Copper-based DNA nano material and application thereof in tumor treatment

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a copper-based DNA nano-material and application thereof in tumor treatment, the copper-based DNA nano-material accurately down-regulates a BMAL1 gene through a CRISPR-Cas13d system, disturbs a cell metabolic pathway, and enhances the copper death effect in tumor cells. By accurately adjusting BMAL1 gene expression and triggering copper death, efficient killing of tumor cells is achieved, and the selectivity and efficiency of treatment are improved through a dual mechanism; the strategy not only can overcome the non-specificity problem of an existing copper delivery system, but also can regulate the metabolic pathway of tumor cells and weaken the metabolic steady state of the tumor cells, so that the sensitivity of the cells to copper death is improved, and the treatment effect is enhanced; in combination with the precise gene editing capability of a CRISPR-Cas13d system, the method has wide application potential in the aspect of personalized cancer treatment, provides a brand new treatment idea for anti-cancer therapy, and particularly has important prospects in the fields of copper death induction treatment and biological clock gene regulation.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a copper-based DNA nanomaterial and an application thereof in tumor treatment. Background Art

[0002] Biological clock genes are core genes that regulate the circadian rhythm in organisms. They play a key role in controlling important physiological processes such as cell proliferation, metabolism and apoptosis. As one of the core biological clock genes, BMAL1 (Brain and Muscle ARNT-Like 1) not only regulates the circadian rhythm, but is also closely related to the cell cycle, metabolic balance, and cell survival and death. Studies have shown that BMAL1 plays an important role in the occurrence and development of various cancers. Its main mechanism of action is to affect the growth and drug resistance of tumor cells by regulating intracellular energy metabolism, redox balance and apoptosis pathways.

[0003] In normal cells, BMAL1 supports cell survival by maintaining cell cycle stability, promoting metabolic homeostasis, and enhancing cellular antioxidant capacity. However, BMAL1 dysregulation in tumor cells may promote uncontrolled cell proliferation, inhibit cell apoptosis, and enhance the antioxidant capacity of tumor cells, thereby promoting tumorigenesis and drug resistance. Studies have found that downregulating BMAL1 in tumor cells can induce cell cycle arrest and promote apoptosis. Therefore, BMAL1 has become a promising target for cancer treatment.

[0004] Copper death is a new type of cell death discovered in recent years. It is characterized by the accumulation of copper ions in cells, which in turn leads to the aggregation of mitochondrial proteins and the instability of iron-sulfur clusters, thus inducing cell death. Unlike traditional cell death methods (such as apoptosis, necrosis, pyroptosis, etc.), the occurrence of copper death mainly depends on the excessive accumulation of copper ions in cells. Copper ions bind to dihydrolipoyltransferase (DLAT) in mitochondria, breaking the stability of iron-sulfur clusters in the tricarboxylic acid cycle (TCA cycle), leading to protein toxicity accumulation and ultimately inducing cell death.

[0005] As an essential trace element for the human body, copper plays an important role in a variety of biological reactions of cells, especially in cellular energy metabolism and antioxidant responses. However, in tumor cells, excessive accumulation of copper can cause cell death by triggering copper death. Studies have found that the pathway of copper death provides a new therapeutic strategy for tumor treatment, especially for those tumor types that are resistant to traditional treatments. By increasing copper accumulation in tumor cells or triggering copper death by regulating related pathways, researchers have successfully triggered tumor cell death, showing the potential of copper as an anti-cancer therapy.

[0006] At present, studies have used copper-based substances to induce tumor cell death, especially when copper ions can activate intracellular oxidative stress through the Fenton reaction, triggering specific cell death pathways, such as copper death. However, the current copper delivery system still faces some challenges, which limits the effectiveness and safety of its clinical application. The main problems include: tumor cells usually lack sufficient copper transporters, which limits the accumulation of copper ions in tumor cells, thereby affecting the effectiveness of copper death. The design of existing copper carriers often cannot overcome this problem, resulting in insufficient accumulation of copper ions and failure to fully activate copper death. Insufficient regulation of tumor cell metabolism: Most existing treatment strategies focus on increasing the bioaccumulation of copper, but ignore the metabolic characteristics of tumor cells, especially the metabolic pathways under the regulation of circadian clock genes. Tumor cells often evade cell death by changing metabolic pathways (such as aerobic glycolysis, lactic acid fermentation, etc.). The lack of regulation of these metabolic pathways limits the effectiveness of existing treatment options. Summary of the invention

