ensure the absence of any unwanted mutations (SequiServe GmbH).

[0443] In the second cloning step, the previously cloned vector was digested with KpnI-HF / SalI-HF and SalI-HF / MfeI-HF, the conditions being the same as for the first cloning. The TI backbone vector was digested with KpnI-HF and MfeI-HF. Isolation and extraction were performed as described above. Purified inserts and backbones were ligated using T4 DNA ligase (NEB) at a ratio of 1:1:1 insert / insert / backbone at 4°C overnight, and inactivated at 65°C for 10 min, as per the manufacturing protocol. The following cloning steps were performed as above.

[0444] The cloned plasmids were used for TI transfection and pool generation.

[0445] Example 3

[0446] Culture, transfection, selection and single cell cloning

[0447] TI host cells were propagated in a disposable 125 ml ventilated shake flask in a proprietary culture medium based on DMEM / F12 at a constant stirring rate of 150 rpm under standard humidified conditions (95% rH, 37°C and 5% CO2). Every 3-4 days, cells were inoculated in a chemically defined medium containing effective concentrations of selection marker 1 and selection marker 2 at a concentration of 3x10E5 cells / ml. The density and viability of the culture were measured using a Cedex HiRes cell counter (F. Hoffmann-La Roche Ltd, Basel, Switzerland).

[0448] For stable transfection, equimolar amounts of forward and reverse vectors were mixed. The total DNA used for each transfection was 30 μg, and the plasmid ratio was 2.5:2.5:1 (forward, reverse, Cre plasmid).

[0449] Two days before transfection, TI host cells were inoculated in fresh culture medium at a density of 4x10E5 cells / ml. According to the manufacturer's protocol, an OC-400 electroporation box was used to transfect using a MaxCyte STX electroporation device (MaxCyte Inc., Gaithersburg). 3x10E7 cells were transfected with a total of 30 μg of nucleic acid, i.e., 30 μg of plasmid (forward: reverse: Cre plasmid at a molar ratio of 2.5:2.5:1) or 5 μg of Cre mRNA and 25 μg of a mixture of front and back vectors. After transfection, cells were inoculated in 30 ml of culture medium without a selection agent.

[0450] On day 5 after inoculation, the cells were centrifuged and transferred to 80 mL of chemically defined medium containing effective concentrations of puromycin (selection agent 1) and 1-(2'-deoxy-2'-fluoro-1-β-D-arabinofuranosyl-5-iodo)uracil (FIAU; selection agent 2), 6x10E5 cells / ml, for selection of recombinant cells. From this day on, the cells were incubated at 37°C, 150 rpm, 5% CO2 and 85% humidity without splitting. The cell density and viability of the culture were monitored regularly. When the viability of the culture began to increase again, the concentrations of selection agents 1 and 2 were reduced to approximately half of the amount previously used.

[0451] In more detail, to facilitate the recovery of cells, if the viability>40% and the viable cell density (VCD)>0.5x10E6 cells / mL, the selection pressure is reduced. Therefore, 4x10E5 cells / ml are centrifuged and resuspended in 40ml selective medium II (chemically defined medium, 1 / 2 selection markers 1 and 2). The cells are incubated under the same conditions as before and are not split.

[0452] Ten days after the start of selection, the expression of intracellular GFP and extracellular heterologous polypeptides bound to the cell surface was measured by flow cytometry to check whether the cassette exchange mediated by Cre was successful. APC antibodies (F(ab')2 fragment goat anti-human IgG labeled with allophycocyanin) for human antibody light and heavy chains were used for FACS staining. Flow cytometry was performed using a BD FACS Canto II flow cytometer (BD, Heidelberg, Germany). Ten thousand events for each sample were measured. Live cells were gated in the forward scatter (FSC) to side scatter (SSC) graph. The live cell gate was defined by untransfected TI host cells and applied to all samples using FlowJo 10.8.1EN software (TreeStar, Olten, Switzerland). The fluorescence of GFP was quantified in the FITC channel (488nm excitation, 530nm detection). Heterologous polypeptides were measured in the APC channel (645nm excitation, 660nm detection). Parental CHO cells, those used for the production of TI host cells, were used as negative controls for GFP and heterologous polypeptide expression. Fourteen to twenty-one days after the start of selection, the viability exceeded 90% and selection was considered complete.

[0453] After selection, the stably transfected cell pool can be cloned into single cells by limiting dilution. For this purpose, cells are stained with Cell Tracker Green TM (Thermo Fisher Scientific, Waltham, MA) and seeded in 384-well plates at 0.6 cells / well. For single-cell cloning and all further culture steps, selection agent 2 was omitted from the culture medium. Wells containing only one cell were identified by bright field and fluorescence-based plate imaging. Only wells containing one cell were further considered. Approximately three weeks after seeding, colonies were picked from confluent wells and further cultured in 96-well plates.

