Rice semi-dwarf male photo-thermo-sensitive sterile gene with high breeding utilization value and application of rice semi-dwarf male photo-thermo-sensitive sterile gene

Abstract

The invention discloses a rice semi-dwarf male photo-thermo-sensitive sterile gene OsPFN2 with high breeding utilization value and application. Through verification and phenotype analysis of a target gene of a rice semi-dwarf photo-thermo-sensitive sterile mutant pfn2-2, the photo-thermo-sensitive sterile gene OsPFN2 is finally obtained through cloning, and the photo-thermo-sensitive sterile gene OsPFN2 is composed of a cDNA sequence as shown in SEQ ID NO. 1 and a genome sequence as shown in SEQ ID NO. 3. The photo-thermo-sensitive male sterile gene is used for regulating and controlling the development process of rice pollen, the OsPFN2 gene of rice is subjected to gene editing or the mutant gene of the OsPFN2 gene is introduced into rice in a hybridization mode, and semi-dwarf male photo-thermo-sensitive sterile rice can be obtained. In conclusion, the gene and the protein coded by the gene can be applied to creation of semi-dwarf photo-thermo-sensitive sterile rice and germplasm genetic improvement of the photo-thermo-sensitive sterile rice.

Description

Technical Field

[0001] The invention relates to the field of rice crop genetic breeding, and in particular to a rice semi-dwarf male photothermosensitive sterile gene with high breeding value and an application thereof. Technical Background

[0002] Rice is an important staple crop in my country and plays a vital role in food security. Improving yield is the current goal of rice breeding (Song S, Tian D, Zhang Z, et al. 2018. Rice genomics: over the past two decades and into the future. Genom Proteom Bioinf [J], 16: 397-404.). Pollen fertility is a key factor affecting rice fruiting rate, and abnormal pollen development will lead to reduced crop yield. In addition, fertility-related germplasm resources are widely used in breeding. Two-line and three-line hybrid seed production based on male sterile lines are the main technical approaches to utilize hybrid vigor. Therefore, the identification of fertility-related genes lays the application foundation for the effective utilization of hybrid vigor and has received widespread attention in the industry.

[0003] The study of plant pollen fertility genes has been an important research direction in the past decade. The development process of rice pollen is very complicated. Previous researchers divided the development process of anthers into 14 stages through careful observation of anther sections. During the development of rice pollen, any abnormality in any link will lead to pollen abortion (Wilson Z, Zhang D. 2009. From Arabidopsis to rice: pathways in pollen development. J Exp Bot [J], 60: 1479-1492.).

[0004] Environmentally sensitive male sterility (EGMS) is mainly divided into photosensitive male sterility (PGMS) and thermosensitive male sterility (TGMS). In rice, thermosensitive male sterility genes represented by tms5 and photosensitive male sterility genes represented by pms1 are widely used in the two-line hybrid seed production process. In the production and seed production process, photosensitive male sterile materials as receptor materials often need to slightly reduce plant height, which is convenient for the "pollen rush" operation, thereby quickly and large-scale hybrid seed production. The currently mainly used TMS5 and PMS1 genes only affect pollen fertility and do not affect rice plant height. Therefore, in the production process, it is also necessary to consider introducing TMS5 and PMS1 into materials with shorter plant heights to facilitate their application. However, the photosensitive genes reported so far do not have the phenotypes of semi-dwarf and pollen photosensitive sterility at the same time, which is not conducive to the rapid cultivation of new varieties. In short, it is necessary to explore genes that reduce plant height and have male photosensitive characteristics.

[0005] The cytoskeleton is one of the basic components of cells and is an indispensable complex fibrous network structure in cells. The cytoskeleton is mainly composed of three parts, namely, microfilaments, microtubules, and intermediate filaments. The cytoskeleton has many important functions, including maintaining the morphology of cells, controlling the separation of chromosomes, the movement of vesicles, and guiding the synthesis of cell walls (Frixione E.2000.Recurring views on the structure and function of thecytoskeleton:a 300-year epic.Cell Motil Cytoskeleton[J],46(2):73-94.). Microfilaments are special 7nm structures composed of actin. Actin and its related proteins control the stability of microfilaments, thereby regulating the life activities of animals and plants. In plants, actin controls the elongation of pollen tubes, the transport of vesicles and other activities (Blanchoin L, Staiger C J. 2010. Plant Formins: Diverse isoforms and unique molecular mechanisms. BBA-Mol Cell Res [J], 1803 (2): 201-206.). Actin-composed microfilaments are a dynamic polymer. According to the needs of life activities, actin can be rapidly assembled on the one hand, and depolymerized on the other hand, and different microfilament-related proteins are involved in this process. However, so far, the biological function of microfilaments in regulating plant pollen development is still unclear. Summary of the invention

[0006] In response to the needs of the prior art, the present invention discovered the rice semi-dwarf male photothermosensitive sterility gene OsPFN2 through research.

