Freshwater fish meat protein antihypertensive peptide based on esterification modification and preparation method thereof

Abstract

The invention belongs to the technical field of preparation of antihypertensive active peptides for aquatic products. The invention discloses a freshwater fish meat protein antihypertensive peptide based on ethyl esterification modification. The freshwater fish meat protein antihypertensive peptide is characterized in that the structural sequence of the freshwater fish meat protein antihypertensive peptide is Tyr-Leu-Arg-Leu-His-Phe-OEt. The invention relates to a preparation method of a freshwater fish protein antihypertensive peptide based on esterification modification. The preparation method is characterized by comprising the following specific steps: step 1, separating active peptide from freshwater fish protein; and step 2, performing ethyl esterification modification on the active peptide separated from the freshwater fish meat protein. The activity and stability of the antihypertensive peptide prepared by the method are remarkably improved.

Description

Technical Field

[0001] The invention belongs to the technical field of preparation of blood pressure-lowering aquatic product active peptides, and relates to an ethyl esterified freshwater fish meat blood pressure-lowering peptide and a preparation method thereof. Background Art

[0002] Freshwater fisheries, especially freshwater aquaculture, provide us with abundant aquatic products, meeting the people's increasingly diversified food consumption needs. Freshwater fish meat has a high protein content, and the ratio and quantity of essential amino acids it contains meet the needs of the human body. It has a very high digestion and absorption rate, which is conducive to the extraction of bioactive peptides.

[0003] Hypertension, as one of the risk factors for stroke, affects 20%-45% of the world's population, especially 50%-60% of the elderly. Angiotensin-I-converting enzyme (EC 3.4.15.1; ACE) is a metallocarboxypeptidase that regulates blood pressure in the renin-angiotensin system. It hydrolyzes the carboxyl-terminal dipeptide His-Leu of angiotensin I to obtain angiotensin II. Angiotensin II enhances the contractility of the myocardium, leading to contraction of vascular smooth muscle and increased blood pressure. Therefore, inhibiting ACE activity is an important means of lowering blood pressure. However, the effect of ACE inhibitory peptides from natural sources still needs to be improved. In addition, their stability in the body is poor and they are easily hydrolyzed by enzymes in the gastrointestinal tract, so they cannot play their blood pressure lowering effect well. In order to improve these problems, the chemical structure of the peptides from natural sources can be modified, and the activity and stability of the blood pressure lowering peptides after chemical modification are significantly improved. Summary of the invention

[0004] The purpose of the present invention is to provide a freshwater fish meat protein antihypertensive peptide based on ethyl esterification modification and a preparation method thereof. The activity and stability of the antihypertensive peptide prepared by the method are significantly improved.

[0005] In order to achieve the above-mentioned purpose, the technical solution adopted by the present invention is a freshwater fish meat protein antihypertensive peptide based on ethyl esterification modification, characterized in that its structural sequence is Tyr-Leu-Arg-Leu-His-Phe-OEt (YLRLHF-OEt).

[0006] The above-mentioned method for preparing the blood pressure lowering peptide of freshwater fish meat protein based on ethyl esterification modification is characterized by the following specific steps:

[0007] Step 1: Isolate active peptides from freshwater fish protein;

[0008] Step 2: Ethyl esterification modification of the active peptide separated from the freshwater fish protein comprises the following steps:

[0009] 1) Swelling the mixture with a mass ratio of Fmoc-Phe-CTC Resin (resin): DCM (dichloromethane) = 1:1 to obtain a swollen Fmoc-Phe-CTC Resin resin;

[0010] 2) Add 3 times the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) with a mass concentration of 20% Pip / DMF solution {(piperidine / n,n-dimethylformamide) mixed solution}, purge with nitrogen and then dry to obtain H2N-Phe-CTCResin;

[0011] 3) According to the mass ratio of Fmoc-Phe-CTC Resin (resin): Fmoc-His-OH amino acid: DIPEA: HBTU: solvent DMF described in step 1), Fmoc-His-OH amino acid, DIPEA (N, N-diisopropylethylamine), HBTU (chemical name O-Benzotriazole-N, N, N', N'-tetramethyl-uronium-hexafluorophosphate), and solvent DMF (dimethylformamide) are added, mixed, and reacted to obtain Fmoc-Ala-Glu(OtBu)-CTC Resin;

[0012] 4) Add DMF, a solvent with a volume twice that of the Fmoc-Phe-CTC Resin (resin) described in step 1), to wash the resin in the previous step;

[0013] 5) Add 3 times the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) with a mass concentration of 20% Pip / DMF solution, and dry it with nitrogen to obtain H2N-His-Phe-CTC Resin;

