A novel human type II collagen COLII-14K-H, gene and application thereof

Abstract

The application provides a novel human type II collagen COLII-14K-H and a coding gene thereof, the coding gene is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2. The application also provides a preparation method of the human type II collagen COLII-14K-H and application thereof in preparing cartilage repair drugs, skin repair drugs and skin care products. The human type II collagen can significantly improve the collagen gene expression level, realize the improvement of the content of collagen in human dermal fibroblasts, and delay skin aging. Meanwhile, the protein fragment can exhibit a significant skin repair effect at a low concentration, provides a new treatment option for skin repair, and can be widely applied in the fields of skin repair and care.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology and medical health, and particularly relates to a novel human type II collagen COLII-14K-H, a gene thereof and an application thereof. BACKGROUND

[0002] As an important member of the collagen family, type II collagen has shown wide application potential in the field of biomedicine, especially in the field of bone and joint health and biomaterial science. Its unique molecular structure and biological activity make type II collagen irreplaceable in promoting cartilage repair, enhancing joint function, and serving as a basic component of biomaterials.

[0003] In the field of bone and joint health, type II collagen is one of the main components of cartilage tissue, which is crucial for maintaining the flexibility and stability of joints. With age or disease, cartilage tissue gradually degenerates, leading to joint pain, stiffness, and even dysfunction. The supplementation and application of type II collagen can stimulate the proliferation and differentiation of chondrocytes, promote the synthesis and repair of cartilage matrix, thereby effectively improving joint health and improving the quality of life of patients.

[0004] In addition, in the field of biomaterial science, type II collagen is widely used in tissue engineering scaffolds, drug carriers, and regenerative medicine materials due to its good biocompatibility, biodegradability, and biological activity. By compounding or modifying with other biomaterials, its performance can be further optimized to meet different clinical needs. For example, biomaterial scaffolds based on type II collagen can simulate the microenvironment of natural cartilage tissue, guide cell growth and differentiation, and promote tissue regeneration and repair.

[0005] However, despite the significant achievements of type II collagen in the field of bone and joint health and biomaterial science, its application in the field of skin health is relatively limited.

[0006] Wound healing in the skin is a highly complex and finely regulated biological process that encompasses a series of pathophysiological stages that are both continuous and interwoven, including the inflammatory, proliferative, and remodeling phases. This series of processes is deeply rooted in the complex interaction network between various cell types, cytokines, growth factors, and extracellular matrix. According to the latest statistics on the number of global chronic wound patients, although there are some differences, a study in the journal Research and Reviews in Plant Science indicates that about 13 million people worldwide suffer from chronic wounds each year. Given this, finding safe and efficient wound healing materials has become a hot and important topic in current biomedical research.

[0007] Modern scientific research has confirmed that the use of natural bioactive ingredients such as collagen can significantly optimize and accelerate the process of wound healing. Collagen plays a crucial role in the process of chemotaxis, not only can guide fibroblasts to the wound site and adhere efficiently, but also can promote the proliferation of fibroblasts. In addition, collagen also has a positive effect on the deposition of collagen fibers in the wound area and the remodeling of the tissue structure, thereby further promoting the overall process of wound healing.

[0008] Therefore, it is of great significance to actively develop skin products based on type II collagen, and to explore its potential in skin repair, collagen regeneration promotion, etc. by in-depth study of the specific mechanism and effect of type II collagen in the wound healing process. SUMMARY

[0009] The technical problem to be solved by the present application is to provide a novel human type II collagen COLII-14K-H, its gene and application.

[0010] The technical problem is solved by the following technical solutions of the present application:

[0011] A novel human type II collagen COLII-14K-H, the amino acid sequence of which is shown in SEQ ID NO. 2.

[0012] As one of the preferred modes of the present application, the human type II collagen COLII-14K-H contains one "GER" and two "GEK integrin recognition sites".

[0013] A coding gene of the above-mentioned novel human type II collagen COLII-14K-H, the gene is COLII-14K-H, the nucleotide sequence is shown in SEQ ID NO. 1.

[0014] As one of the preferred modes of the present application, the nucleotide sequence shown in SEQ ID NO. 1 is codon-optimized and adapted to the sequence of the Pichia pastoris expression system.

[0015] A preparation method of the above-mentioned human type II collagen COLII-14K-H, comprising the following steps:

[0016] (1) synthesizing the nucleotide sequence shown in SEQ ID NO. 1, which codes the human type II collagen COLII-14K-H;

[0017] (2) constructing a recombinant expression vector pPIC9K-COLII-14K-H containing the DNA fragment coding the human type II collagen COLII-14K-H;

[0018] (3) linearizing the constructed group expression vector, and then transferring into Pichia pastoris GS115 competent cells to obtain recombinant Pichia pastoris engineering bacteria;

[0019] (4) screening and fermentation culture of the recombinant bacteria to obtain human type II collagen COLII-14K-H;

[0020] (5) combining nickel ion affinity chromatography and dialysis to separate and purify the human type II collagen COLII-14K-H expressed in step (4).

