Application of targeted LRTOR in development of medicine for preventing and / or treating osimertinib drug resistance and invasion and metastasis of non-small cell lung cancer

Abstract

The invention belongs to the technical field of biology, discloses application of targeted LRTOR in development of drugs for preventing and / or treating osimertinib drug resistance and invasion and metastasis of non-small cell lung cancer, and particularly discloses application of an LncRNA LRTOR inhibitor in promoting sensitivity of tumors to osimertinib. The invention discloses that LncRNA LRTOR plays a crucial role in NSCLC osimertinib drug resistance for the first time, and can be used as a target for preventing and / or treating NSCLC osimertinib drug resistance and transfer. Targeted inhibition of LncRNA LRTOR can greatly enhance the sensitivity of NSCLC to osimertinib treatment, significantly inhibit the activity and proliferation of osimertinib drug-resistant cells, significantly inhibit the invasion and metastasis capacities and cell dryness of drug-resistant tumors, and inhibit the growth of osimertinib drug-resistant tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the application of targeting LRTOR in the development of drugs for preventing and / or treating osimertinib resistance and invasion and metastasis of non-small cell lung cancer. Background Art

[0002] EGFR mutation is the most common driver mutation in NSCLC, and approximately 50% of Asian NSCLC patients carry EGFR mutations. Although EGFR tyrosine kinase inhibitors (TKIs) initially work well for most patients with EGFR mutations, almost all patients eventually develop disease progression due to resistance to targeted drugs. T790M mutation is the main mechanism of acquired resistance to first- and second-generation EGFR-TKIs. The third-generation EGFR-TKI represented by osimertinib (OSI) is selective for EGFR T790M resistance mutations, has strong efficacy against EGFR-initiating mutations, and has few side effects. Although osimertinib has significant efficacy in the first- and second-line treatment of EGFR-mutated NSCLC, patients usually develop resistance in about a year. So far, there is still a lack of effective alternative therapies for osimertinib resistance.

[0003] Only about 1.2% of human genes encode proteins, and more than 98% of RNA is non-coding RNA (ncRNA). Among them, ncRNA with a length greater than 200 nucleotides is called long non-coding RNA (lncRNA). Studies have shown that abnormal expression of lncRNA is common in tumors. LncRNA can induce tumor resistance by enhancing DNA repair, changing signal transduction, affecting mitochondrial function, regulating cell cycle progression, inducing EMT and cancer stem cell (CSC) transformation.

[0004] Currently, no effective LncRNA has been found for preventing and / or treating osimertinib resistance in non-small cell lung cancer, so the present invention is proposed. Summary of the invention

[0005] The present invention aims to reveal the application of targeted inhibition of lncRNA LRTOR in preventing and / or treating NSCLC osimertinib resistance and invasion and metastasis, and experimentally confirms the feasibility and application value of targeted inhibition of LRTOR in preventing and / or treating NSCLC osimertinib resistance and invasion and metastasis.

[0006] The purpose of the first aspect of the present invention is to provide the use of LncRNA LRTOR inhibitors.

[0007] The second aspect of the present invention aims to provide an RNA.

[0008] The third aspect of the present invention aims to provide biological materials related to the RNA of the second aspect of the present invention.

[0009] The fourth aspect of the present invention aims to provide a product.

[0010] The purpose of the fifth aspect of the present invention is to provide the application of the RNA of the second aspect of the present invention, the biological material of the third aspect of the present invention or the product of the fourth aspect of the present invention.

[0011] The sixth aspect of the present invention aims to provide the use of LncRNA LRTOR as a target in the development of products for preventing and / or treating osimertinib resistance and lung cancer cell invasion and / or metastasis.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] The first aspect of the present invention provides a use of a LncRNA LRTOR inhibitor in any one of (a1) to (a7):

[0014] (a1) Promote tumor sensitivity to osimertinib;

[0015] (a2) preparing a product that increases the sensitivity of tumors to osimertinib;

[0016] (a3) inhibiting the invasion and / or metastasis ability of tumor cells;

[0017] (a4) preparing products that inhibit the proliferation, invasion and / or metastasis of tumor cells;

[0018] (a5) Inhibit tumor cell stemness;

[0019] (a6) preparing products that inhibit tumor cell stemness;

[0020] (a7) Treating and / or preventing tumors.