[0014] 6) Add DMF (solvent DMF) twice the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) to wash the resin in the previous step;

[0015] 7) Repeat 3), 4), 5) and 6) once to obtain H2N-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTCResin;

[0016] 8) According to the mass ratio of Fmoc-Phe-CTC Resin (resin), Boc anhydride, DIPEA (N,N-diisopropylethylamine), HBTU (benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate) and solvent DMF described in step 1), 4ml:5.4mmol:10.8mmol:5.13mmol:6-7ml, then add Boc anhydride, DIPEA, HBTU and solvent DMF, mix and react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTC Resin;

[0017] 9) Add 1% TFA / DCM solution (trifluoroacetic acid / dichloromethane) with a volume twice that of the Fmoc-Phe-CTC Resin described in step 1) to react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH;

[0018] 10), Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH obtained in step 9) is dissolved in anhydrous ethanol {Fmoc-Phe-CTC Resin (resin) and anhydrous ethanol = 4ml:8ml as described in step 1)}, hydrogen chloride gas is introduced {Fmoc-Phe-CTC Resin (resin) and hydrogen chloride gas = 4ml:10ml as described in step 1)}, refluxed at 60-70°C, and concentrated under reduced pressure to obtain a C-terminal carboxyl ethyl ester product: Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-Oet;

[0019] 11), according to the Fmoc-Phe-CTC Resin (resin) described in step 1): the active peptide separated from the freshwater fish meat protein described in step 1 = 4ml: 2ml, add the C-terminal carboxyl ethyl ester product obtained in step 10) to the active peptide, and then add 6 times the volume of the Fmoc-Phe-CTC Resin (resin) described in step 1) The cutting solution (mass percentage of trifluoroacetic acid: anisole: 1,2-ethanedithiol: phenol: water = 87.5%: 5%: 2.5%: 2.5%: 2.5%), mix and soak, filter out the resin, precipitate the filtrate with anhydrous ether, and wash the precipitate with anhydrous ether for 3 times, finally put the precipitate in a vacuum drying kettle, and dry it at room temperature to obtain a crude product Tyr-Leu-Arg-Leu-His-Phe-OEt;

[0020] 12) Purify by high performance liquid chromatography to obtain Tyr-Leu-Arg-Leu-His-Phe-Oet with a purity of more than 95% by mass concentration; obtain a freshwater fish meat protein antihypertensive peptide based on ethyl esterification modification.

[0021] According to the above technical solution, in step 10), the solution is dissolved in anhydrous ethanol as follows: Fmoc-Phe-CTC Resin (resin) and anhydrous ethanol = 4 ml: 8 ml as described in step 1), and anhydrous ethanol is selected.

[0022] According to the above technical solution, the hydrogen chloride gas introduced in step 10) is: Fmoc-Phe-CTCResin (resin) and hydrogen chloride gas = 4ml:10ml as described in step 1), and hydrogen chloride gas is selected.

[0023] According to the above technical scheme, in step 11), the cutting fluid is composed of trifluoroacetic acid, thioanisole, 1,2-ethanedithiol, phenol and water, and the mass percentage of trifluoroacetic acid: thioanisole: 1,2-ethanedithiol: phenol: water = 87.5%: 5%: 2.5%: 2.5%: 2.5%.

[0024] The beneficial effects of the present invention are as follows: 1. The blood pressure lowering peptide provided by the present invention has a strong ACE inhibitory activity (IC 50 =22.74μM), cell experiments and animal experiments have verified its effect. It can achieve the purpose of lowering blood pressure by affecting multiple pathways such as the renin-angiotensin system, kallikrein-kinin system, and inhibiting the activity of endothelin-converting enzyme, and has strong antihypertensive activity. 2. Cell experiments show that it is non-toxic to HUVECs cells. Animal experiments show that the intake of this peptide by rats with primary hypertension can significantly lower blood pressure, and the organs of the rats have no lesions, and the stability effect is significantly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figure is a liquid chromatogram of the ethyl esterified blood pressure lowering peptide segment of the present invention.

[0026] Figure 2 The figure is the mass spectrum of the ethyl esterified blood pressure lowering peptide segment of the present invention.

[0027] Figure 3 This is a diagram showing the toxic effect of the ethyl esterified blood pressure lowering peptide segment of the present invention on HUVECs cells.

[0028] Figure 4 This is a graph showing the effect of the ethyl esterified antihypertensive peptide segment of the present invention on the amount of NO released into HUVECs cells.

[0029] Figure 5 This is a graph showing the effect of the ethyl esterified antihypertensive peptide segment of the present invention on the amount of ET-1 released from HUVECs cells.