[0007] The present invention solves the above technical problems existing in the prior art and provides a copper-based DNA nanomaterial and its application in tumor treatment, wherein the copper-based DNA nanomaterial can selectively downregulate the expression of the BMAL1 gene in tumor cells. The nanomaterial is equipped with a CRISPR-Cas13d system, which accurately targets the BMAL1 gene through RNA targeting technology, thereby increasing the sensitivity of tumor cells to copper death.

[0008] The technical solution of the present invention is as follows:

[0009] A copper-based DNA nanomaterial, wherein the copper-based DNA nanomaterial is Cu-DNA@CRISPR-Cas13d / BMAL1sgRNA (abbreviated as Cu-RNP);

[0010] The Cu-DNA is a copper-based delivery carrier, in which copper ions and DNA form a complex through coordination reaction;

[0011] The CRISPR-Cas13d / BMAL1 sgRNA is a Cas13d protein that reacts with an sgRNA targeting BMAL1 to form a Cas13d RNP complex.

[0012] The Cu-DNA complex and the Cas13dRNP complex form a Cu-RNP complex through self-assembly.

[0013] Preferably, the Cu-RNP complex is a spherical nanoparticle with a particle size of about 90-150 nm.

[0014] Preferably, the molar ratio of the Cu-DNA to the CRISPR-Cas13d / BMAL1 sgRNA is 1:1.

[0015] Preferably, the self-assembly condition is: reacting in a buffer system at 37° C. for 30 minutes or more.

[0016] Preferably, in the Cu-DNA complex, the DNA includes BMAL1 targeting DNA and template DNA.

[0017] More preferably, the molar ratio of copper ions, BMAL1 targeting DNA, and template DNA is: 33.7:1:1

[0018] Preferably, the BMAL1 targeting DNA sequence is:

[0019] AGCCTACTGAGTTCAGCACATGAAAACATTAAGA, as shown in SEQ No. 1;

[0020] The template DNA sequence is:

[0021] ATGTCATCACGCCCACCCGCTGTGGAAGTGGATG, as shown in SEQ No. 2;

[0022] The sgRNA sequence for BMAL1 is:

[0023] GGCACUGGUGCAAAUUUGCACUAGUCUAAAACUCUUAAUGUUUUCAUGUGCUGAAC, as shown in SEQ No.3.

[0024] Preferably, the conditions for the coordination reaction between copper ions and DNA are as follows: after copper ions and DNA are mixed in a solution, they are incubated at 95° C. for 5 hours.

[0025] The copper-based DNA nanomaterial Cu-RNP of the present invention is injected into the animal body through the tail vein and accumulates in the tumor site of the xenotransplanted MCF-7 cells. It enters the MCF-7 cells through endocytosis and releases copper ions and CRISPR-Cas13d RNP in the tumor environment. On the one hand, Cu 2+ Cu is generated by glutathione +, while the depletion of FDX1 and LIAS led to DLAT heteromerization and caused mitochondrial damage, leading to copper death of cells. On the other hand, gene editing by CRISPR-Cas13dRNP reduced the level of BMAL1, which in turn led to a decrease in WEE1 levels, triggering cell apoptosis; at the same time, the disruption of the biological clock and the upregulation of p21 led to cell cycle arrest in the G2 / M phase; in addition, the effects on the metabolic levels of lactate and pyruvate hindered the normal metabolism of the tricarboxylic acid cycle, further enhancing copper death. By integrating multiple cell death pathways, the overall therapeutic effect of tumors was improved.

[0026] therefore,

[0027] The copper-based DNA nanomaterial of the present invention can be used to prepare drugs for inhibiting tumors.

[0028] The copper-based DNA nanomaterial of the present invention can be used to prepare drugs that interfere with biological clock genes and promote copper death of tumor cells.