[0021] In some embodiments of the present invention, the LncRNA LRTOR inhibitor is at least one of a substance that inhibits the activity of LncRNA LRTOR, a substance that degrades LncRNA LRTOR, and a substance that reduces the expression level of LncRNA LRTOR.

[0022] In some embodiments of the present invention, the substance that reduces the expression level of LncRNA LRTOR is at least one of (b1) to (b4):

[0023] (b1) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting LncRNA LRTOR;

[0024] (b2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting LncRNA LRTOR described in (b1);

[0025] (b3) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (b2);

[0026] (b4) Small molecule compounds and antibodies targeting LncRNA LRTOR.

[0027] In some embodiments of the present invention, the LncRNA LRTOR inhibitor is at least one of (b5) to (b7):

[0028] (b5) siRNA or shRNA targeting LncRNA LRTOR;

[0029] (b6) a nucleic acid molecule encoding the siRNA or shRNA targeting LncRNA LRTOR described in (b5);

[0030] (b7) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (b6).

[0031] In some embodiments of the present invention, the sequence of the sense strand of the siRNA is as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0032] In some embodiments of the present invention, the sequence of the positive strand of the shRNA is shown in SEQ ID NO:4.

[0033] In some embodiments of the present invention, the tumor comprises lung cancer.

[0034] In some embodiments of the present invention, the lung cancer includes non-small cell lung cancer.

[0035] In some embodiments of the present invention, the tumor cells described in (a3) ​​to (a6) include tumor cells resistant to osimertinib and tumor cells sensitive to osimertinib.

[0036] In some embodiments of the present invention, the nucleotide sequence of the LncRNA LRTOR is shown in SEQ ID NO:6.

[0037] For the first time, it was revealed that long noncoding RNA (lncRNA) LRTOR plays a key role in osimertinib resistance and invasion and metastasis of non-small cell lung cancer (NSCLC). RNAi knockdown / silencing of LRTOR significantly reversed osimertinib resistance and inhibited NSCLC invasion and metastasis, indicating that LRTOR can be used as a molecular target for the prevention and treatment of osimertinib resistance and invasion and metastasis of NSCLC.

[0038] The second aspect of the present invention provides an RNA which is siRNA and / or shRNA;

[0039] The sequence of the sense strand of the siRNA is shown in SEQ ID NO: 2 or SEQ ID NO: 3;

[0040] The sequence of the positive strand of the shRNA is shown in SEQ ID NO:X.

[0041] The third aspect of the present invention provides a biological material related to the RNA of the second aspect of the present invention, wherein the biological material comprises any one of (c1) to (c12):

[0042] (c1) a nucleic acid molecule encoding the RNA of the present invention;

[0043] (c2) an expression cassette comprising the nucleic acid molecule described in (c1);

[0044] (c3) a vector comprising the nucleic acid molecule described in (c1);

[0045] (c4) a vector comprising the expression cassette described in (c2);

[0046] (c5) a transgenic cell line comprising the nucleic acid molecule described in (c1);

[0047] (c6) a transgenic cell line comprising the expression cassette described in (c2);

[0048] (c7) a transgenic cell line comprising the vector described in (c3);

[0049] (c8) a transgenic cell line comprising the vector described in (c4);

[0050] (c9) a recombinant microorganism containing the nucleic acid molecule described in (c1);

[0051] (c10) a recombinant microorganism containing the expression cassette described in (c2);

[0052] (c11) a recombinant microorganism containing the vector described in (c3);

[0053] (c12) A recombinant microorganism containing the vector described in (c4)

[0054] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0055] In some embodiments of the present invention, the vector comprises a promoter, and the promoter is operably linked to the nucleic acid molecule.

[0056] In some embodiments of the present invention, the vector is independently selected from a non-pathogenic viral vector and a non-viral vector.

[0057] In some embodiments of the present invention, the non-pathogenic viral vector comprises an adenoviral vector or a retroviral vector.