[0021] The application of the human type II collagen COLII-14K-H in the preparation of cartilage repair or skin repair drugs.

[0022] As one of the preferred modes of the present application, the human type II collagen COLII-14K-H is used for promoting cartilage repair.

[0023] As one of the preferred modes of the present application, the human type II collagen COLII-14K-H is used for promoting skin wound repair, accelerating the migration, proliferation and scratch repair of skin cells.

[0024] As one of the preferred modes of the present application, the form of the skin repair drug is one of gel, mask, liquid secondary polishing agent.

[0025] The application of the human type II collagen COLII-14K-H in the preparation of skin care products.

[0026] As one of the preferred modes of the present application, the human type II collagen COLII-14K-H is used for increasing the expression level and protein expression level of type I and III collagen genes in human skin fibroblasts, promoting the generation of collagen in human skin cells; and for increasing the transcription level of elastin genes in human skin fibroblasts, promoting the generation of elastin in human skin cells.

[0027] As one of the preferred modes of the present application, the form of the skin care product is one of toner, essence, mask, emulsion, moisturizing lotion, cream and eye cream.

[0028] Compared with the prior art, the present application has the following advantages:

[0029] (1) The human type II collagen COLII-14K-H fragment provided by the application contains one "GER" and two "GEK integrin recognition sites" (integrins can recognize GER and GEK sites, not only can mediate cell adhesion to the extracellular matrix, but also can activate various biological processes in cells through signal transduction pathways, promote cell proliferation and adhesion, and are essential for biological processes such as tissue repair and regeneration), the key active region of human type II collagen is accurately selected, and the base sequence is optimized to enhance the cell adhesion and integrin binding capacity;

[0030] (2) According to the expression characteristics of Pichia pastoris, the nucleotide sequence coding the recombinant human type II collagen is optimized by codon optimization, so that the nucleotide sequence coding the recombinant human type II collagen is more suitable for the expression system of Pichia pastoris, and a high-yield engineering strain of recombinant type II collagen is obtained through rapid screening of small-scale expression;

[0031] (3) In the purification of the recombinant human type II collagen COLII-14K-H, nickel ion affinity chromatography and one-step dialysis are used for purification, so that the recombinant human type II collagen with high purity and high recovery rate can be obtained;

[0032] (4) The Pichia pastoris is used as an expression host to produce the recombinant human type II collagen COLII-14K-H, which has the advantages of no endotoxin, post-translational modification of collagen, high-density fermentation, etc., and these characteristics ensure the excellent performance of the collagen produced by the application in biological function;

[0033] (5) The expression vector used in the application is a secretory expression vector pPIC9K, which can express collagen in the supernatant of fermentation broth, and the content of impurities in the supernatant is low, which greatly simplifies the downstream purification steps, significantly reduces the purification time and cost, and provides strong support for industrial production of recombinant collagen;

[0034] (6) The recombinant human type II collagen COLII-14K-H provided by the application can realize low amount and high efficiency in "skin repair", that is, it can show significant skin repair effect (highly promote skin cell adhesion and cell migration, and promote skin repair) at a low concentration, and the effect is comparable to that of commercially available recombinant collagen and natural animal collagen;

[0035] (7) The recombinant human type II collagen fragment provided by the application can effectively improve the expression level of type I and III collagen genes and the protein expression level in human skin fibroblasts in the aspect of "skin care", thereby promoting the generation of collagen in human skin cells (which is not found in similar recombinant collagens at present); meanwhile, the recombinant human type II collagen fragment can effectively improve the transcription level of elastin genes in human skin fibroblasts, promote the generation of elastin, and improve the elasticity of skin. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 is an active site map of the recombinant human type II collagen fragment COLII-14K-H amino acid sequence in Example 1 (in the figure, GER and GEK are integrin recognition sites);

[0037] Figure 2 is a protein electrophoresis map of the recombinant human type II collagen COLII-14K-H obtained by separation and purification in Example 5 (in the figure, the first lane is a protein Marker, and the second lane is the purified COLII-14K-H protein; the electrophoretic detection molecular weight of the COLII-14K-H protein is about 23 kDa);

[0038] Figure 3 is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the proliferation of human chondrocytes in Example 5 (in the figure, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0039] Figure 4 is a microphotograph of the experiment showing the effect of the recombinant human type II collagen COLII-14K-H on the migration of human chondrocytes;