[0030] Figure 6 This is a graph showing the effect of the ethyl esterified antihypertensive peptide of the present invention on the mRNA content of ACE, ET-1, and eNOs in HUVECs cells.

[0031] Figure 7 The figure is a graph showing the antihypertensive effect of the ethyl esterified antihypertensive peptide segment of the present invention on rats with essential hypertension. DETAILED DESCRIPTION

[0032] In order to make the technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific examples described herein are only used to explain the present invention and are not used to limit the present invention.

[0033] In the following Example 1, active peptides are isolated from freshwater fish meat protein. The existing technology can be used to isolate active peptides from freshwater fish meat protein, such as Chinese Patent 202110960009.7 (Invention Name: A method for preparing a highly antioxidant bioactive peptide). Details: A method for preparing a highly antioxidant bioactive peptide, comprising the following steps:

[0034] Step 1, crush and mix fresh freshwater raw fish or frozen raw fish thawed in running water to make minced meat;

[0035] Step 2, extracting myofibrillar protein to obtain a myofibrillar protein paste solid;

[0036] Step 3, using 0.6 mol / L KCl-Tris-maleic acid solution to dissolve the myofibrillar protein paste solid to obtain a myofibrillar protein solution with a mass concentration of 2% to 5%, and storing it at 0 to 4°C;

[0037] Step 4: the myofibrillar protein solution obtained in step 3 is respectively placed in:

[0038] (1) treating with ultrahigh pressure equipment at a pressure of 100 to 500 MPa (preferably 250 to 350 MPa, more preferably 300 MPa) for 5 to 25 min (preferably 15 to 25 min, more preferably 20 min);

[0039] (2) 1 to 4 (more preferably 2) cycles of treatment in a high-pressure homogenizer at a pressure of 200 to 500 bar (preferably 250 to 350 bar, more preferably 300 bar) (the cycle refers to the number of treatments in the high-pressure homogenization, i.e., 1 to 4 times of treatment in a high-pressure homogenizer at a pressure of 200 to 500 bar; 2 cycles means that the solution is passed through the high-pressure homogenizer twice at the same pressure; the same applies hereinafter);

[0040] (3) treating with ultrahigh pressure equipment at a pressure of 100 to 500 MPa (preferably 250 to 350 MPa, more preferably 300 MPa) for 5 to 25 min (preferably 15 to 25 min, more preferably 20 min), and then high pressure homogenization treatment at a pressure of 200 to 500 bar (preferably 250 to 350 bar, more preferably 300 bar) for 2 cycles (high pressure homogenization uses high pressure homogenization equipment, or high pressure homogenizer);

[0041] (4) high pressure homogenization treatment at a pressure of 200 to 500 bar (preferably 250 to 350 bar, more preferably 300 bar) for 1 to 4 cycles, and then treatment with ultrahigh pressure equipment at a pressure of 100 to 500 MPa (preferably 250 to 350 MPa, more preferably 300 MPa) for 5 to 25 min (preferably 15 to 25 min, more preferably 20 min);

[0042] Step 5, the myofibrillar protein solution obtained after the pretreatment in step 4 is enzymatically hydrolyzed with 4000u / g pepsin at 55°C for 6h, the enzyme is inactivated, centrifuged, and the supernatant is collected;

[0043] Step 6, vacuum concentrating the supernatant obtained in step 5 to a concentrated solution having a solid mass fraction of 50 to 70 wt%;

[0044] Step 7: freeze-dry the concentrated solution obtained in step 6 to obtain highly antioxidant bioactive peptides.

[0045] According to the above technical scheme, the method for extracting myofibrillar protein in step 2 is:

[0046] 1) Preparation of solution:

[0047] 0.1mmol / L maleic acid buffer: 5.8035g maleic acid is diluted to 500mL;

[0048] Solution A (20mmol / L): 3.7275g KCl + 2.4228g Tris to 1L, 0.1mmol / L maleic acid buffer to adjust pH = 7;

[0049] Solution B (0.6 mol / L): 44.73 g KCl + 2.4228 g Tris to 1 L, 0.1 mmol / L maleic acid buffer to adjust pH = 7;

[0050] 2) Extraction (experimental steps): All extractions were carried out in an ice bath at 4°C.

[0051] Extract twice with 10 times the volume of liquid A: 10g meat + 100mL liquid A, homogenize the mixture for 1min, filter with 300-mesh gauze and keep the precipitate; repeat the above operation once for the precipitate;

[0052] Extract once with 5 times the volume of solution B: add 50 mL of solution B to the precipitate and stir and extract overnight in a refrigerator at 4°C;

[0053] The extract was mixed, centrifuged at 12000 rpm at 4°C for 20 min, and the supernatant was retained to obtain a myofibrillar protein salt solution;

[0054] The supernatant (i.e. myofibrillar protein salt solution) was added with 10 times the volume of 4°C deionized water, and the mixture was centrifuged at 4°C and 12,000 rpm for 20 min to retain the precipitate. The precipitate was washed with water and the operation was repeated twice to obtain myofibrillar protein.