[0007] The present invention first provides a protein encoded by a rice semi-dwarf male photothermo-sensitive sterility gene OsPFN2 or a mutant thereof, characterized in that the amino acid sequences thereof are shown in SEQ ID NO.2 and SEQ ID NO.5, respectively.

[0008] Further providing a gene encoding the rice semi-dwarf male photothermosensitive sterility gene OsPFN2 or its mutant;

[0009] Preferably, the gene OsPFN2 encodes the actin-binding protein PFN2, and its cDNA sequence is shown as SEQ ID NO.1, or its genomic sequence is shown as SEQ ID NO.3; the mutant gene lacks three bases "ATG" at positions 34 to 36 relative to the cDNA sequence of the wild-type OsPFN2, and specifically its cDNA sequence is shown as SEQ ID NO.4, or its genomic sequence is shown as SEQ ID NO.6.

[0010] The invention provides a recombinant expression vector containing the rice semi-dwarf male photothermosensitive sterility gene OsPFN2 or its mutant gene.

[0011] The present invention also provides a recombinant host cell containing the rice semi-dwarf male photothermo-sensitive sterility gene OsPFN2 or its mutant, or the recombinant expression vector.

[0012] The present invention further provides the use of the rice semi-dwarf male photo-thermo-sensitive sterility gene OsPFN2 or its mutant, or its encoded protein in rice breeding.

[0013] Specifically, the method comprises performing gene editing in normal wild-type rice or introducing the mutant gene of the rice semi-dwarf male photo-thermo-sensitive sterile gene OsPFN2 into rice by hybridization to obtain semi-dwarf male photo-thermo-sensitive sterile rice;

[0014] Preferably, the photothermosensitive sterility means that the mature pollen of rice is completely sterile under high temperature conditions of 28°C, and is completely fertile under low temperature conditions of 23°C.

[0015] Specifically, it is used in improving male photothermosensitive sterile rice germplasm resources.

[0016] More specifically, the rice semi-dwarf male photothermo-sensitive sterile gene OsPFN2 is introduced into male photothermo-sensitive sterile rice germplasm resources by gene editing or hybridization to improve the plant type and / or critical temperature of pollen abortion.

[0017] The present invention provides a method for cultivating semi-dwarf male photothermosensitive sterile rice, which comprises the following steps: performing gene editing in normal wild-type rice; obtaining semi-dwarf male photothermosensitive sterile rice by screening;

[0018] Alternatively, a rice plant containing a mutant gene of the semi-dwarf male photo-thermo-sensitive sterile gene OsPFN2 is used as a female parent and a rice plant having an excellent phenotype is used as a male parent to screen and obtain semi-dwarf male photo-thermo-sensitive sterile rice from the offspring; the mutant gene of the semi-dwarf male photo-thermo-sensitive sterile gene OsPFN2 lacks three bases "ATG" at positions 34 to 36 relative to the cDNA sequence of the wild-type OsPFN2;

[0019] Preferably, the Indel markers used for identification are as follows:

[0020] Indel-3F: TGAGGCGAAGATGTCGTGG, Indel-3R: GTCGTGGCCGACGATGG) for genotype identification;

[0021] Alternatively, the sequencing primers used for identification are as follows:

[0022] PFN2mutant-F:CATCTGAAACGGAGGTAGTACTC

[0023] PFN2mutant-R:GGAAACAACACCATAAGCGTA.

[0024] Specifically, the rice is japonica rice or indica rice, for example, japonica rice varieties "Zhonghua 11", "Kitaake", "Dianjingyou 1", "Ningjing 4"; indica rice varieties are "Dular", etc., and there are no special requirements for varieties.