[0040] Figure 5 is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the migration rate of human chondrocytes in Example 5 (in the figure, A is the 24h migration result, and B is the 48h migration result; "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0041] Figure 6 is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the proliferation of human immortalized epidermal cells in Example 6 (in the figure, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0042] Figure 7 is a microphotograph of the experiment showing the effect of the recombinant human type II collagen COLII-14K-H on the migration of human immortalized epidermal cells in Example 6;

[0043] Figure 8 is a graph showing the effect of recombinant human collagen type II COLII-14K-H on the migration of human immortalized epidermal cells in Example 6 (in the graph, A is a result of 24h migration, B is a result of 48h migration, "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001);

[0044] Figure 9 is a graph showing the effect of recombinant human collagen type II COLII-14K-H on the proliferation of human fibroblast cells in Example 7 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001);

[0045] Figure 10 is a microphotograph showing the experiment of the effect of recombinant human collagen type II COLII-14K-H on the migration of human fibroblast cells in Example 7;

[0046] Figure 11 is a graph showing the effect of recombinant human collagen type II COLII-14K-H on the migration of human fibroblast cells in Example 7 (in the graph, A is a result of 24h migration rate, B is a result of 48h migration rate; "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001);

[0047] Figure 12 is a graph showing the effect of recombinant human collagen type II COLII-14K-H on the adhesion of human fibroblast cells in Example 7 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, "***" P<0.001);

[0048] Figure 13 is a graph showing the result of promoting the expression of collagen type I and III genes of human fibroblast HSF by recombinant human collagen type II COLII-14K-H in Example 8 (in the graph, A is a result of collagen type I gene, B is a result of collagen type III gene; "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001);

[0049] Figure 14 is a graph showing the result of promoting the expression of collagen type I of human fibroblast HSF by recombinant human collagen type II COLII-14K-H in Example 9 (in the graph, A is a result of 24h, B is a result of 48h; "*" indicates P<0.05, "**" indicates P<0.01);

[0050] Figure 15is a result graph of the expression of type III collagen of human fibroblast HSF promoted by recombinant human type II collagen COLII-14K-H in Example 9;

[0051] Figure 16 is a result graph of the increase of the transcription level of elastin gene of human fibroblast HSF promoted by recombinant human type II collagen COLII-14K-H in Example 10 (in the graph, "**" represents P<0.01);

[0052] Figure 17 is a graph of the effect of recombinant human type II collagen COLII-23 on the migration of human fibroblast in Example 11 (in the graph, A is the result of 24h migration rate, B is the result of 48h migration rate; "*" represents P<0.05, "**" represents P<0.01, "***" represents P<0.001, and "****" represents P<0.0001). DETAILED DESCRIPTION

[0053] The following detailed description of the embodiments of the present application is made on the premise of the technical solutions of the present application, and detailed implementation manners and specific operation processes are given, but the protection scope of the present application is not limited to the following embodiments.

[0054] The Pichia pastoris GS115 competent cells used in the following embodiments are from Shanghai Angyuan Company, the expression vector pPIC9K is from Shanghai Shenguo Company, and the other reagents or instruments used without the manufacturer being specified are all conventional products that can be purchased through a regular channel. The used culture medium formula is as follows:

[0055] (1) YPD complete medium (1L): 10 g of yeast extract and 20 g of peptone are added to 900 mL of water, which is autoclaved at high temperature and high pressure, and then 100 mL of sterile 10X glucose solution is added. The solid medium is additionally added with 1.5% agar powder.

[0056] (2) MD medium (1L): 800 mL of water is autoclaved at high temperature and high pressure, and then cooled to 60°C, and then 100 mL of 10X YNB, 100 mL of 10X glucose, and 2 mL of 500X biotin are added. The solid medium is additionally added with 1.5% agar powder.

[0057] (3) BMGY medium (1L): 10 g of yeast extract and 20 g of peptone are added to 700 mL of water, which is autoclaved at high temperature and high pressure, and then cooled to room temperature, and then 100 mL of 1M potassium phosphate buffer (pH 6.0), 100 mL of 10X YNB, 100 mL of 10X glycerol, and 2 mL of 500X biotin are added.

[0058] (4) BMMY medium (1 L): 10 g yeast extract, 20 g peptone were added to 700 mL water, autoclaved at high temperature and high pressure, cooled to room temperature, then 100 mL of 1M potassium phosphate buffer (pH 6.0), 100 mL of 10X YNB, 100 mL of 5% methanol and 2 mL of 500X biotin were added.