[0055] According to the above technical scheme, the preparation method of 0.6mol / L KCl-Tris-maleic acid solution in step 3 is: 44.73gKCl+2.4228g Tris is adjusted to 1L, and the pH is adjusted to 6.95-7.05 using 0.1mmol / L maleic acid buffer.

[0056] The protease, protease dosage and enzymatic hydrolysis time selected in step 5 are all optimal conditions screened out based on preliminary experiments.

[0057] The active peptide was identified by LC-MS / MS, and the peptide YLRLHF with the most significant blood pressure lowering activity was screened out through bioinformatics analysis.

[0058] Example 1: A method for preparing a blood pressure lowering peptide based on ethyl esterification modification of freshwater fish meat protein, wherein the sequence of the blood pressure lowering peptide obtained is Tyr-Leu-Arg-Leu-His-Phe-OEt (YLRLHF-OEt), comprising the following steps:

[0059] Step 1: Isolate (isolate and identify) active peptides from freshwater fish meat protein to obtain active peptides isolated from freshwater fish meat protein; the separation method is as described above, the active peptides are identified by LC-MS / MS peptide sequence, and the peptide with the most significant antihypertensive activity (ACE inhibitory peptide YLRLHF) is screened out by bioinformatics analysis, and then ethyl esterification is performed on it;

[0060] Step 2: Ethyl esterification modification of the active peptide (YLRLHF) separated from the freshwater fish protein comprises the following steps:

[0061] 1) Take 4 ml of Fmoc-Phe-CTC Resin (resin), and swell the Fmoc-Phe-CTC Resin (resin) at a mass ratio of Fmoc-Phe-CTC Resin (resin): DCM (dichloromethane) = 1:1 to obtain a swollen Fmoc-Phe-CTC Resin resin;

[0062] 2) Add 3 times the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) with a mass concentration of 20% Pip / DMF solution {(piperidine / n,n-dimethylformamide) mixed solution}, purge with nitrogen and then dry to obtain H2N-Phe-CTCResin;

[0063] 3) According to the mass ratio of Fmoc-Phe-CTC Resin (resin): Fmoc-His-OH amino acid: DIPEA: HBTU: solvent DMF described in step 1), Fmoc-His-OH amino acid, DIPEA (N, N-diisopropylethylamine), HBTU (chemical name O-Benzotriazole-N, N, N', N'-tetramethyl-uronium-hexafluorophosphate), and solvent DMF (dimethylformamide) are added, mixed, and reacted to obtain Fmoc-Ala-Glu(OtBu)-CTC Resin;

[0064] 4) Add DMF, a solvent with a volume twice that of the Fmoc-Phe-CTC Resin (resin) described in step 1), to wash the resin in the previous step;

[0065] 5) Add 3 times the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) with a mass concentration of 20% Pip / DMF solution, and dry it with nitrogen to obtain H2N-His-Phe-CTC Resin;

[0066] 6) Add DMF (solvent DMF) twice the volume of Fmoc-Phe-CTC Resin (resin) described in step 1) to wash the resin in the previous step;

[0067] 7) Repeat 3), 4), 5) and 6) once to obtain H2N-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTCResin;

[0068] 8) According to the mass ratio of Fmoc-Phe-CTC Resin (resin), Boc anhydride, DIPEA (N,N-diisopropylethylamine), HBTU (benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate) and solvent DMF described in step 1), 4ml:5.4mmol:10.8mmol:5.13mmol:6-7ml, then add Boc anhydride, DIPEA, HBTU and solvent DMF, mix and react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTC Resin;

[0069] 9) Add 1% TFA / DCM solution (trifluoroacetic acid / dichloromethane) with a volume twice that of the Fmoc-Phe-CTC Resin described in step 1) to react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH;

[0070] 10), Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH obtained in step 9) is dissolved in anhydrous ethanol {Fmoc-Phe-CTC Resin (resin) and anhydrous ethanol = 4ml:8ml as described in step 1)}, hydrogen chloride gas is introduced {Fmoc-Phe-CTC Resin (resin) and hydrogen chloride gas = 4ml:10ml as described in step 1)}, refluxed at 60-70°C, and concentrated under reduced pressure to obtain a C-terminal carboxyl ethyl ester product: Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-Oet;