[0025] By detecting the mutation site of the semi-dwarf male photo-thermo-sensitive sterile rice gene OsPFN2 of the present invention, potential male photo-thermo-sensitive sterile materials can be found. In the hybrid breeding process, the gene is introduced into the recipient parent by hybridization or genetic transformation to create a semi-dwarf and photo-thermo-sensitive male sterile backbone parent material, or to genetically improve the existing photo-thermo-sensitive sterile material for application in rice hybrid seed production. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Comparison of plant type, anther, pollen, and embryo sac phenotypes of wild-type NIP and semi-dwarf photothermosensitive male sterile mutant pfn2-2. (a) Plant morphology of wild-type NIP and mutant pfn2-2. (bc) Anther morphology of wild-type NIP and mutant pfn2-2. (de) Pollen morphology of wild-type NIP and mutant pfn2-2. (fg) Embryo sac morphology of wild-type NIP and mutant pfn2-2.

[0027] Figure 2The mutation site of the semi-dwarf photothermosensitive male sterile mutant pfn2-2, OsPFN2, was shown to have a deletion of three bases "ATG" from position 34 to 36.

[0028] Figure 3 The hybrids of the semi-dwarf photothermosensitive male sterile mutant pfn2-2 and the wild type NIP can set fruit normally after seedlings. (ab) Show the plant morphology of NIP, pfn2-2 mutant, and F1 (NIP / pfn2-2). (ce) Show the pollen morphology of NIP, pfn2-2 mutant, and F1 (NIP / pfn2-2). (f) Show the pollen fertility statistics of Nipponbare, pfn2-2 mutant, and F1 (NIP / pfn2-2). (gh) Pollen fertility statistics of pfn2-2 under different temperature and light conditions.

[0029] Figure 4 The abnormal chromosome segregation of the mutant pfn2-2 during meiosis is shown. (a) Observation of abnormal chromosome arrangement and segregation in pollen mother cells of pfn2-2. (b) Statistical analysis of the proportion of abnormal chromosome arrangement in pfn2-2. (c) Statistical analysis of the proportion of abnormal chromosome segregation in pfn2-2.

[0030] Figure 5 Semi-thin sections are shown to observe the anther locule structure of NIP and the semi-dwarf photothermosensitive male sterile mutant pfn2-2. (a) Comparison of anther locule structure of NIP and pfn2-2 mutants at different stages. (b) Locule structure morphology of pfn2-2 mutant at S11 and S12 stages.

[0031] Figure 6 Figure 2 shows knockout of OsPFN2 in japonica rice NIP and Kitaake. (a) Plant morphology of wild type and mutant pfn2-2-NIP in NIP background; (bc) Pollen morphology of wild type and mutant pfn2-2-NIP; (d) Plant morphology of wild type and mutant pfn2-2-kiaake in Kitaake background; (ef) Pollen morphology of wild type and pfn2-2-kiaake mutant.

[0032] Figure 7 The expression profile analysis of OsPFN2 is shown. (a) qRT-PCR quantitative analysis of the expression level of OsPFN2 in different tissues. (bh) GUS staining method analysis of the expression level of OsPFN2 in different tissues.

[0033] Figure 8 Comparison of plant photos of DJY, pfn2-2, DJY / pfn2-2, and NIP is shown.

[0034] Fig. 9The phenotypes of wild-type NIP and pfn2-2 in the field were observed, and the genotype of the pfn2-2 mutant was analyzed by polyacrylamide gel electrophoresis to remove impurities. (ab) Plots of pfn2-2 mutants after molecular marker screening; (c) Indel marker screening of pfn2-2 mutants at the seedling stage. The red arrows indicate heterozygous plants.

[0035] Fig.10 A vector map of the CRISPR-CAS9 knockout vector used in the present invention is shown. DETAILED DESCRIPTION

[0036] The following examples further illustrate the content of the present invention and describe the method of isolating and cloning the DNA fragment of the complete segment of OsPFN2 based on the above-mentioned preliminary work, and verifying the function of OsPFN2. According to the following description and these examples, those skilled in the art can determine the basic characteristics of the present invention. If not specifically stated, the technical means used are conventional means known to those skilled in the art.

[0037] Example 1: Genetic analysis of mutant pfn2-2 and cloning of the OsPFN2 gene