[0059] Meanwhile, the DMEM basic culture solution, PBS, fetal bovine serum (FBS), trypsin used in the following examples come from vivacell company, human chondrocyte C28I2 comes from BFB Shanghai Cell Bank, human immortalized epidermal cell line HaCaT comes from Oricell company, human skin fibroblast HSF comes from Shanghai Fuheng Biotechnology Co., Ltd.

[0060] Example 1

[0061] Recombinant human type II collagen COLII-14K-H coding gene:

[0062] The final screening optimized recombinant human type II collagen fragment COLII-14K-H coding gene of the application has a nucleotide sequence as shown in SEQ ID NO. 1, and a corresponding amino acid sequence as shown in SEQ ID NO. 2 (GER and GEK active sites in the amino acid sequence of the recombinant human type II collagen fragment COLII-14K-H are shown in SEQ ID NO. 2). Figure 1 )。

[0063] Gene screening optimization process:

[0064] (1) Based on the Genebank gene sequence NM_033150.3 of human type II collagen, an original sequence fragment containing one "GER" and two "GEK integrin recognition sites" was found, as shown in SEQ ID NO. 3.

[0065] (2) The sequence was optimized according to the codon bias of Pichia pastoris and the GC content of DNA sequence, and the optimized gene sequence is shown in SEQ ID NO. 1. The optimized gene sequence was synthesized by Shanghai Sunway Biotech Co., Ltd.

[0066] Example 2

[0067] Construction of recombinant expression vector pPIC9K-COLII-14K-H:

[0068] An EcoRI enzyme cutting site sequence is added at the 5' end of the coding gene sequence, and a stop codon, 6xHis tag and NotI enzyme cutting site sequence are added at the 3' end; then, the sequence fragment is inserted into the pPIC9K expression vector through the EcoRI and NotI enzyme cutting sites to obtain the corresponding recombinant expression vector pPIC9K-COLII-14K-H.

[0069] Example 3

[0070] Construction of the recombinant Pichia pastoris engineering bacteria:

[0071] (1) After linearization of the recombinant expression vector pPIC9K-COLII-14K-H, the linearized recombinant expression vector is transformed into Pichia pastoris GS115 competent cells, and the transformants are grown on MD plates for 2-5 days.

[0072] (2) The transformants are picked from the MD plates and cultured in 48-well culture plates containing 500 μL of YPD (0.75 mg / mL of G418) medium at 30°C and 240 rpm for 18-24 h; and then sequentially transferred to YPD liquid culture medium with gradually increasing G418 content for culture.

[0073] (3) The well-growing strains are fermented, and the steps are as follows:

[0074] The bacteria are inoculated in 10 mL / 50 mL BMGY at an inoculation amount of 2%, and cultured at 30°C and 240 rpm for 18-24 h; centrifuged, and the supernatant is discarded; 10 mL of BMMY is added for resuspension, and the bacteria are cultured at 28°C and 240 rpm for 48 h, and 100% methanol is added every 24 h to a final concentration of 1.5%; centrifuged, and the supernatant is subjected to SDS-PAGE analysis to obtain the recombinant Pichia pastoris engineering bacteria with high expression amount.

[0075] Example 4

[0076] Production, preparation and purification of the recombinant human type II collagen COLII-14K-H:

[0077] (1) The successfully constructed recombinant Pichia pastoris engineering bacteria are activated in YPD (containing the corresponding G418) medium at 30°C and 240 rpm for 24 h.

[0078] (2) The bacteria are inoculated in 200 mL / 1 L of BMGY at an inoculation amount of 2%, and cultured at 30°C and 240 rpm for 16-18 h.

[0079] (3) The bacteria are centrifuged, the supernatant is discarded, and the bacteria are resuspended in 200 mL of BMMY, and cultured at 28°C and 240 rpm for 48 h; and 100% methanol is added every 24 h to a final concentration of 1.5%.

[0080] (4) The supernatant after fermentation was filtered through a 0.22 μm aqueous filter membrane to obtain a clear fermentation supernatant. The recombinant type II collagen COLII-14K-H was separated and purified by nickel ion affinity chromatography and dialysis (1×PBS).

[0081] Figure 2 Electrophoresis image of the purified recombinant human type II collagen COLII-14K-H. The purified COLII-14K-H protein solution was analyzed by gel filtration chromatography and SDS-PAGE, showing a purity >95% and a recovery rate >85%.

[0082] Example 5

[0083] The growth-promoting and migration-promoting effects of recombinant human type II collagen fragment COLII-14K-H on human chondrocyte C28I2:

[0084] 1. MTT assay to determine the effect of recombinant human type II collagen on the proliferation of human chondrocytes:

[0085] (1) Human chondrocytes C28I2 were collected, digested, centrifuged, resuspended, and diluted to 2×10⁻⁶. 4 Cells / mL, 100 μL per well was seeded into a 96-well cell culture plate; at the same time, cell-free culture medium was seeded as a blank control, 37°C, 5% CO2, 95% humidity.