[0029] Compared with the prior art, the advantages of the present invention are as follows:

[0030] The present invention provides an innovative copper-based DNA nano-delivery system (Cu-RNP), which has significant advantages in the application in tumor treatment, mainly in the following aspects:

[0031] (1) Precisely targeting tumor cells and inducing cell death: The present invention uses the CRISPR-Cas13d system to target and cut the mRNA of the BMAL1 gene in tumor cells, accurately downregulating the expression of BMAL1. BMAL1 is a key gene regulated by the biological clock and plays an important role in the proliferation, metabolism and cell cycle of tumor cells. Unlike traditional chemotherapy and radiotherapy methods, the present invention uses gene editing technology to achieve targeted therapy, effectively reducing the growth ability of tumor cells and enhancing the sensitivity of tumor cells to stress.

[0032] (2) Dual therapeutic mechanism: The Cu-RNP system of the present invention utilizes the catalytic effect of copper ions to induce "copper death" in tumor cells. By utilizing the reaction between copper ions and GSH in Cu-DNA nanoparticles, Cu-RNP can generate monovalent copper ions, triggering the Fenton reaction to produce free radicals, which in turn leads to cell death mechanisms such as mitochondrial dysfunction, protein aggregation, and lipid peroxidation. In addition to targeting BMAL1 through the CRISPR-Cas13d system, the present invention also disrupts the metabolic homeostasis of tumor cells by downregulating the BMAL1 gene, affecting the metabolism of lactate and pyruvate, and inhibiting glycolysis and the tricarboxylic acid cycle. This dual effect (gene editing and metabolic interference) makes it impossible for tumor cells to effectively resist oxidative stress, thereby promoting the death of tumor cells.

[0033] (3) Synergistic effect of multiple cell death mechanisms: The present invention can inhibit the proliferation and growth of tumor cells at different cellular levels through the synergistic effect of multiple cell death mechanisms such as copper death, cell cycle arrest and apoptosis. Compared with single drug treatment, Cu-RNP can significantly enhance the anti-tumor treatment effect and reduce the drug resistance of tumor cells to treatment through the synergistic effect of multiple mechanisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The preparation route of Cu-RNP;

[0035] Figure 2 The mechanism of action of Cu-RNP in tumor cells;

[0036] Figure 3 The activity of CRISPR-Cas13d in cleaving BMAL1 mRNA;

[0037] Figure 4 is the transmission electron microscopy image of Cu-RNP;

[0038] Figure 5 High-angle annular dark field-scanning transmission electron microscopy image of Cu-RNP and the corresponding element distribution map (C, Cu, S, N, P and O);

[0039] Figure 6 Cellular uptake and lysosomal escape of Cu-RNP (laser confocal image);

[0040] Figure 7 Real-time reverse transcription quantitative polymerase chain reaction was used to detect the cellular mRNA levels in different treatment groups. A is BMAL1; B is FDX1; C is LIAS;

[0041] Figure 8 Intracellular metabolite levels in different treatment groups, A is lactate; B is pyruvate;

[0042] Fig. 9 The mitochondrial membrane potential in cells of different treatment groups (laser confocal images);

[0043] Fig.10 is the intracellular ATP level in different treatment groups;

[0044] Fig.11 Real-time reverse transcription quantitative polymerase chain reaction was used to detect the intracellular WEE1 mRNA levels in different treatment groups;

[0045] Fig.12 Flow cytometry was used to detect cell apoptosis in different treatment groups;

[0046] Fig.13Real-time reverse transcription quantitative polymerase chain reaction was used to detect the intracellular p21 mRNA levels in different treatment groups;

[0047] Fig.14 Flow cytometry was used to detect the cell cycle status of different treatment groups;

[0048] Fig.15 Fluorescence images of live and dead cells stained for different treatment groups;

[0049] Fig.16 Construction of human breast cancer MCF-7 tumor-bearing mouse model and drug administration process;

[0050] Fig.17 Figure 2 shows the tumor treatment status. A is the tumor growth curve of MCF-7 tumor-bearing mice after treatment; B is the dissected photos of tumors in mice of different treatment groups; C is the average weight of dissected tumors in each group after treatment;

[0051] Fig.18 Western blot was used to detect the expression levels of proteins in tumor tissues of different treatment groups. A is BMAL1 and LIAS; B is FDX1; C is the aggregation of DLAT;

[0052] Fig.19 HE staining was used to detect tumor tissue morphology, and immunohistochemistry was used to detect the changes in the expression of TUNEL, Ki67 and BMAL1. DETAILED DESCRIPTION

[0053] The technical solution of the present invention is further described below in conjunction with the accompanying drawings. The methods are conventional methods unless otherwise specified. The raw materials can be obtained from public commercial channels unless otherwise specified.