[0071] 11), according to the Fmoc-Phe-CTC Resin (resin) described in step 1): the active peptide separated from the freshwater fish meat protein described in step 1 = 4ml: 2ml, add the C-terminal carboxyl ethyl ester product obtained in step 10) to the active peptide, and then add 6 times the volume of the Fmoc-Phe-CTC Resin (resin) described in step 1) The cutting solution (mass percentage of trifluoroacetic acid: anisole: 1,2-ethanedithiol: phenol: water = 87.5%: 5%: 2.5%: 2.5%: 2.5%), mix and soak, filter out the resin, precipitate the filtrate with anhydrous ether, and wash the precipitate with anhydrous ether for 3 times, finally put the precipitate in a vacuum drying kettle, and dry it at room temperature to obtain a crude product Tyr-Leu-Arg-Leu-His-Phe-OEt;

[0072] 12) Purify by high performance liquid chromatography to obtain Tyr-Leu-Arg-Leu-His-Phe-Oet with a purity of more than 95% by mass concentration; freeze the collected target peak solution with liquid nitrogen and then put it on a freeze dryer to vacuum dry it into powder to obtain a freshwater fish meat protein hypotensive peptide based on ethyl esterification modification. Figure 1 and Figure 2 As shown, after identification by liquid chromatography and mass spectrometry, the sequence of the pure antihypertensive peptide was analyzed to be Tyr-Leu-Arg-Leu-His-Phe-Oet, which is an undiscovered new antihypertensive peptide segment.

[0073] The molecular structure is shown in the figure below:

[0074]

[0075] Application Example 1, HUVECs Cytotoxicity Test Mediated by Antihypertensive Peptide

[0076] 1. Add 150 μL of PBS (phosphate buffer) around the 96-well plate, and add 100 μL of cell suspension (cell number = 1*10) to the control group (without the ethyl esterification-modified freshwater fish protein antihypertensive peptide obtained in Example 1) and the treatment group (with the ethyl esterification-modified freshwater fish protein antihypertensive peptide obtained in Example 1) 5 ). The culture plate was cultured in an incubator for 24 h.

[0077] 2. After the cells adhered, aspirate the culture medium (specifically, the culture medium is DMEM high-glucose cell culture medium containing 10% fetal bovine serum), add 100 μL of ACE inhibitory peptides with different concentration gradients (different concentrations: 0.25, 0.5, 1, 2.5, 5, 25, 125, 250 μg / mL), and continue culturing for 24 hours.

[0078] 3. Add 10 μL of CCK-8 solution (10% of the total volume of the culture medium) to each well and shake thoroughly for 10 seconds.

[0079] 4. Incubate the culture plate in the incubator for 2 hours.

[0080] 5. Measure the absorbance at 450 nm using an enzyme-labeled instrument.

[0081]

[0082] Abs blank : Complete medium + CCK8

[0083] Abs control :Cells+CCK8

[0084] Abs sample:Cell+Peptide+CCK8

[0085] 6. If Figure 3 As shown, the peptide had no toxicity to cells within 250 μg / mL.

[0086] Application Example 2: Release of NO in HUVECs mediated by antihypertensive peptides

[0087] 1. In-situ loading probe:

[0088] HUVECs cells were 5*10 5 The cells / well were inoculated in a 12-well plate and cultured in a cell culture incubator for 24 hours, and then different concentrations (5, 25, 50 μg / mL) of samples were added (the samples were freshwater fish meat protein hypotensive peptides based on ethyl esterification modification obtained in Example 1) and the cells were incubated for 24 hours in DMEM high-glucose cell culture medium containing 10% fetal bovine serum. After the treatment, the cell surface was washed 3 times with PBS, and the cells were fixed with 4°C paraformaldehyde for 10-15 minutes (fixed at room temperature in the dark). The fixed cells were incubated at 37°C for 20 minutes using 5 μmol / L DAF-FM DA fluorescent probe. The cell surface was washed 3 times with PBS, the slide was washed and dried on clean dust-free paper, the cells in PBS were taken out, and the cells were noted to be facing down. The anti-quenching sealing agent was dropped on the slide, covered on the slide, and the production of NO in HUVECs was observed using a laser confocal microscope. Measurement parameters: 495nm excitation wavelength, 515nm emission wavelength.

[0089] 2. Collect cells and load probes:

[0090] After the cells were treated with the polypeptide, the cells were collected, resuspended with 5 μmol / L DAF-FM DA fluorescent probe, and then incubated in a 37°C cell culture incubator for 20 min. The cells were mixed every 3-5 min during the incubation process. After the incubation, the cells were centrifuged and washed with PBS. The supernatant was removed by centrifugation. This process was repeated three times to remove the probes that did not enter the cells. 200 μL PBS buffer was added to each well. The cells were placed in a flow cytometer for detection, and the parameter was set to FITC.