[0058] In some embodiments of the present invention, the non-viral vector comprises a plasmid vector.

[0059] In some embodiments of the present invention, the vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a bacteriophage, a cosmid, a F cosmid, or an artificial chromosome.

[0060] In some embodiments of the present invention, the plasmid vector may be an optional plasmid, and the viral vector may be an optional virus.

[0061] The fourth aspect of the present invention provides a product, comprising the RNA of the second aspect of the present invention or the biological material of the third aspect of the present invention.

[0062] In some embodiments of the present invention, the product has at least one of the functions (d1) to (d4):

[0063] (d1) Promote tumor sensitivity to osimertinib;

[0064] (d2) inhibiting the proliferation, invasion and / or metastasis of tumor cells;

[0065] (d3) inhibiting tumor cell stemness;

[0066] (d4) Treatment and / or prevention of tumors.

[0067] In some embodiments of the present invention, the product includes at least one of a drug, a reagent, and a kit.

[0068] In some embodiments of the present invention, the tumor comprises lung cancer.

[0069] In some embodiments of the present invention, the lung cancer includes non-small cell lung cancer.

[0070] In some embodiments of the present invention, the tumor cells include tumor cells that are resistant to osimertinib and tumor cells that are sensitive to osimertinib.

[0071] The fifth aspect of the present invention provides the use of the RNA of the second aspect of the present invention, the biomaterial of the third aspect of the present invention and / or the product of the fourth aspect of the present invention in any one of (a1) to (a7)

[0072] (a1) Promote tumor sensitivity to osimertinib;

[0073] (a2) preparing a product that increases the sensitivity of tumors to osimertinib;

[0074] (a3) inhibiting the proliferation, invasion and / or metastasis of tumor cells;

[0075] (a4) preparing products that inhibit the invasion and / or metastasis ability of tumor cells;

[0076] (a5) Inhibit tumor cell stemness;

[0077] (a6) preparing products that inhibit tumor cell stemness;

[0078] (a7) Treating and / or preventing tumors.

[0079] In some embodiments of the present invention, the tumor comprises lung cancer.

[0080] In some embodiments of the present invention, the lung cancer includes non-small cell lung cancer.

[0081] In some embodiments of the present invention, the tumor cells include tumor cells that are resistant to osimertinib and tumor cells that are sensitive to osimertinib.

[0082] A sixth aspect of the present invention provides the use of LncRNA LRTOR as a target in developing products for preventing and / or treating osimertinib resistance and lung cancer cell invasion and / or metastasis.

[0083] The beneficial effects of the present invention are:

[0084] The present invention provides a novel non-coding RNA, named LncRNA LRTOR, which plays a vital role in NSCLC osimertinib resistance and can be used as a target for the prevention and / or treatment of NSCLC osimertinib resistance and metastasis. Experiments have shown that targeted inhibition of LncRNA LRTOR can greatly enhance the sensitivity of NSCLC to osimertinib treatment, significantly inhibit the viability and proliferation of osimertinib-resistant cells, significantly inhibit the invasion and metastasis ability of resistant tumors and cell stemness, and inhibit the growth of osimertinib-resistant tumors. Therefore, LncRNA LRTOR inhibitors (including siRNA, miRNA, and small molecule compounds, etc.) are expected to become drugs for preventing and / or treating NSCLC osimertinib resistance and invasion and metastasis and are used in clinical practice, providing a new treatment option for patients with osimertinib resistance and tumor metastasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1The effect of LRTOR silencing on osimertinib resistance, invasion and metastasis of NSCLC; (A) LRTOR silencing significantly inhibited the viability of osimertinib-resistant cells; (B) LRTOR silencing significantly inhibited the clone formation of osimertinib-resistant cells; (C) LRTOR silencing significantly inhibited the invasion and metastasis markers (ZEB1, ZEB2, E-cadhenrin, N-cadhenrin, Vimentin, Snail) and tumor stemness markers (CD44 and CD133) of osimertinib-resistant cells; (D) LRTOR silencing significantly inhibited the invasion and metastasis ability of osimertinib-resistant cells; (E) LRTOR silencing significantly inhibited the growth of osimertinib-resistant tumors; (F) Pathological section analysis of LRTOR silencing inhibiting the growth of osimertinib-resistant tumors, scale is 100μm; (G) Effect of LRTOR silencing on the growth curve of osimertinib-resistant tumors; (H) Effect of LRTOR silencing on the weight of osimertinib-resistant tumors; in the figure, sh-NC, control cells; sh-LRTOR, LRTOR silenced cells, *** represents p < 0.001.