[0086] (2) Prepare COLII-14K-H protein suspensions at concentrations of 1.6 mg / mL, 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL.

[0087] (3) Discard the culture medium, add culture medium to the blank control, add culture medium to the negative control, add culture medium to the positive control containing 2.5 mg / mL type II chicken cartilage collagen, and add culture medium containing different concentrations of protein solution to the experimental group. Incubate at 37℃, 5% CO2, and 95% humidity for 48 h.

[0088] (4) Add 20 μL MTT to each well and incubate in an incubator for 4 h at 37 °C, 5% CO2, and 95% humidity. Add 150 μL LDMSO and incubate on a shaker for 10 min to fully dissolve the crystals. Detect the absorbance at 490 nm using a microplate reader.

[0089] Test results as follows Figure 3 As shown. By Figure 3 It can be seen that, with the negative control group (NC) as 100%, the survival rate of the experimental group with C28I2 supplemented with 0.05 mg / mL COLII-14K-H was 124%.

[0090] 2. Scratch test to measure the migration of "human chondrocytes" promoted by recombinant human collagen type II:

[0091] (1) Cell culture: Use a Marker pen to draw 5 lines horizontally in each well at the back of the 6-well plate, with an interval of about 0.5 cm between each line as a marker. Select C28I2 cells, set up a blank group, a control group, and an experimental group, and after digestion, centrifugation, and resuspension, dilute to 5 x 10 5 6 / mL, 2 mL of cell suspension per well, to ensure the same cell density in each group, and after 24 h of culture, the cells can reach 95-100% confluence.

[0092] (2) Scratch test: After 24 h of cell culture, use a 200 μL gun head to vertically and closely draw across the cell layer to form a scratch on the culture plate, rinse the cells with PBS 3 times to remove the scratched cells, and add 2 mL of culture medium containing recombinant human collagen type II COLII-14K-H in each well, with a final concentration of 1.6 mg / mL, 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL. The blank group only adds culture medium, and the positive control group adds 4% FBS (the addition of serum FBS will definitely promote cell migration) and culture medium containing 0.625 mg / mL of type II chicken cartilage collagen.

[0093] (3) Culture in a 37°C, 5% CO2, 95% humidity incubator, and take microphotographs at fixed positions after 0 h, 24 h, and 48 h, as shown in Figure 4 .

[0094] (4) Use Image J to measure the area of the scratch: use the software to process the scratch pictures (0 h, 24 h, and 48 h) to finally obtain the migration rate of the cells.

[0095] The test results are shown in Figure 5 . As can be seen from Figure 5 : the 24 h migration rate of the blank control group (NC) is 25.65%, and the 48 h migration rate is 40.13%; the 24 h migration rate after adding 0.625 mg / mL of type II chicken cartilage collagen is 28.30%, and the 48 h migration rate is 50.13%; the 24 h migration rate of the experimental group after adding 0.05 mg / mL of COLII-14K-H is 45.97%, and the 48 h migration rate is 65.51%.

[0096] Example 6

[0097] Growth-promoting and migration-promoting effects of recombinant human type II collagen COLII-14K-H on human immortalized epidermal cells HaCaT:

[0098] 1. MTT assay shows that recombinant human type II collagen promotes the proliferation of "human immortalized epidermal cells":

[0099] The experimental method was the same as in Example 5-1. The positive control was supplemented with a culture medium containing 0.625 mg / mL bovine Achilles tendon type I collagen and commercially available recombinant type III collagen. The experimental groups were supplemented with a culture medium containing different concentrations of COLII-14K-H protein solution: 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, 0.00625 mg / mL, and 0.003125 mg / mL, respectively.

[0100] Test results as follows Figure 6 As shown. By Figure 6 It can be seen that, with the negative control group as 100%, the survival rate of the positive control group with 0.625 mg / mL bovine Achilles tendon type I collagen added was 114%, the survival rate of the positive control group with 0.625 mg / mL commercially available recombinant type III collagen added was 126%, and the survival rate of the experimental group with 0.0125 mg / mL LCOOLII-14K-H added was 134%.

[0101] 2. Scratch assay showed that recombinant human type II collagen promotes the migration of "human immortalized epidermal cells":

[0102] The experimental method is the same as in Example 5-2. However, HaCaT cells were used and diluted to 2 × 10⁻⁶. 6 Cells were administered at a concentration of 2 mL per well. Experimental groups were prepared by adding different concentrations of COLII-14K-H-containing culture medium: 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL, respectively. The control group received only culture medium, while the control group received either 5 mg / mL bovine Achilles tendon type I collagen or 1.25 mg / mL commercially available recombinant type III collagen.