[0038] In the present invention, multiple targets were first designed in the japonica rice variety Nipponbare (NIP) by CRIPSR-Cas9 (the knockout vector used the pCAMBIA1305.1 vector from our laboratory) to perform gene editing on two genes of the rice Profilin family, OsPFN1 and OsPFN2 (Table 1), and different editing types of OsPFN1 and OsPFN2 mutants were obtained. Among the knockout families of OsPFN2, there was a mutant family that showed complete spikelet sterility (the knockout target was PFN2site-2: CCTGATGTGCGAGATTGACG), recorded as "pfn2-2". The morphology of the pollen was identified by staining with 1% (w / v) I2-KI solution, and it was found that the pollen of the wild-type NIP was normal, while the pollen of pfn2-2 was completely sterile ( Figure 1 In addition, the plant height of the mutant pfn2-2 showed a semi-dwarf phenotype ( Figure 1 ). Through sequencing, it was found that there was a deletion of three bases "ATG" from 34 to 36 of the cDNA sequence of OsPFN2 in the mutant, resulting in the deletion of a "methionine" in the expressed protein of OsPFN2 ( Figure 2). The offspring of the heterozygous PFN2 / pfn2-2 were planted in the field for phenotypic observation, and 50 sterile plants and 166 fertile plants were found. Genotyping was performed using Indel markers (Indel-3F: TGAGGCGAAGATGTCGTGG, Indel-3R: GTCGTGGCCGACGATGG), and 57 plants with the genotype PFN2 / PFN2, 109 plants with the genotype PFN2 / pfn2-2, and 50 plants with the genotype pfn2-2 / pfn2-2 were found. The phenotype and genotype were completely co-segregated (Table 2). This proves that the sterile phenotype is controlled by a recessive single gene. Among them, the gene OsPFN2 encodes the actin-binding protein PFN2, and its cDNA sequence is shown as SEQ ID NO.1, or its genomic sequence is shown as SEQ ID NO.3; the mutant gene lacks three bases "ATG" at positions 34 to 36 relative to the cDNA sequence of the wild-type OsPFN2, and its specific cDNA sequence is shown as SEQ ID NO.4, or its genomic sequence is shown as SEQ ID NO.6.

[0039] Table 1. Profilin protein family gene knockout target sequences

[0040] Gene name Knockout target number Target sequence OsPFN1 PFN1site-1 AATATGGCAGAACGTACAAG OsPFN1 PFN1site-2 GTGGTCATTTCGATTTCCAT OsPFN1 PFN1site-3 TCCTCGTCGGGTGTTCGTCG OsPFN2 PFN2site-1 TGGTGATCCAAGGTGAACCA OsPFN2 PFN2site-2 CCTGATGTGCGAGATTGACG OsPFN2 PFN2site-3 GGCGATTATCTGATCGAGCA

[0041] Table 2. Genetic analysis of pfn2-2 mutants

[0042] genotype Statistical number of plants Expected number of plants Phenotype PFN2 / PFN2 57 54 pollen fertile PFN2 / pfn2-2 109 108 pollen fertile pfn2-2 / pfn2-2 50 54 Completely sterile pollen

[0043] Development of Indel markers used in Table 2: The published Nipponbare (japonica rice) related sequences were downloaded from the Gramene website, and sequence alignment was performed. The corresponding markers were designed using Primer Premier 5.0 software to detect genotype differences.

[0044] The method of the above molecular marker analysis is as follows:

[0045] (1) Extract the total DNA of the single plant as a template for PCR amplification. The specific method is as follows: 1. Take about 0.2 g of rice leaves, place them in a 2.0 mL test tube with steel balls, freeze them in liquid nitrogen for 5 minutes, and grind the samples on a grinder; 2. Add 600 μL of CTAB extraction solution and place them in a water bath at 65°C for 30 minutes; 3. Add 900 μL of chloroform, mix them thoroughly, and centrifuge them at 12,000 rpm for 3 minutes; 4. Transfer all the supernatant to a 1.5 mL test tube, add 600 μL of isopropanol, mix them, and centrifuge them at 12,000 rpm for 5 minutes; 5. Discard the supernatant, rinse the precipitate once with 70% ethanol, and dry it at room temperature; 6. Add 100 μL of pure water to dissolve the DNA; 7. Take 2 μL of total DNA, detect the DNA quality by electrophoresis, and measure the concentration by a spectrophotometer.

[0046] (2) diluting the extracted DNA to about 50 ng / μL and using it as a template for PCR amplification;

[0047] PCR reaction system (10μL): DNA (50ng / uL) 1ul, F primer (2pmol / uL) 1ul, R primer (2pmol / uL) 1ul, 10XBuffer (MgCl2 free) 1uL, dNTP (10mM) 0.2uL, MgCl2 (25mM) 0.6uL, Taq (5u / uL) 0.1uL, ddH2O 5.1uL, a total of 10uL reaction system.

[0048] PCR reaction program: denaturation at 94.0°C for 5 minutes; denaturation at 94.0°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, for a total of 35 cycles; extension at 72°C for 7 minutes; storage at 10°C.