[0454] Example 4

[0455] FACS screening

[0456] FACS analysis was performed to check transfection efficiency and RMCE efficiency of transfection. 4x10E5 cells of the transfection method were centrifuged (1200rpm, 4min) and washed twice with 1mL PBS. After the washing step with PBS, the pellet was resuspended in 400μL PBS and transferred to a FACS tube (with a cell strainer cap). The FACS Canto II was used for measurement, and the data were analyzed by FlowJo software.

[0457] Example 5

[0458] Fed-batch culture

[0459] In shake flask or Ambr 15 container (Sartorius Stedim), feed batch production culture is carried out using the culture medium determined by proprietary chemical composition.At the 0th day, with 2x10E6 cells / ml inoculation cells.At the 3rd, 7th and 10th days, proprietary feed matrix is ​​added to the culture.At the 0th, 3rd, 7th, 10th and 14th days, Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany) is used to measure the viable cell count (VCC) and the cell viability percentage in the culture.Use Cobas analyzer (Roche Diagnostics GmbH, Mannheim, Germany) at the 3rd, 5th, 7th, 10th, 12th and 14th day to measure glucose, lactic acid and product titer concentration.At fed batch culture start after 14 days, by centrifugation (10min, 1000rpm, and 10min, 4000rpm) harvest supernatant, and by filtering (0.22 μm) make it clear. Titers on day 14 were determined using protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper LifeSciences).

[0460] Example 6

[0461] RNP-based CRISPR-Cas9 gene knockout in CHO cells

[0462] Materials / Resources:

[0463] Geneious 2021.2.2 software for guidance and primer design

[0464] CHO TI host cell line; culture status: day 30-60

[0465] Gibco TrueCut Cas9 protein, A45220P, Thermo Fisher

[0466] sgRNA (custom designed for target gene, 3nm chemically modified sgRNA, Synthego)

[0467] Culture medium (200 μg / ml hygromycin B, 4 μg / ml selection agent 2)

[0468] DPBS-Dulbecco's Phosphate Buffered Saline without Ca and Mg (Thermo Fisher)

[0469] Microplate 24 deep well plate (Agilent Technology, Porvoir Science) with lid (homemade)

[0470] Slim RNase, DNase, and pyrogen-free filter tips for loading OC-100 cartridges.

[0471] (Biozyme)

[0472] Hera safety cover (Thermo Fisher)

[0473] Cedex HiRes Analyzer (Innovatis)

[0474] Liconic incubator Storex IC

[0475] HyClone electroporation buffer

[0476] MaxCyte OC-100 Box

[0477] MaxCyte STX electroporation system

[0478] CRISPR-Cas9 RNP delivery

[0479] RNPs were preassembled by mixing 30 pmol Cas9 with 30 pmol μg gRNA mixture (equal ratios for each gRNA - see the table below for exemplary gene-specific gRNA sequences) and incubated at RT for 20 minutes. Cells with a concentration between 2-4x10E6 cells / mL were centrifuged (3 minutes, 300g). The cells were then resuspended in 90 μL HyClone electroporation buffer. The pre-incubated RNP mixture was added to the cells and incubated for 5 minutes. The cell / RNP solution was then transferred to an OC-100 cuvette and electroporated using the MaxCyte electroporation system by program "CHO2". Immediately after electroporation, the cell suspension was transferred to 24 wells and incubated at 37°C for 30 minutes. Fresh and preheated culture medium was added to result in a final cell concentration of 1x10E6, and incubated at 37°C with 350 rpm shaking for cell expansion. For genomic DNA preparation (day 6 or 8), QuickExtract kit (Lucigen) was added to cells and used as PCR template. Specific gene amplicons were PCR amplified using standard Q5 hot start polymerase protocol (NEB) and gene-specific primers spanning gRNA target sites (see, e.g., table below). The corresponding amplicons were purified using QIAquick PCR purification kit (Qiagen) and analyzed by Sanger sequencing of Eurofins Genomics GmbH to verify gene inactivation by knockout.

[0480] Example 7

[0481] Fed-batch culture

[0482] In Ambr 15 or Ambr 250 containers (Sartorius Stedim), fed batch production culture is carried out using a proprietary chemical composition-determined culture medium. With 2x10E6 cells / ml inoculated cells. At the 3rd, 7th and 10th days, a proprietary feed matrix is ​​added to the culture. At the 0th, 3rd, 7th, 10th, 12th and 14th days, Cedex HiRes (Roche DiagnosticsGmbH, Mannheim, Germany) is used to measure the viable cell count (VCC) and cell viability percentage in the culture. Cobas analyzer (Roche Diagnostics GmbH, Mannheim, Germany) is used to measure glucose, lactic acid concentration and product titer at the 3rd, 5th, 7th, 10th, 12th and 14th days. After fed batch starts 10, 12 or 14 days, supernatant is harvested by centrifugation (10min, 1000rpm, then 10min, 4000rpm), and it is clarified by filtration (0.22 μm). The harvest titer was further determined using protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper Life Sciences).