[0091] 3. If Figure 4 As shown, with the increase of treatment concentration, the proportion of intracellular NO release increased.

[0092] Application Example 3: Release of ET-1 in HUVECs mediated by antihypertensive peptides

[0093] The ELISA kit (DB918-Hu) of Shanghai Huding Biotechnology Co., Ltd. was used for determination. The specific method is as follows:

[0094] 1. Dilute the endothelin-1 standard to 160pg / mL, 80pg / mL, 40pg / mL, 20pg / mL, 10pg / mL, and 0pg / mL;

[0095] 2. Add the standard and sample (the sample is the ethyl esterified freshwater fish protein hypotensive peptide obtained in Example 1) to the bottom of the ELISA plate, try not to touch the well wall, and gently shake to mix. Add 50 μL of the standard to the standard well; add 10 μL of the ethyl esterified hypotensive peptide sample + 40 μL of sample diluent to the sample well; and add 50 μL of sample diluent to the blank well.

[0096] 3. Add enzyme: Add 100 μL of detection antigen labeled with horseradish peroxidase (HRP) to the standard wells and sample wells except the blank wells.

[0097] 4. Incubation: Cover the reaction plate with a sealing film and incubate in a 37°C incubator for 60 minutes.

[0098] 5. Washing: Remove the sealing film, discard the liquid, drain on absorbent paper, fill each well with washing solution (concentrated washing solution and distilled water diluted at 1:20), let stand for 30 seconds, shake off the washing solution, pat dry on absorbent paper, and repeat this 5 times. After washing, before adding the substrate, pat the reaction plate dry on a piece of paper that does not feel flaky.

[0099] 6. Color development: Mix color developer A and color developer B in a 1:1 ratio, add 100 μL of substrate mixture to all wells, cover the reaction plate with a sealing film, and incubate in a 37°C incubator for 15 minutes.

[0100] 10. Termination: Add 50 μL of stop solution to each well to terminate the reaction.

[0101] 11. Determination: adjust the blank well to zero and measure the absorbance of each well at a wavelength of 450nm.

[0102] 12. If Figure 5 As shown in the figure, the release of ET-1 in each group increased with time. After 36 hours of treatment, there was no significant difference between the medium-dose group (25μg / mL) and the high-dose group (50μg / mL), but there was a significant inhibitory effect compared with the blank control group. The inhibitory effect of inhibitory peptide was positively correlated with its concentration.

[0103] Application Example 4, mRNA Content of ACE, ET-1, and eNOs in HUVECs Cells Mediated by Antihypertensive Peptides

[0104] 1. Sample processing:

[0105] The cells treated with the polypeptide (the ethyl esterified freshwater fish protein hypotensive peptide obtained in Example 1) were deprived of the cell culture medium and washed once with sterile PBS.

[0106] Repeat twice and add 0.5 mL of RNA-easy

[0107] Transfer the lysate to a centrifuge tube and pipette repeatedly until the cells are fully lysed.

[0108] 2. RNA extraction:

[0109] Add 2 / 5 volume of RNase-free ddH2O (DEPC water) to the above lysate, mix by inversion, and let stand at room temperature for 5 minutes.

[0110] Centrifuge at 12000g for 15 min at room temperature.

[0111] Pipette the upper aqueous phase into a new centrifuge tube.

[0112] Add isopropanol in an equal volume to the supernatant, invert several times to mix, and let stand at room temperature for 10 min.

[0113] Centrifuge at 12000g for 10 min and carefully discard the supernatant to retain the RNA precipitate.

[0114] Add 500 μL of 75% ethanol (prepared with RNase-free ddH2O), flick the bottom of the tube to suspend the precipitate, and mix by inverting several times (or shaking on a vortex mixer for 1 min).

[0115] After centrifugation at 8000 g for 5 min, the supernatant was discarded.

[0116] Place at room temperature to dry, add 20 μL of RNase-free ddH2O to dissolve the precipitate, vortex at room temperature for 3 minutes (or repeatedly blow with a pipette) to fully dissolve the RNA precipitate. The extracted RNA product can be packaged and stored at -85 to -65°C for a long time, and can only be stored at -30 to -15°C for a short time.

[0117] 3. Reverse transcription:

[0118] Genomic DNA removal

[0119] Prepare the following mixture in an RNase-free centrifuge tube on ice:

[0120] 4×gDNAwiperMix 4μL Template RNA Total RNA: 1pg-1μg <![CDATA[RNase-freeddH2O]]> Add to total volume 16 μL

[0121] Mix by gently blowing with a pipette (or flicking to mix), and treat at 42°C for 2 min.