[0049] (3) Detection of molecular marker PCR products

[0050] The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis, and the molecular weight of the amplified products was compared with 50 bp DNA ladder as a control, and the color was visualized by silver staining.

[0051] Example 2: Cytological observation of the light-temperature sensitive phenotype of the mutant pfn2-2

[0052] During the research, it was found that the pfn2-2 mutant has significant light and temperature sensitivity. That is, under high temperature or long-day conditions (temperature: 28°C, daylight: 14.5 hours), pollen is completely sterile; under low temperature or short-day conditions (temperature: 23°C, daylight: 11.5 hours), pollen returns to normal ( Figure 3). Verification was carried out in Sanya, Hainan, Beijing, Nanjing, and Hangzhou for many years, and it was proved that the mutant pfn2-2 has light and temperature sensitive characteristics. In order to verify whether this gene can be used in hybrid breeding, the mutant pfn2-2 was hybridized with wild-type NIP to produce F1 hybrids, and it was found that the pollen of F1 hybrids was completely fertile ( Figure 3 ).

[0053] In order to find out the cause of pollen abortion, DAPI staining and semi-thin section observation were performed. It was found that in the pollen mother cells of the mutant pfn2-2, some chromosomes were misaligned and separated ( Figure 4 In addition, the anther locules of the mutant pfn2-2 were partially shrunken and the middle layer could not be degraded ( Figure 5 ). Therefore, abnormal chromosome segregation and abnormal tapetum degradation are the cytological causes of complete pollen abortion.

[0054] Example 3: Clarifying the function of target genes

[0055] To further prove that the deletion of three bases in OsPFN2 is the cause of the photothermosensitive phenotype, we constructed a Cas9-free OsPFN2TKC knockout vector (the vector came from Zhao Yunde's laboratory, and the target site was CCTGATGTGCGAGATTGACG), and transformed it into japonica rice Nipponbare and Kitaake, respectively. After the callus was cultured into seedlings, multiple transgenic families were obtained. Phenotypic identification found that in the transgenic plants of NIP and Kitaake, the deletion of OsPFN2 "ATG" had a phenotype of complete high temperature sterility ( Figure 6 ). In summary, it is believed that the deletion of three bases "ATG" from the 34th to the 36th position of OsPFN2 is the genetic cause of pollen abortion.

[0056] Example 4: Analysis of the expression pattern of OsPFN2

[0057] In order to clarify the expression pattern of the OsPFN2 gene, qRT-PCR technology and β-glucuronidase (GUS) staining method were used to identify its expression pattern. First, the expression level of OsPFN2 in the roots, stems, leaves, spikelets and anthers of different developmental stages of wild-type Nipponbare was detected by qRT-PCR technology. It was found that OsPFN2 showed a constitutive expression pattern in various tissues, with a higher expression level in the spikelets. In addition, it was also found that OsPFN2 had a high expression level at various stages of anther development ( Figure 7 ).

[0058] By transferring the pPFN2:GUS vector into the wild-type Nipponbare, and identifying the transgenic positive plants, GUS staining was performed to identify that OsPFN2 was expressed in all tissues. In addition, anthers at different stages were stained, and the staining results were consistent with the results of qRT-PCR. GUS staining signals could be detected in anthers at different developmental stages, and the levels were not much different ( Figure 7 ). The above results indicate that OsPFN2 is a constitutively expressed gene, expressed in different tissues, and has a high expression level in anthers.

[0059] Example 5: Creation of semi-dwarf photothermosensitive male sterile lines using CRISPR-Cas9 technology and their applications

[0060] The mutant pfn2-2 created by the CRISPR-Cas9 method was used as the female parent to cross with the japonica rice Dianjingyou (DJY) to produce hundreds of F1 hybrids. The hybrids were planted individually, and markers were used to identify whether the F1 background was a true hybrid. Comparing the phenotypes of DJY, pfn2-2, and DJY / pfn2-2, it was found that the plant height of F1 was between the two parents, and the fertility was normal ( Figure 8 ). The above proves that this method can be used in agricultural production.