[0054] Example 1 Preparation and Characterization of Cu-RNP

[0055] like Figure 1 As shown, the preparation method of Cu-RNP includes copper ion chelation, DNA self-assembly and assembly of Cas13d system. The specific steps are as follows: Self-assembly of Cu-DNA: 16 μL of 20 mM CuCl2·2H2O solution was added to 380 μL of 50 μM mixed DNA solution, wherein the molar ratio of BMAL1 target DNA to template DNA was 1:1.

[0056] The BMAL1 targeting DNA sequence is: AGCCTACTGAGTTCAGCACATGAAAACATTAAGA (as shown in SEQ No. 1)

[0057] The template DNA sequence is: ATGTCATCACGCCCACCCGCTGTGGAAGTGGATG (as shown in SEQ No. 2)

[0058] The solution was incubated at 95°C for 5 hours, and the copper ions and DNA formed a Cu-DNA complex through coordination reaction. After incubation, the unreacted components were removed by centrifugation (8000 rpm, 10 minutes), and the nanoparticles were washed with deionized water. The obtained Cu-DNA nanoparticles were resuspended in deionized water to prepare for subsequent treatment.

[0059] Assembly of Cas13d RNP: The purified Cas13d protein was mixed with the designed sgRNA targeting BMAL1 (synthesized by T7 RNA synthesis kit) and incubated in 20 mM Tris-HCl buffer to form a Cas13d RNP complex.

[0060] The sgRNA sequence is:

[0061] GGCACUGGUGCAAAUUUGCACUAGUCUAAAACUCUUAAUGUUUUCAUGUGCUG AAC (as shown in SEQ No.3)

[0062] like Figure 3 As shown, Native PAGE analysis verified that Cas13d RNP could efficiently and specifically cleave BMAL1 mRNA, demonstrating its RNA targeting activity.

[0063] The BMAL1 mRNA sequence is:

[0064] UUAGAUAAACUUACUGUGCUAAGGAUGGCUGUUCAGCACAUGAAAACAUUAAGAGGUGCCACCAAUCCAU (as shown in SEQ No.4)

[0065] Synthesis and characterization of Cu-RNP: Cu-DNA and Cas13dRNP complex were incubated at 37°C for 30 minutes. The surface of Cu-DNA self-assembled with the extended fragment of Cas13dRNP to form a Cu-RNP complex.

[0066] like Figure 4 As shown, the morphology of Cu-RNPs was observed using a transmission electron microscope (TEM), and the image showed that Cu-RNPs formed uniformly distributed spherical nanoparticles with a particle size of approximately 90-150 nm.

[0067] like Figure 5As shown, it was imaged and verified using high-angle annular dark-field scanning transmission electron microscopy to observe the presence and spatial distribution of key elements (C, Cu, S, N, P, and O). The distribution map of the carbon (C) element revealed different regions within the structure: the Cu-DNA core region has a low carbon content, while the Cas13d RNP shell region is rich in carbon, and the Cas13d RNP shell is assembled on the Cu-DNA surface. This hierarchical distribution demonstrates the successful integration of its core and shell components.

[0068] Example 2 Cu-RNP enters tumor cells

[0069] like Figure 2 As shown in the figure, Cu-RNP exerts its effects in tumor cells through the following mechanism: Cu-RNP is injected into the body through the tail vein and accumulates in the tumor site of xenografted MCF-7 cells. It enters MCF-7 cells through endocytosis and releases copper ions and CRISPR-Cas13d RNP in the acidic environment of the tumor microenvironment. On the one hand, Cu 2+ Cu is generated by glutathione (GSH) and hydrogen peroxide (H2O2) + , while the depletion of FDX1 and LIAS led to DLAT heterodimerization and caused mitochondrial damage, resulting in copper death of cells. On the other hand, gene editing reduced the level of BMAL1, which in turn led to a decrease in WEE1 levels, triggering cell apoptosis; at the same time, the disruption of the biological clock and the upregulation of p21 led to cell cycle arrest in the G2 / M phase; in addition, the effects on the metabolic levels of lactate and pyruvate hindered the normal metabolism of the tricarboxylic acid cycle, further enhancing copper death. By integrating multiple cell death pathways, the overall therapeutic effect of human breast cancer was improved.