[0122] Set up the reverse transcription reaction system

[0123] Add 5×HiScript III qRT SuperMix directly to the reaction tube in step 1.

[0124] Reaction solution of step 1 16μL 5×HiScriptIIIqRTSuperMix 4μL

[0125] Mix by gently pipetting.

[0126] Note: This step ensures that the ratio of 5×HiScript III qRT SuperMix to the previous step reaction solution is 1:4

[0127] Reverse transcription reaction

[0128] 37℃ 15min 85℃ 5s

[0129] 4. Gene and primer design:

[0130] The required gene sequences were downloaded from the NCBI database, and primers were designed using Primer4.0.

[0131] Gene Primer (5' to 3') ACE ForwardPrimer CAGGTGGTGTGGAACGAGTATGC ReversePrimer TCAGGGTGTGGTTGGCTATTTGC ET-1 ForwardPrimer TGCTCCTGCTCGTCCCTGATG ReversePrimer AAGTCCATACGGAACAACGTGCTC eNOs ForwardPrimer ACGAGGAGTGGAAGTGGTTC ReversePrimer TGCCGAGCTGACTGAGTAGT β-actin ForwardPrimer GGCTGTATTCCCCTCCATCG ReversePrimer CCAGTTGGTAACAATGCCATGT

[0132] 5. Fluorescence quantitative PCR:

[0133] Prepare the following mixture in a qPCR tube:

[0134] ①2×AceQ Universal SYBR qPCR Master Mix 5μL ② PrimerMix 0.5μL ③Template cDNA 1μL <![CDATA[④ddH2O]]> To10μL

[0135] qPCR reaction conditions

[0136]

[0137] 6. If Figure 6 As shown in the figure, compared with the untreated group, with the increase of treatment concentration, the mRNA expression levels of ACE and ET-1 decreased, indicating that ACE inhibitory peptides may inhibit the gene expression of ACE and then reduce ACE activity to achieve the purpose of lowering blood pressure. At the same time, the mRNA level of ET-1 was significantly reduced, indicating that ACE inhibitory peptides may inhibit the expression of ET-1 mRNA in human umbilical vein endothelial cells and reduce the content of intracellular ET-1 to achieve the effect of lowering blood pressure. ACE inhibitory peptide treatment of cells can significantly increase the gene expression of eNOs, and this change trend is dose-dependent with the treatment concentration.

[0138] Application Example 5, Animal Blood Pressure Lowering Experiment of Antihypertensive Peptide

[0139] 1. Rats grouping:

[0140] Spontaneously Hypertensive Rat (SHR), 30 rats, 11 weeks old; Normal blood pressure rats (Wistar Kyoto, WKY), 6 rats, 11 weeks old. SHR and WKY rats were placed in clean standard rat cages and adaptively raised for one week. The breeding environment temperature was 22±2℃, the environmental humidity was 35±5%, and the lighting was 12h light / dark cycle. During the week of adaptive breeding, sufficient water and feed were given every day and blood pressure, including systolic and diastolic blood pressure, was measured once a day. After one week, SHR and Wistar rats were randomly divided into six groups, with 6 rats in each experimental group. Each group of rats was given physiological saline and polypeptide (the polypeptide was the ethyl esterified modified freshwater fish meat protein antihypertensive peptide obtained in Example 1) by gavage at the same time, and gavage was performed for 28 days. The specific groups were:

[0141] Blank control group: WKY rats with normal saline,

[0142] Negative control group: SHR rats with normal saline,

[0143] Low-dose sample group: SHR rats 5 mg / kg BW polypeptide (the ethyl esterified freshwater fish protein antihypertensive peptide obtained in Example 1),

[0144] Medium dose sample group: SHR rats 10 mg / kg BW polypeptide (the ethyl esterified freshwater fish protein antihypertensive peptide obtained in Example 1),

[0145] High-dose sample group: SHR rats 50 mg / kg BW polypeptide (the ethyl esterified freshwater fish protein antihypertensive peptide obtained in Example 1),

[0146] Positive control group (captopril): SHR rats 10 mg / kg BW captopril,

[0147] 2. Blood pressure measurement:

[0148] The systolic blood pressure of rats was measured before oral gavage and at 7d, 14d, 21d and 28d after oral gavage using an intelligent non-invasive sphygmomanometer.

[0149] 3. Changes in blood pressure As shown in Result 7, with the extension of the oral administration time, the blood pressure of rats in the three sample groups (low-dose sample group, medium-dose sample group, and high-dose sample group) decreased, indicating that the peptide is beneficial for lowering the blood pressure of rats.