[0086] Figure 2 The effects of LRTOR overexpression on osimertinib resistance, invasion and metastasis of NSCLC; (A) LRTOR overexpression significantly enhanced the cell viability of NSCLC cells under the action of osimertinib; (B) LRTOR overexpression significantly enhanced the clone formation ability of NSCLC cells under the action of osimertinib; (C) The effect of LRTOR overexpression on the invasion and metastasis markers (ZEB1, ZEB2, E-cadhenrin, N-cadhenrin, Vimentin, Snail) and tumor stemness markers (CD44 and CD133) of osimertinib-resistant cells. (D) LRTOR overexpression significantly enhances the invasion and metastasis ability of NSCLC cells; (E) LRTOR overexpression significantly promotes the growth of NSCLC tumors and tolerance to osimertinib treatment; (F) Pathological section analysis of LRTOR overexpression promoting the growth of NSCLC tumors and tolerance to osimertinib treatment, scale is 100μm; (G) Effect of LRTOR overexpression on the growth curve of NSCLC tumors; (H) Effect of LRTOR overexpression on NSCLC tumor weight; In the figure, Vector, control cells; LRTOR, LRTOR overexpressing cells, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001.

[0087] Figure 3The figures show the effect of siRNA silencing LRTOR on the growth of organoid tumors derived from osimertinib-resistant NSCLC patients; (A) siRNA silencing LRTOR significantly inhibited the growth of organoid tumors derived from osimertinib-resistant NSCLC patients; (B) The effect of siRNA silencing LRTOR on the growth curve of organoid tumors derived from osimertinib-resistant NSCLC patients; (C) The effect of siRNA silencing LRTOR on the weight of organoid tumors derived from osimertinib-resistant NSCLC patients; (D) The effect of siRNA silencing LRTOR on mouse body weight; (E) Pathological section analysis of organoid tumors derived from osimertinib-resistant NSCLC patients by siRNA silencing LRTOR, with a scale of 100 μm; (F) The silencing efficiency of LRTOR in organoid tumors derived from osimertinib-resistant NSCLC patients after tail vein injection of si-LRTOR, ** represents p < 0.01, *** represents p < 0.001, **** represents p < 0.0001. DETAILED DESCRIPTION

[0088] The present invention is further described in detail below through specific examples.

[0089] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0090] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0091] The gene sequence of lncRNA LRTOR (abbreviated as LRTOR) mentioned in the example is shown in SEQ ID NO:6.

[0092]

[0093] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0094] Example 1 Effect of silencing LRTOR on osimertinib resistance and invasion and metastasis of NSCLC

[0095] The method for establishing an NSCLC osimertinib-resistant cell line is as follows: osimertinib-sensitive NSCLC cell lines HCC827 and H1975 cells are cultured in a culture medium containing 0.3 μM osimertinib, respectively, and the osimertinib concentration is gradually increased to 1 μM. The resistant cell lines are maintained in a culture medium containing 1 μM osimertinib to obtain NSCLC osimertinib-resistant cell lines.

[0096] The sh-NC plasmid and sh-LRTOR plasmid were co-transfected with PMD2.G and PSPAX2 into HEK293T, and the viral supernatants at 48 and 72 hours were collected and filtered. In order to construct the LRTOR silencing cell line, the viral supernatants were used to infect osimertinib-resistant cells for 72 hours and screened with 1 μg / mL puromycin for 14 consecutive days. Monoclonal cells were selected and cultured by limiting dilution method to obtain the corresponding LRTOR-silenced NSCLC osimertinib-resistant cell lines and negative control strains.