[0103] Microscopic images were taken at fixed locations after 0h, 24h, and 48h, such as... Figure 7 As shown.

[0104] Test results as follows Figure 8 As shown. By Figure 8The results showed that the migration rate of the blank control group (NC) was 25.60% at 24 h and 44.40% at 48 h; the migration rate of the positive control group supplemented with 5 mg / mL bovine Achilles tendon type I collagen was 38.17% at 24 h and 49.97% at 48 h; the migration rate of the positive control group supplemented with 1.25 mg / mL commercially available recombinant type III collagen was 41.76% at 24 h and 56.51% at 48 h; and the migration rate of the experimental group supplemented with 0.05 mg / mL LCOOLII-14K-H was 40.44% at 24 h and 55.06% at 48 h.

[0105] Example 7

[0106] The effects of recombinant human type II collagen COLII-14K-H on the growth, migration, and adhesion of human fibroblasts (HSF):

[0107] 1. MTT assay shows that recombinant human type II collagen promotes the proliferation of human fibroblasts:

[0108] The experimental method was the same as in Example 5-1. The blank control was supplemented with culture medium, the positive control with culture medium containing 0.5 mg / mL of commercially available recombinant III collagen, and the experimental groups with culture medium containing different concentrations of COLII-14K-H protein solution: 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, 0.00625 mg / mL, and 0.003125 mg / mL, respectively.

[0109] Test results as follows Figure 9 As shown. By Figure 9 It can be seen that, with the negative control group as 100%, the survival rate of the positive control group with 0.5 mg / mL of commercially available recombinant III collagen added was 113%, while the survival rate of the experimental group with 0.00625 mg / mL of LCOLII-14K-H added was 124%.

[0110] 2. Scratch assay showed that recombinant human type II collagen promotes the migration of human fibroblasts:

[0111] The experimental method is the same as in Example 5-2. However, HSF cells were used and diluted to 5 × 10⁻⁶. 5The experimental group was added with different concentrations of COLII-14K-H containing culture medium, and the final concentration was 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, 0.00625 mg / mL, and 0.003125 mg / mL. The blank group was only added with the culture medium, and the control group was added with 0.125 mg / mL bovine Achilles tendon type I collagen and 0.5 mg / mL commercially available recombinant type III collagen.

[0112] Microphotographs were taken at fixed positions after 0 h, 24 h, and 48 h, as shown in Figure 10 .

[0113] The detection results are shown in Figure 11 . It can be seen from Figure 11 that the 24 h migration rate of the blank control group (NC) was 22.16%, and the 48 h migration rate was 30.98%; the 24 h migration rate of the positive control group added with 0.125 mg / mL bovine Achilles tendon type I collagen was 29.63%, and the 48 h migration rate was 48.64%; the 24 h migration rate of the positive control group added with 0.5 mg / mL commercially available recombinant type III collagen was 31.65%, and the 48 h migration rate was 57.84%; and the 24 h migration rate of the experimental group added with 0.05 mg / mL COLII-14K-H was 31.20%, and the 48 h migration rate was 71.61%.

[0114] 3. MTT method for measuring the adhesion of recombinant human type II collagen to promote “human fibroblasts” (adhesion experiment verification):

[0115] (1) Coating preparation: commercially available bovine type I collagen and commercially available recombinant type III collagen were added into a 96-well plate as positive controls, the test product was COLII-14K-H, and the negative control was PBS. 100 μL / well was added, 6 wells were made for each concentration, and it was placed in a 4°C refrigerator overnight (to deposit enough protein on the surface of the wells). Remove the excess coating solution from the wells, add 100 μL of 1% BSA-PBS solution, incubate at 37°C in a 5% CO2 incubator for 1 h. After removing the liquid in the wells, wash three times with PBS, discard the washing liquid, seal with sealing film, and place in a 4°C refrigerator for standby.

[0116] (2) Cell preparation and detection: HSF cells growing to 90% of the culture dish were trypsinized, counted, and the cell concentration was adjusted to 1×10 5 cells / mL of cell suspension with complete culture medium, inoculated in a 96-well culture plate at 100 μL / well, and cultured at 37°C, 5% CO2 saturated humidity for 1 h.

[0117] (3) Add MTT and detect: discard the supernatant, wash once with PBS, add 120 μL of complete medium containing 1.2 mL of MTT and 6 mL, mix, and then add to each well, incubate for 4 h. Then, discard the culture solution and add 150 μL of DMSO, shake for 10 min, select 490 nm as the detection wavelength and 570 nm as the reference wavelength, and measure the light absorption value of each well on an enzyme marker.