[0070] like Figure 6 As shown, the MCF-7 human breast cancer cell line was cultured in high-glucose DMEM medium containing 10% fetal bovine serum and cultured in an incubator at 37°C and 5% CO2 until the logarithmic growth phase. 24 hours before the experiment, the cells were seeded in a confocal microscope culture dish with a glass bottom, with approximately 3×10 cells per well. 4cells. When the cell coverage reached 80%, the cells were treated with medium containing 200 μg / mL FITC-labeled Cu-RNP. This concentration was used to ensure sufficient cellular uptake and lysosomal escape. After treatment, the cells were removed at 1 hour, 4 hours, and 8 hours, and washed three times with PBS to remove the unendocytosed Cu-RNP. Staining with Hoechst 33342 dye (for nucleus staining) and LysoTracker Red (for lysosomal labeling) was performed according to the instructions. Laser confocal microscopy (Leica SP8) was used for observation. The colocalization of fluorescently labeled Cu-RNP and lysosomes can be quantified by Pearson's correlation coefficient (PCC) to analyze the uptake and lysosomal escape of Cu-RNP. The fluorescence images were quantitatively analyzed, and the overlap of the fluorescence intensity of Cu-RNP and lysosomal labeling was calculated by ImageJ software. The Pearson correlation coefficient was used to evaluate the overlap of the two fluorescent signals. The images showed that Cu-RNP had a high overlap with the lysosomal fluorescence signal after 4 hours, indicating that Cu-RNP entered the cell through endocytosis and combined with the lysosome. After 6 hours, the overlap between Cu-RNP and lysosome gradually weakened, indicating that Cu-RNP escaped through lysosomes into the cytoplasm, releasing copper ions and Cas13dRNP, thereby exerting its therapeutic effect.

[0071] Example 3 Mechanism of Anti-tumor Effect of Cu-RNP

[0072] like Figure 7 As shown, MCF-7 cells in the logarithmic growth phase were taken and inoculated into a 24-well plate, with 2.5×105 cells in each well. After culturing for 16 hours, the cells were treated with PBS, Cu-DNA, Cu-RNP, Cu-RNP+UK5099, etc. The final concentration of UK5099 is 100nM. After treatment, the culture was continued for 24 hours. Total cellular RNA was extracted using the UNlQ-10Column TRIZOL total RNA extraction kit according to the manufacturer's instructions. The concentration and quality of RNA were determined using a NanoDrop 2000 spectrophotometer. 1μg of RNA was used for cDNA synthesis, and cDNA was synthesized using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit according to the instructions. AceQ qPCR was used Green Master Mix (Without ROX) was used for real-time quantitative PCR. β-actin was selected as the internal reference gene, and the relative expression levels of the target genes (BMAL1, FDX1, LIAS) were calculated using the 2-ΔΔCt method. The PCR results were analyzed, and the relative mRNA expression levels of BMAL1, FDX1, and LIAS in different treatment groups were calculated to evaluate the effect of Cu-RNP treatment on gene expression. The results showed that the mRNA levels of BMAL1, FDX1, and LIAS in the Cu-RNP group were significantly reduced, especially the downregulation of BMAL1, indicating that Cu-RNP effectively downregulated the BMAL1 gene through the CRISPR-Cas13d system. In addition, the downregulation of FDX1 and LIAS, important genes for copper death, also proved the mechanism of cell-induced copper death, and the copper death inhibitor UK5099 could attenuate the downregulation of copper death genes.