[0097] The sh-NC sequence (as a negative control group, a random sequence) is shown in SEQ ID NO: 1, and the sh-LRTOR#1 and sh-LRTOR#2 sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0098] CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG (such as SEQ ID NO: 1).

[0099] CCGGGCACTGCTCCCTCATGATTTCCTCGAGGAAATCATGAGGGAGCAGTGCTTTTT (SEQ ID NO: 2).

[0100] CCGGGCACCTGCCTAAGACTAATATCTCGAGATATTAGTCTTAGGCAGGTGCTTTTT (SEQ ID NO: 3).

[0101] To evaluate the effect of LRTOR silencing on the viability of osimertinib-resistant cells, osimertinib-resistant cells were cultured in 96-well plates at a density of 2,000 cells per well. TMII luminescent cell viability assay kit was used to measure cell viability according to the manufacturer's instructions. To evaluate the effect of LRTOR silencing on the proliferation and clonogenicity of osimertinib-resistant cells, cells were cultured in 6-well plates at a density of 700 cells per well and allowed to grow for 14 days. Afterwards, cells were fixed with 4% paraformaldehyde and tumor cell clonogenicity was observed with crystal violet staining.

[0102] The results are as follows Figure 1 As shown in A and B, after LRTOR silencing, osimertinib-resistant cells regained sensitivity to osimertinib.

[0103] To evaluate the effect of LRTOR silencing on the invasion and metastasis of osimertinib-resistant cells, 50,000 LRTOR-silenced or control-negative cells were resuspended in serum-free medium and inoculated in the upper chamber of Transwell. 1 mL of complete medium containing 20% ​​serum was added to the lower chamber. After 24 hours, the cells were fixed with 4% paraformaldehyde and stained with crystal violet. After wiping off the cells that did not pass through the membrane in the upper chamber, the number of cells was observed under a microscope and recorded, and Western Blot was used to detect the invasion and metastasis markers (ZEB1, ZEB2, E-cadhenrin, N-cadhenrin, Vimentin, Snail) and tumor stemness markers (CD44 and CD133) of osimertinib-resistant cells.

[0104] The results are as follows Figure 1 As shown in C and D, after LRTOR silencing, the invasion and metastasis abilities of osimertinib-resistant cells were significantly reduced, and the expressions of related genes were significantly decreased.

[0105] LRTOR silenced or control negative cells were implanted into 6-week-old male Balb / c nude mice, with 1 million cells per mouse. When the tumor grew to 50 mm 3 Afterwards, the mice were randomly divided into (a) sh-NC + saline group, (b) sh-NC + osimertinib group, (c) sh-LRTOR + saline group, and (d) sh-LRTOR + osimertinib group, with 5 mice in each group. The LRTOR silencing group or the negative control group was intragastrically administered with saline or 5 mg / kg osimertinib every day. When the maximum tumor volume was close to 1500 mm 3 The mice were killed and the (1) tumor growth curve; (2) tumor weight; and (3) tumor pathology (H&E staining) were observed.

[0106] like Figure 1 As shown in Figures E to H, silencing LRTOR can significantly inhibit tumor growth and promote tumor sensitivity to osimertinib treatment.

[0107] Example 2 Effect of overexpression of LRTOR on osimertinib resistance and invasion and metastasis of NSCLC

[0108] The empty plasmid (Vector) and LRTOR overexpression plasmid (LRTOR) were co-transfected with PMD2.G and PSPAX2 into HEK293T, and the viral supernatants at 48 and 72 hours were collected and filtered. In order to construct the LRTOR overexpression cell line, the viral supernatant was used to infect osimertinib-sensitive cells (HCC827 and H1975 cells) for 72 hours, and 10 μg / mL rice blast was used for continuous screening for 14 days. Monoclonal cells were selected and cultured by limiting dilution method to obtain osimertinib-sensitive cells overexpressing LRTOR and negative control cells.