[0483] Example 8

[0484] High cell density fed-batch culture

[0485] In Ambr 15 or Ambr 250 containers (Sartorius Stedim), the culture medium determined using proprietary chemical composition is used for fed-batch production cultivation.At the 0th day, with 15x10E6 cells / ml inoculated cells.At the 1st, 3rd and 6th days, proprietary feed matrix is ​​added to the culture.At the 0th, 3rd, 7th, 10th, 12th and 14th days, Cedex HiRes instrument (Roche Diagnostics GmbH, Mannheim, Germany) is used to measure the viable cell count (VCC) and the cell viability percentage in the culture.Use Cobas analyzer (Roche Diagnostics GmbH, Mannheim, Germany) at the 3rd, 5th, 7th, 10th, 12th and 14th days to measure glucose, lactic acid concentration and product titer.After cultivation starts 10 or 12 or 14 days, by centrifugation (10min, 1000rpm, then 10min, 4000rpm) harvest supernatant, and by filtering (0.22 μm) make it clear. The harvest titer was further determined using protein A affinity chromatography with UV detection. Product quality was determined by Caliper's LabChip (Caliper LifeSciences).

Claims

1. A modified mammalian cell in which the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes has been reduced or eliminated.

2. The modified mammalian cell according to claim 1, wherein MYC, SIRT-1, and ICAM-1 genes, or MYC, BAX, BAK, and SIRT-1 genes, or The expression of MYC, BAX, BAK, ICAM-1, and SIRT-1 genes was reduced or eliminated.

3. The modified mammalian cell according to claim 1 or 2, wherein the reduction or elimination is performed by gene knockout.

4. The modified mammalian cell of any one of claims 1 to 3, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites.

5. The modified mammalian cell of any one of claims 1 to 4, wherein the modified mammalian cell comprises one or two or more targeted integration landing sites, wherein one or more nucleic acids encoding a monospecific or multispecific antibody have been integrated into one targeted integration landing site.

6. The modified mammalian cell according to any one of claims 1 to 5, wherein said reduction or elimination of the expression of MAY, BAK, BAX, ICAM-1 or / and SIRT-1 genes has been achieved after stable introduction of one or more nucleic acids encoding heterologous proteins.

7. The modified mammalian cell according to any one of claims 1 to 6, wherein the modified cell is a modified CHO or CHO-K1 cell.

8. The modified mammalian cell according to any one of claims 1 to 6, wherein the modified cell is a modified HEK 293, HEK293T, BHK, A549 or HeLa cell.

9. A method for recombinantly producing a protein, the method comprising the following steps: a) culturing the modified mammalian cell according to any one of claims 1 to 8 in a culture medium under conditions suitable for expression of the protein, the modified mammalian cell comprising one or more nucleic acids encoding the protein, b) recovering said protein from said modified mammalian cell or said culture medium, c) optionally purifying the protein using one or more chromatography steps, and thereby recombinantly producing the protein.

10. The method according to claim 9, wherein the culturing lasts for 6 to 16 days.

11. The method according to claim 9 or 10, wherein the culture is initiated at a cell density of 5*10E6 cells / ml or higher.

12. The method according to any one of claims 9 to 11, wherein the culture is a fed-batch culture in which feeding is performed at least on day 1, day 4, day 7 and day 10.

13. The method according to any one of claims 9 to 12, wherein the modified mammalian cell is a modified CHO or CHO-K1 cell.

14. The method according to any one of claims 9 to 12, wherein the modified mammalian cell is a modified HEK 293, HEK293T, BHK, A549 or HeLa cell.

15. Use of reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a modified mammalian cell expressing a recombinant polypeptide for increasing the volumetric productivity of the modified mammalian cell.

16. Use of reduced or eliminated expression of the MYC gene and one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in modified mammalian cells for increasing cell volume.

17. Use of the reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a modified mammalian cell expressing a recombinant polypeptide for increasing the activity of a biological process.

18. Use of the reduction or elimination of the expression of the MYC gene and the expression of one or more of the BAK, BAX, SIRT-1 and ICAM-1 genes in a modified mammalian cell expressing a recombinant polypeptide for increasing / extending the culture time of the modified mammalian cell without cell division.

19. The use according to any one of claims 15 to 17, wherein MYC, SIRT-1, and ICAM-1 genes, or MYC, BAX, BAK, and SIRT-1 genes, or The expression of the MYC, BAX, BAK, ICAM-1, and SIRT-1 genes was permanently reduced or eliminated.

20. The use according to any one of claims 15 to 19, wherein the modified mammalian cell is a modified CHO or CHO-K1 cell.

21. The method of any one of claims 15 to 19, wherein the modified mammalian cell is a modified HEK293, HEK293T, BHK, A549 or HeLa cell.

Images