Claims

1. A blood pressure lowering peptide based on freshwater fish meat protein modified by ethyl esterification, characterized in that: Its structural sequence is Tyr-Leu-Arg-Leu-His-Phe-OEt.

2. A method for preparing a blood pressure lowering peptide based on ethyl esterification modification of freshwater fish meat protein as claimed in claim 1, characterized in that The specific steps are as follows: Step 1: Isolate active peptides from freshwater fish protein; Step 2: Ethyl esterification modification of the active peptide separated from the freshwater fish protein comprises the following steps: 1) Take Fmoc-Phe-CTC Resin:DCM with a mass ratio of 1:1 for swelling to obtain swollen Fmoc-Phe-CTCResin resin; 2) Add 3 times the volume of Fmoc-Phe-CTC Resin described in step 1) with a mass concentration of 20% Pip / DMF solution, purge with nitrogen and then dry to obtain H2N-Phe-CTC Resin; 3) According to the mass ratio of Fmoc-Phe-CTC Resin: Fmoc-His-OH amino acid: DIPEA: HBTU: solvent DMF described in step 1), Fmoc-His-OH amino acid, DIPEA, HBTU and solvent DMF are added and reacted to obtain Fmoc-Ala-Glu(OtBu)-CTC Resin; 4) Add DMF, a solvent with a volume twice that of the Fmoc-Phe-CTC Resin described in step 1), to wash the resin in the previous step; 5) Add 3 times the volume of Fmoc-Phe-CTC Resin described in step 1) with a mass concentration of 20% Pip / DMF solution, and dry it with nitrogen to obtain H2N-His-Phe-CTC Resin; 6) Add DMF twice the volume of Fmoc-Phe-CTC Resin described in step 1) to wash the resin in the previous step; 7) Repeat 3), 4), 5) and 6) once to obtain H2N-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTC Resin; 8) According to the mass ratio of Fmoc-Phe-CTC Resin, Boc anhydride, DIPEA, HBTU and solvent DMF described in step 1), 4 ml: 5.4 mmol: 10.8 mmol: 5.13 mmol: 6-7 ml, then add Boc anhydride, DIPEA, HBTU and solvent DMF, mix and react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-CTC Resin; 9) Add 1% TFA / DCM solution with a volume twice that of the Fmoc-Phe-CTC Resin described in step 1) to react to obtain Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH; 10), Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-COOH obtained in step 9) is dissolved in anhydrous ethanol, hydrogen chloride gas is introduced, and refluxed at 60-70° C., and concentrated under reduced pressure to obtain a C-terminal carboxyl ethyl ester product: Boc-Tyr(tBu)-Leu-Arg(Pbf)-Leu-His-Phe-Oet; 11), according to the Fmoc-Phe-CTC Resin described in step 1): the active peptide separated from the freshwater fish meat protein described in step 1 = 4ml: 2ml, add the C-terminal carboxyl ethyl ester product obtained in step 10) to the active peptide, and then add 6 times the volume of the Fmoc-Phe-CTC Resin described in step 1) The cutting liquid is mixed and soaked, the resin is filtered out, the filtrate is precipitated with anhydrous ether, and the precipitate is washed with anhydrous ether for 3 times, and finally the precipitate is placed in a vacuum drying kettle, and dried at room temperature to obtain a crude product Tyr-Leu-Arg-Leu-His-Phe-OEt; 12) Purify by high performance liquid chromatography to obtain Tyr-Leu-Arg-Leu-His-Phe-Oet with a purity of more than 95% by mass concentration; obtain a freshwater fish meat protein antihypertensive peptide based on ethyl esterification modification.

3. The method for preparing a blood pressure lowering peptide based on ethyl esterification modification of freshwater fish meat protein according to claim 2, characterized in that: In step 10), the solution is dissolved in anhydrous ethanol as follows: Fmoc-Phe-CTCResin and anhydrous ethanol = 4 ml: 8 ml as described in step 1), with anhydrous ethanol being selected.

4. The method for preparing a blood pressure lowering peptide based on ethyl esterification modification of freshwater fish meat protein according to claim 2, characterized in that: In step 10), the hydrogen chloride gas is introduced in the following ratio: Fmoc-Phe-CTC Resin and hydrogen chloride gas = 4 ml: 10 ml as described in step 1). The hydrogen chloride gas is selected.

5. The method for preparing a blood pressure lowering peptide based on ethyl esterification modification of freshwater fish meat protein according to claim 2, characterized in that: In step 11), the cutting fluid consists of trifluoroacetic acid, thioanisole, 1,2-ethanedithiol, phenol and water, and the mass percentage of trifluoroacetic acid:thioanisole:1,2-ethanedithiol:phenol:water=87.5%:5%:2.5%:2.5%:2.5%.

Images