[0109] To evaluate the effect of overexpression of LRTOR on the viability of osimertinib-sensitive cells, cells were cultured at a density of 2,000 cells per well in 96-well plates. TM II Luminescent Cell Viability Assay Kit was used to measure cell viability according to the manufacturer's instructions. To evaluate the effect of overexpression of LRTOR on the proliferation and clone formation of osimertinib-sensitive cells, cells were cultured in 6-well plates at a density of 700 cells per well and allowed to grow for 14 days. Afterwards, cells were fixed with 4% paraformaldehyde and clone formation was observed with crystal violet staining.

[0110] The results are as follows Figure 2 As shown in Figures A and B, after overexpression of LRTOR, the sensitivity of parental cells to osimertinib was significantly reduced.

[0111] To evaluate the effect of LRTOR overexpression on the invasion and metastasis of osimertinib-sensitive cells, 50,000 LRTOR overexpressing or control negative cells were resuspended in serum-free medium and inoculated in the upper chamber. 1 mL of complete medium containing 20% ​​serum was added to the lower chamber. After 24 hours, the cells were fixed with 4% paraformaldehyde and stained with crystal violet. After wiping off the cells that did not pass through the membrane in the upper chamber, the number of cells was observed under a microscope and recorded. Western Blot was used to detect invasion and metastasis markers (ZEB1, ZEB2, E-cadhenrin, N-cadhenrin, Vimentin, Snail) and tumor stemness markers (CD44 and CD133) of osimertinib-resistant cells.

[0112] The results are as follows Figure 2 As shown in C and D, after LRTOR overexpression, the invasion and metastasis abilities of parental cells were significantly enhanced.

[0113] LRTOR overexpressing or control negative cells were implanted into 6-week-old male Balb / c nude mice, with 1 million cells per mouse. When the tumor grew to 50 mm 3Afterwards, the mice were randomly divided into (a) Vector+saline group, (b) Vector+osimertinib group, (c) LRTOR+saline group, and (d) LRTOR+osimertinib group, with 6 mice in each group. The LRTOR overexpression group or negative control group was intragastrically administered with saline or 3 mg / kg osimertinib every day. When the maximum tumor volume was close to 1500 mm 3 The mice were killed and (1) tumor growth curve; (2) tumor weight; and (3) tumor pathological condition were observed.

[0114] The results are as follows Figure 2 As shown in Figures E to H, overexpression of LRTOR significantly promoted tumor growth and inhibited the sensitivity of tumors to osimertinib treatment.

[0115] Example 3 Effect of siRNA silencing LRTOR on the growth of organoid tumors from osimertinib-resistant NSCLC patients

[0116] After the osimertinib-resistant patient-derived organoids were digested into single cells, 3 million cells per cell were implanted into 6-week-old male Balb / c nude mice. 3 Afterwards, the mice were randomly divided into (a) si-NC + saline group, (b) si-NC + osimertinib group, (c) si-LRTOR + saline group, and (d) si-LRTOR + osimertinib group, with 6 mice in each group. 75 mg / kg 2'-OMe and Chol-modified si-LRTOR or control siRNA were injected into the tail vein, and saline or 5 mg / kg osimertinib was given by gavage every day. When the maximum tumor volume was close to 1500 mm 3 , and the mice were killed. Observe (1) the growth curve of the tumor; (2) the weight of the tumor; (3) the pathological condition of the tumor; (4) the weight change of the mice; (5) the silencing efficiency of si-LRTOR. Among them, the positive chain sequence of si-LRTOR is: GGAGAGUAGAGAAAGCUAACU (SEQ ID NO: 4). The positive chain sequence of the control siRNA (i.e., si-NC) is: UUCUCCGAACGUGUCACGU (SEQ ID NO: 5).

[0117] The results are as follows Figure 3 As shown in Figures A to F, siRNA silencing LRTOR can significantly inhibit tumor growth and significantly enhance the sensitivity of tumors to osimertinib treatment.

[0118] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a lncRNA LRTOR inhibitor in any one of (a1) to (a7): (a1) Promote tumor sensitivity to osimertinib; (a2) preparing a product that increases the sensitivity of tumors to osimertinib; (a3) inhibiting the invasion and / or metastasis ability of tumor cells; (a4) preparing products that inhibit the proliferation, invasion and / or metastasis of tumor cells; (a5) Inhibit tumor cell stemness; (a6) preparing products that inhibit tumor cell stemness; (a7) Treating and / or preventing tumors.