[0073] like Figure 8 As shown, after different treatments, the cell culture supernatant was collected and the concentrations of intracellular lactate and pyruvate were determined. The absorbance value was measured using a microplate reader (BioTek Synergy H1), and the concentrations of lactate and pyruvate were calculated according to the standard curve. The levels of lactate and pyruvate in MCF-7 cells in the Cu-RNP treatment group were significantly lower than those in the control group, indicating that Cu-RNP inhibited energy metabolism by interfering with glycolysis and tricarboxylic acid cycle in tumor cells.

[0074] Use JC-1 dye to detect intracellular mitochondrial membrane potential. Add JC-1 dye to treated cells and incubate at 37°C for 30 minutes. Use laser confocal microscopy to observe the red and green fluorescence signals in the cells. Healthy mitochondria will emit red fluorescence, while mitochondria that have lost membrane potential will emit green fluorescence. Fig. 9 As shown, JC-1 dye was used to detect the mitochondrial membrane potential of MCF-7 cells in the Cu-RNP treatment group. The cells in the Cu-RNP treatment group showed weaker red fluorescence and increased green fluorescence, indicating a significant loss of mitochondrial membrane potential, indicating that Cu-RNP caused mitochondrial functional damage.

[0075] Determination of intracellular ATP levels, such as Fig.10 As shown, the ATP level in MCF-7 cells treated with Cu-RNP was significantly reduced, indicating that Cu-RNP inhibited the generation of ATP by disrupting the energy metabolism of tumor cells, further aggravating cell death.

[0076] β-actin was used as an internal reference gene to calculate the relative expression level of the WEE1 gene, and flow cytometry was used to detect cell apoptosis in different treatment groups. Fig.11As shown in Figure 2, the mRNA level of WEE1 in the Cu-RNP-treated cells was significantly decreased. Fig.12 The apoptosis rate of the Cu-RNP-treated group was significantly increased to 42.1%, indicating that Cu-RNP downregulated BMAL1 and effectively induced apoptosis of tumor cells by inhibiting WEE1.

[0077] β-actin was used as an internal reference gene to calculate the relative expression level of the p21 gene, and flow cytometry was used to detect the cell cycle status of different treatment groups. Fig.13 As shown in Figure 2, the mRNA level of p21 in the cells treated with Cu-RNP was significantly increased. Fig.14 The proportion of cells in the G2 / M phase of the Cu-RNP group reached 45%, an increase of 15% compared with 30% in the PBS group, and the proportion of cells in the G0 / G1 phase decreased from 60% to 45%. The results showed that Cu-RNP downregulated BMAL1 and interfered with the cell cycle process, leading to cell cycle arrest and further inhibiting the proliferation of tumor cells.

[0078] like Fig.15 As shown, after Calcein-AM / PI staining, the Cu-RNP treatment group showed significant dead cell fluorescence, and red fluorescence (PI-stained dead cells) was significantly enhanced. In particular, in the Cu-RNP group, the red fluorescence accounted for 42.1%, which was significantly increased compared to 15.3% in the PBS group, indicating that the above mechanism enables Cu-RNP to effectively induce tumor cell death.

[0079] Example 4 Evaluation of in vivo anti-tumor effects

[0080] according to Fig.16 The in vivo experimental protocol shown above used 5-6 week old female BALB / c-nu mice purchased from Zhejiang Weitong Lihua Experimental Animal Technology Co., Ltd. MCF-7 cells (5×10 per mouse) were injected subcutaneously. 6 7 days later, the volume was about 100 mm 3 The mice were randomly divided into four groups (4 mice in each group): PBS group, Cu-DNA group, Cu-RNP group, and control group. Different doses (25 mg / kg) of Cu-RNP solution were injected through the tail vein once every 3 days for a total of 3 times. Fig.17As shown, the changes in mouse body weight and tumor volume were monitored to evaluate the anti-tumor effect of Cu-RNP. The changes in tumor volume of each group of mice during the treatment process showed that the tumor growth in the Cu-RNP treatment group was significantly inhibited after administration, and the tumor volume growth rate in the Cu-RNP group was the slowest compared with the control group, PBS group and Cu-DNA group. At the end of the treatment, the tumor volume of mice in the Cu-RNP group was significantly smaller than that in the other groups. Specific data showed that the tumor volume in the Cu-RNP group was reduced by about 60%, and the TGI (tumor growth inhibition rate) was 87%. Through the determination of tumor weight, the tumor weight of the Cu-RNP group was significantly lower than that of the control group, further proving that Cu-RNP exhibits significant anti-tumor effects in vivo.