[0118] (4) Data analysis: the results were statistically analyzed by Graphpad 9.5, P < 0.05 was statistically different, and P < 0.01 was significantly different.

[0119] The detection results are shown in Table 1. Figure 12 As can be seen from Table 1, the recombinant human type II collagen COLII-14K-H has a certain effect on promoting cell adhesion of HSF cells. Figure 12

[0120] Example 8

[0121] The recombinant human type II collagen COLII-14K-H promotes the expression of type I and III collagen genes of human fibroblast HSF (verified by real-time quantitative PCR), which specifically comprises the following steps performed in sequence:

[0122] The blank control adds culture medium, the positive control adds culture medium containing 20 ng / mL TGF-β (which has a well-known stimulating effect on fibroblasts), and the experimental group adds 0.05 mg / mL COLII-14K-H. After 3H of culture, the cells are collected. Total RNA is extracted using the TransZol Up Cell Kit (Qiujing Biological Company, Beijing, China) according to the manufacturer's protocol. The total RNA (1000 ng) is reverse transcribed using the Nuaidian Reverse Transcription Kit (Nanjing, China) to prepare the PCR amplification cDNA template. The specific primers (Table 1) for RT-qPCR analysis are synthesized by Universal Biological (Chuzhou, China). According to the recommendations of the official instructions, the following thermal cycles (Table 2) are used. RT-qPCR uses the Life Technologies Real-Time PCR Detection System (ThermoFisher Scientific, USA) and 2x AceQ Universal SYBR qPCR Master Mix (Nuaidian, Nanjing, China). The gene expression level of each target gene is normalized to the housekeeping gene GAPDH as an internal control for quantification. -△△CT Method.

[0123] The target gene mRNA expression level is normalized to the housekeeping gene GAPDH as an internal control for quantification.

[0124] Table 1 Specific primers for RT-qPCR analysis ​

[0125]

[0126]

[0127] Table 2 Thermal cycling conditions

[0128] Pre-denaturation 95℃ 5 min Cycling reactions (40x) 95℃ 10S 60℃ 30S 95℃ 15S Melt curve 60℃ 60S 95℃ 15S

[0129] The results are shown in Figure 13 . It can be seen from Figure 13 that the expression of type I and type III collagen genes in the recombinant human type II collagen COLII-14K-H group increased by 41.80% and 82.21%, respectively. Compared with the gene expression at the same time point in the blank group, there was a significant increase. The expression of type I and type III collagen genes in the positive control TGF-β group increased by 70.49% and 123.47%, respectively. TGF-β, as a widely used cell stimulator, can significantly up-regulate the expression of two collagen subtypes, but has no selectivity, which may increase the risk of overexpression of collagen. In contrast, COLII-14K-H can mildly and selectively up-regulate gene expression, which may be an important advantage in application.

[0130] Example 9

[0131] Recombinant human type II collagen COLII-14K-H promotes the expression of type I and type III collagen in human fibroblast HSF:

[0132] 1. Promotion of expression of type I collagen (ELISA experiment):

[0133] Human fibroblast HSF was diluted to 1 x 10 5 / mL, and 1 mL was inoculated into each well of a 24-well cell culture plate; at the same time, culture medium without cells was inoculated as a blank control. The negative control group was added with complete culture medium, the positive control group was added with complete culture medium containing 20 ng / mL TGF-β, and the experimental group was added with 0.05 mg / mL COLII-14K-H. The culture was incubated at 37°C in a 5% CO2 humidified atmosphere for 1 day and 2 days. The culture supernatant was collected, and the content of type I collagen was determined. The content of type I collagen was determined by ELISA. The absorbance at 450 nm was determined by microplate spectrophotometer. The results are shown in Figure 14 .

[0134] 2. Promotion of expression of type III collagen (immunoblotting experiment):

[0135] Blank control group was added with culture medium, and experimental group was added with 0.05 mg / mL COLII-14K-H, and incubated for 2 days. After 2 days, RIPA lysis buffer was directly added in the cell culture dish to collect the lysate of the cells and extracellular matrix. The lysate was subjected to Western blotting using COL1A1 antibody / COL3A1 antibody, and then imaged using an imaging system, and the relative expression level of the protein was calculated by adding the gray value of the bands. The results are shown in Figure 15 .

[0136] As can be seen from Figure 14 , 15 , the recombinant human type II collagen COLII-14K-H can increase the production of COL1A1 and COL3A1 collagen in HSF cells.

[0137] Example 10

[0138] The recombinant human type II collagen COLII-14K-H promotes the increase of the transcription level of elastin gene in human fibroblast HSF, which comprises the following steps in sequence: the experimental method is the same as that in Example 8. The thermal cycling conditions are the same as those in Table 2, and the gene expression level of each target gene is calculated by 2 -△△CT method.