2. The use according to claim 1, characterized in that: The LncRNA LRTOR inhibitor is at least one of a substance that inhibits the activity of LncRNA LRTOR, a substance that degrades LncRNA LRTOR, and a substance that reduces the expression level of LncRNA LRTOR; Preferably, the substance that reduces the expression level of LncRNA LRTOR is at least one of (b1) to (b4): (b1) siRNA, dsRNA, miRNA, ribozyme or shRNA targeting LncRNA LRTOR; (b2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting LncRNA LRTOR described in (b1); (b3) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (b2); (b4) Small molecule compounds and antibodies targeting LncRNA LRTOR.

3. The use according to claim 2, characterized in that: The LncRNA LRTOR inhibitor is at least one of (b5) to (b7): (b5) siRNA or shRNA targeting LncRNA LRTOR; (b6) a nucleic acid molecule encoding the siRNA or shRNA targeting LncRNA LRTOR described in (b5); (b7) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (b6); Preferably, the sequence of the sense strand of the siRNA is as shown in SEQ ID NO: 2 or SEQ ID NO: 3; Preferably, the sequence of the positive strand of the shRNA is as shown in SEQ ID NO:

4.

4. The use according to any one of claims 1 to 3, characterized in that: The tumor includes lung cancer; and / or the tumor cells described in (a3) ​​to (a6) include tumor cells resistant to osimertinib and tumor cells sensitive to osimertinib.

5. An RNA that is siRNA and / or shRNA; The sequence of the sense strand of the siRNA is shown in SEQ ID NO: 2 or SEQ ID NO: 3; The sequence of the positive strand of the shRNA is shown in SEQ ID NO:

4.

6. A biological material related to the RNA according to claim 5, wherein the biological material comprises any one of (c1) to (c12): (c1) a nucleic acid molecule encoding the RNA according to claim 5; (c2) an expression cassette comprising the nucleic acid molecule described in (c1); (c3) a vector comprising the nucleic acid molecule described in (c1); (c4) a vector comprising the expression cassette described in (c2); (c5) a transgenic cell line comprising the nucleic acid molecule described in (c1); (c6) a transgenic cell line comprising the expression cassette described in (c2); (c7) a transgenic cell line comprising the vector described in (c3); (c8) a transgenic cell line comprising the vector described in (c4); (c9) a recombinant microorganism containing the nucleic acid molecule described in (c1); (c10) a recombinant microorganism containing the expression cassette described in (c2); (c11) a recombinant microorganism containing the vector described in (c3); (c12) A recombinant microorganism containing the vector described in (c4).

7. A product comprising the RNA of claim 5 or the biological material of claim 6; Preferably, the product has at least one of the functions (d1) to (d4): (d1) Promote tumor sensitivity to osimertinib; (d2) inhibiting the proliferation, invasion and / or metastasis of tumor cells; (d3) inhibiting tumor cell stemness; (d4) Treatment and / or prevention of tumors.

8. Use of the RNA according to claim 5, the biological material according to claim 6 and / or the product according to claim 7 in any one of (a1) to (a7) (a1) Promote tumor sensitivity to osimertinib; (a2) preparing a product that increases the sensitivity of tumors to osimertinib; (a3) inhibiting the proliferation, invasion and / or metastasis of tumor cells; (a4) preparing products that inhibit the invasion and / or metastasis ability of tumor cells; (a5) Inhibit tumor cell stemness; (a6) preparing products that inhibit tumor cell stemness; (a7) Treating and / or preventing tumors.

9. The use according to claim 8, characterized in that: The tumor includes lung cancer; and / or the tumor cells described in (a3) ​​to (a6) include tumor cells resistant to osimertinib and tumor cells sensitive to osimertinib.

10. Application of lncRNA LRTOR as a target in the development of products for preventing and / or treating osimertinib resistance in lung cancer and invasion and / or metastasis of lung cancer cells.

Images