[0081] Tumor tissue samples were taken and protein was extracted using RIPA lysis buffer. The expression of BMAL1, FDX1, LIAS and other proteins was detected by Western Blot. Fig.18 As shown in Figure 3, the protein expression of BMAL1 in the tumor tissues of the Cu-RNP treatment group was significantly reduced, the expression of FDX1 and LIAS also decreased, while the DLAT protein showed obvious aggregation. Fig.19 As shown in the figure, after tissue sectioning and HE staining, the tumor tissue in the Cu-RNP group showed obvious necrotic areas, shrunken cell nuclei, and different staining depths. The number of TUNEL-positive cells in the tumor tissue of the Cu-RNP group increased significantly, indicating that Cu-RNP can effectively induce tumor cell apoptosis. The proportion of Ki67-positive cells in the Cu-RNP group was significantly lower than that in the control group, indicating that Cu-RNP inhibited the proliferation of tumor cells. BMAL1 immunohistochemical analysis showed that the immune response of BMAL1 in the tumor tissue of the Cu-RNP group was significantly weakened, further confirming that Cu-RNP exerts its anti-tumor effect by downregulating BMAL1.

[0082] Sequence Listing

[0083]

[0084] It should be noted that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Equivalent replacements or substitutions made on the basis of the above embodiments all fall within the protection scope of the present invention.

Claims

1. A copper-based DNA nanomaterial, characterized in that: The copper-based DNA nanomaterial is Cu-DNA@CRISPR-Cas13d / BMAL1 sgRNA, abbreviated as Cu-RNP; The Cu-DNA is a copper-based delivery carrier, in which copper ions and DNA form a complex through coordination reaction; The CRISPR-Cas13d / BMAL1 sgRNA is a Cas13d protein that reacts with an sgRNA targeting BMAL1 to form a Cas13dRNP complex; The Cu-DNA complex and the Cas13dRNP complex form a Cu-RNP complex through self-assembly.

2. The copper-based DNA nanomaterial according to claim 1, characterized in that: The Cu-RNP complex is a spherical nanoparticle with a particle size of 90-150 nm.

3. The copper-based DNA nanomaterial according to claim 1, characterized in that: The Cu-DNA and the The molar ratio of CRISPR-Cas13d / BMAL1 sgRNA was 1:

1.

4. The copper-based DNA nanomaterial according to claim 1, characterized in that: The self-assembly condition is: reacting in a buffer system at 37° C. for 30 minutes or more.

5. The copper-based DNA nanomaterial according to claim 1, characterized in that: In the Cu-DNA complex, the DNA includes BMAL1 target DNA and template DNA.

6. The copper-based DNA nanomaterial according to claim 5, characterized in that: The molar ratio of the copper ion, the BMAL1 targeting DNA, and the template DNA is 33.7:1:

1.

7. The copper-based DNA nanomaterial according to claim 5, characterized in that: The BMAL1 targeting DNA sequence is: AGCCTACTGAGTTCAGCACATGAAAACATTAAGA, as shown in SEQ No. 1; The template DNA sequence is: ATGTCATCACGCCCACCCGCTGTGGAAGTGGATG, as shown in SEQ No. 2; The sgRNA sequence for BMAL1 is: GGCACUGGUGCAAAUUUGCACUAGUCUAAAACUCUUAAUGUUUUCAUGUGCUGAAC, as shown in SEQ No.

3.

8. The copper-based DNA nanomaterial according to claim 1, characterized in that: The conditions for the copper ion-DNA coordination reaction are as follows: copper ions and DNA are mixed in a solution and then incubated at 95° C. for 5 hours.

9. Use of the copper-based DNA nanomaterial according to any one of claims 1 to 8 in the preparation of a drug for inhibiting tumors.

10. Use of the copper-based DNA nanomaterial according to any one of claims 1 to 8 in the preparation of a drug that interferes with biological clock genes and promotes copper cell death in tumor cells.

Images