[0061] Example 6: Identification of the genotype of the pfn2-2 semi-dwarf photothermosensitive male sterile line using molecular markers

[0062] In order to quickly identify the genotype of pfn2-2 at the seedling stage, a pair of Indel primers (Indel-3F: TGAGGCGAAGATGTCGTG G, Indel-3R: GTCGTGGCCGACGATGG) were designed for polyacrylamide gel electrophoresis experiments. The results showed that the markers were available and could clearly distinguish homozygous and heterozygous genotypes. After marker screening, the homozygous genotype plants were planted, and it was found that all the plants in the plot were semi-dwarf and high-temperature sterile, which can be used for large-scale hybrid seed production. The above results prove that the method of using molecular markers to identify the genotype of pfn2-2 semi-dwarf photothermosensitive male sterile plants is feasible. In addition to using markers to identify the genotype of pfn2-2 at the seedling stage, plant height is also an important trait for distinguishing pfn2-2 homozygous mutants. All semi-dwarf pfn2-2 plants are completely sterile, and the two phenotypes are closely linked. Therefore, by combining markers and phenotypic observations, pfn2-2 semi-dwarf photothermosensitive male sterile mutants can be stably obtained and propagated.

Claims

1. A semi-dwarf male photothermosensitive sterility gene in rice OsPFN2 or a protein encoded by a mutant thereof, characterized in that The amino acid sequences thereof are shown in SEQ ID NO.2 and SEQ ID NO.5 respectively.

2. Encoding the rice semi-dwarf male photothermosensitive sterility gene as claimed in claim 1 OsPFN2 or a gene or a mutant thereof; Preferably, the gene OsPFN2 Encoding actin binding protein PFN2, whose cDNA sequence is shown in SEQ ID NO.1, or whose genomic sequence is shown in SEQ ID NO.3; the mutant gene is different from the wild type OsPFN2 The cDNA sequence of the gene is missing three bases "ATG" at positions 34 to 36. Specifically, its cDNA sequence is shown in SEQ ID NO.4, or its genomic sequence is shown in SEQ ID NO.

6.

3. A rice containing the semi-dwarf male photo-thermo-sensitive sterility gene as claimed in claim 1 OsPFN2 Or a recombinant expression vector of a mutant gene thereof.

4. A rice containing the semi-dwarf male photothermo-sensitive sterility gene as claimed in claim 1 OsPFN2 Or a mutant thereof, or a recombinant host cell containing the recombinant expression vector as claimed in claim 4.

5. The semi-dwarf male photothermosensitive sterility gene of rice as claimed in claim 1 OsPFN2 Or its mutant, or its encoded protein in rice breeding.

6. The use according to claim 5, characterized in that The method is to edit genes in normal wild-type rice or to introduce the semi-dwarf male photothermosensitive sterility gene of rice into the normal wild-type rice by hybridization. OsPFN2 The mutant gene of was introduced into rice to obtain semi-dwarf male photothermosensitive sterile rice; Preferably, the photothermosensitive sterility means that the mature pollen of rice is completely sterile under high temperature conditions of 28°C, and is completely fertile under low temperature conditions of 23°C.

7. The use according to claim 6, characterized in that It is used in improving male photothermosensitive sterile rice germplasm resources.

8. The use according to claim 7, characterized in that The semi-dwarf male photothermosensitive sterility gene of rice is introduced into the rice by gene editing or hybridization. OsPFN2 Introduce male photothermosensitive sterile rice germplasm resources to improve their plant type and / or critical temperature of pollen abortion.

9. A method for cultivating semi-dwarf male photothermosensitive sterile rice, characterized in that: The method comprises the following steps: performing gene editing in normal wild-type rice; obtaining semi-dwarf male photothermosensitive sterile rice by screening; Alternatively, by hybridization, the semi-dwarf male photothermo-sensitive sterility gene OsPFN2 The semi-dwarf male photothermosensitive sterile rice is obtained by hybridizing rice with a mutant gene as the female parent and rice with a good phenotype as the male parent, and screening the semi-dwarf male photothermosensitive sterile rice from the offspring; the semi-dwarf male photothermosensitive sterile rice is obtained by hybridizing rice with a mutant gene as the female parent and rice with a good phenotype as the male parent. OsPFN2 The mutant gene is relative to the wild type OsPFN2 The cDNA sequence of the gene lacks three bases "ATG" at positions 34 to 36; Preferably, the Indel markers used for identification are as follows: Indel-3F: TGAGGCGAAGATGTCGTGG, Indel-3R: GTCGTGGCCGACGATGG) for genotype identification; Alternatively, the sequencing primers used for identification are as follows: PFN2mutant-F: CATCTGAAACGGAGGTAGTACTC PFN2mutant-R: GGAAACAACACCATAAGCGTA.

10. The cultivation method according to claim 9, characterized in that The rice is japonica rice or indica rice, for example, japonica rice varieties "Zhonghua 11", "Kitaake", "Dianjingyou 1", "Ningjing 4"; the indica rice variety is "Dular".

Images