[0139] The mRNA expression level of the target gene is normalized to the housekeeping gene GAPDH as the quantitative internal control.

[0140] Table 3 Specific primers for RT-qPCR analysis

[0141] Primer name Primer sequence 5'-3' Elastin_F GCAGGAGTTAAGCCCAAGG Elastin_R TGTAGGGCAGTCCATAGCCA GAPDH_F TCATGACCACAGTCCATGCC GAPDH_R AAGTGGTCGTTGAGGGCAAT

[0142] The results are shown in Figure 16 .

[0143] As can be seen from Figure 16 , the recombinant human type II collagen COLII-14K-H can increase the transcription level of elastin gene in HSF cells.

[0144] Example 11

[0145] Comparison of skin repair effects of the recombinant human type II collagen COLII-14K-H and the recombinant human type II collagen COLII-23:

[0146] The recombinant human type II collagen COLII-23 is a type II collagen screened and designed by the laboratory in the early stage, and the amino acid sequence is shown in SEQ ID NO. 4.

[0147] The skin repair effects (influence on human fibroblast migration structure) of the recombinant human type II collagen COLII-14K-H and the recombinant human type II collagen COLII-23 were respectively tested according to the above-mentioned embodiment, and the final results are shown in Table 4. Figure 17

[0148] Table 4. Human fibroblast migration results of COLII-14K-H and COLII-23

[0149]

[0150]

[0151] From the above results, it can be seen that the recombinant human type II collagen COLII-14K-H has a better skin repair effect (for example, HSF cell migration experiment for 48H) than the recombinant human type II collagen COLII-23.

[0152] In summary, the recombinant human type II collagen fragment COLII-14K-H has a low amount and high efficiency in skin repair, that is, it can show a significant skin repair effect (highly promote skin cell adhesion and cell migration, and promote skin repair) at a low concentration, and has a similar effect to the commercially available recombinant collagen and natural animal collagen; in skin care, COLII-14K-H can effectively improve the expression levels of type I and III collagen in human skin fibroblasts and protein expression levels, thereby promoting the generation of collagen and elastin in human skin cells; at the same time, the COLII-14K-H protein can also effectively improve the transcription level of elastin gene in human skin fibroblasts, promote the generation of elastin, and improve skin elasticity.

[0153] The above only describes the preferred embodiments of the present application and should not be used to limit the present application, and any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.​

Claims

1. A novel human type II collagen COLII-14K-H, characterized in that, The amino acid sequence is shown as SEQ ID NO.

2.

2. A novel gene encoding human type II collagen COLII-14K-H as claimed in claim 1, wherein, The gene is COLII-14K-H, and the nucleotide sequence is shown as SEQ ID NO.

1. ​ 3. A method for preparing a novel human type II collagen COLII-14K-H according to claim 1, characterized by, The method comprises the following steps: (1) synthesizing the nucleotide sequence shown as SEQ ID NO. 1 for coding human type II collagen COLII-14K-H; (2) constructing a recombinant expression vector pPIC9K-COLII-14K-H containing the DNA fragment for coding human type II collagen COLII-14K-H; (3) linearizing the constructed expression vector and then transferring into Pichia pastoris GS115 competent cells to obtain recombinant Pichia pastoris engineering bacteria; (4) screening and fermentation culturing the recombinant bacteria to obtain human type II collagen COLII-14K-H; (5) combining nickel ion affinity chromatography and dialysis method to separate and purify the human type II collagen COLII-14K-H expressed in step (4).

4. Application of the novel human type II collagen COLII-14K-H in claim 1 in preparing cartilage repair or skin repair drugs.

5. Use according to claim 4, characterized in that, The human type II collagen COLII-14K-H is used for promoting cartilage repair.

6. Use according to claim 4, characterized in that, The human type II collagen COLII-14K-H is used for promoting skin wound repair, accelerating migration, proliferation and scratch repair of skin cells.

7. Use according to claim 4, characterized in that, The form of the skin repair drug is one of gel, mask, liquid secondary polishing agent.

8. Application of the novel human type II collagen COLII-14K-H in claim 1 in preparing skin care products.

9. Use according to claim 8, characterized in that, The human type II collagen COLII-14K-H is used for increasing the expression level and protein expression level of type I and III collagen genes in human skin fibroblasts, promoting the generation of collagen in human skin cells; meanwhile, the human type II collagen COLII-14K-H is used for increasing the transcription level of elastin genes in human skin fibroblasts, promoting the generation of elastin in human skin cells.

10. Use according to claim 8, characterized in that, The form of the skin care product is one of toner, essence, mask, emulsion, lotion, cream and eye cream.

Images