Pseudohelichthys pirastris and application thereof

Abstract

The invention relates to a strain of pelatinomyces piraticola and an application thereof. The name of the strain is Phlebiopsis pilari HE39, the preservation number is CGMCC No.41168, and the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on February 5, 2024, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, West Beichen Road, Chaoyang District, Beijing, China. The strain can be used for degrading lignin and cellulose, has very good degradation capability on lignin in ground cover combustible materials, has very good laccase activity, lignin peroxidase activity and manganese peroxidase activity, and can improve the weight loss ratio of the combustible materials in forest land.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a strain of Pseudomonas pilatus and an application thereof. Background Art

[0002] Litter on the ground is the main forest floor fuel, and lignin is the main component of forest floor fuel. The degradation process of forest floor fuel depends on the catalysis of a complex lignin degradation enzyme system composed of extracellular oxidoreductases such as laccase (Lac), lignin peroxidase (Li P) and manganese peroxidase (MnP) secreted by lignin-degrading fungi. Among them, basidiomycetes such as white rot fungi have a strong ability to degrade lignin. There are significant differences in the ability of different strains to degrade lignin, which is also closely related to the growth conditions of the strains.

[0003] Kang Yue et al. screened out a strain of Aspergillus nidulans from garden waste. Through solid-state fermentation experiments, they found that the strain had a good effect on the degradation of lignin in the branches and leaves of common garden wastes in Beijing, such as Euonymus oleifera, Juniperus chinensis and Forsythia suspensa. The lignin degradation rate was 15.77%-29.90% higher than that of the control (Kang Yue, Li Suyan, Sun Xiangyang, et al. Screening, identification and ability study of lignin-degrading fungi from garden waste [J]. Journal of Forestry Science, 2019, 32(3):80-87). Zhang Fangfang et al. screened out a strain of Borerella birchii and a strain of Poreola subglabrata from 16 strains of white-rot fungi, and the degradation rates of lignin in corn stalks reached 13.60% and 21.87% (Zhang Fangfang, Zhang Tong, Dai Dan, et al. Screening of efficient lignin-degrading bacteria and their degradation effect on corn stalks [J]. Journal of Mycology, 2021, 40(7):1869-1880). Yang Li et al. conducted a liquid fermentation study on the dark green Trichoderma atroviride Z-1 strain with significant lignin-degrading enzyme activity and determined the optimal culture conditions such as culture time, temperature, dissolved oxygen, inoculation amount and pH for enzyme production (Yang Li, Sun Xiaodong, Li Linlin, et al. Screening of Trichoderma strains producing lignin-degrading enzymes and their enzyme production characteristics [J / OL]. Journal of Mycology, 1-9 [2024-08-02]. https: / / doi.org / 10.13346 / j.mycosystema.240032.).

[0004] The application of lignin-degrading fungi can improve the lignin degradation rate, and optimizing the culture conditions of the strains can further improve the enzyme activity of the strains, thereby promoting the degradation of lignin. However, how to obtain suitable strains is a key issue. At present, there are no reports on the degradation of forest lignin or cellulose by Pseudomonas pilatris. Domestic and foreign research on lignin biodegradation is mainly concentrated in the fields of papermaking industry, biocomposting, environmental protection, feed and food industries, and less research has been carried out in the field of forest fire prevention. In the field of forestry, due to differences in tree species, the ability of lignin-degrading strains to degrade lignin for different trees will also be different. Summary of the invention

[0005] In view of the problems existing in the prior art, the present invention provides a strain of Pseudoradiatus pilatus and its application. The strain provided by the present invention can be used to degrade lignin, cellulose, prepare preparations for degrading lignin and / or cellulose, etc., has good degradation ability for lignin / cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can improve the weight loss rate of forestland combustibles.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] The present invention provides a strain of Phlebiopsis pilatii, the strain name is Phlebiopsis pilatii HE39, the preservation number is CGMCC No.41168, it was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on February 5, 2024, and the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China.

[0008] The present invention carries out the screening research of fungi with the ability to degrade lignin in forest ground cover combustibles, and preliminarily optimizes the culture medium components, providing a basis for the application of lignin-degrading strains to expand new ways to reduce the load of ground cover combustibles. The study found that the strain HE39 provided by the present invention has a good ability to degrade lignin and cellulose in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can increase the weight loss rate of forestland combustibles.

[0009] The invention provides a fermentation method of the strain HE39, comprising the following steps: inoculating a culture medium with Phlebiopsis pilatii HE39 for fermentation.

[0010] Furthermore, in the culture medium, the carbon source is selected from one or more of sucrose, corn flour, soluble starch and glucose.

[0011] Furthermore, in the culture medium, the nitrogen source is selected from one or more of tryptone, soybean powder, yeast powder and malt extract powder.

[0012] Furthermore, in the culture medium, the inorganic salt is selected from one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

[0013] Preferably, in the culture medium, the carbon source is sucrose, the nitrogen source is soybean powder, and the inorganic salt is calcium chloride.

[0014] Furthermore, in the culture medium, the carbon source content was 10.0 g / L.

[0015] Furthermore, in the culture medium, the nitrogen source content is 20.0 g / L.

[0016] Furthermore, in the culture medium, the inorganic salt content was 3.0 g / L.

[0017] The use of the above culture medium is beneficial to improving the enzyme production activity of strain HE39.

[0018] The present invention provides a bacterial agent, comprising the above-mentioned Phlebiopsis pilatii HE39 and / or the supernatant of Phlebiopsis pilatii HE39.

[0019] The microbial agent provided by the present invention has good degradation ability for lignin in ground cover combustibles, has good laccase activity, lignin peroxidase and manganese peroxidase activity, and can improve the weight loss rate of forestland combustibles.

[0020] The above-mentioned bacterial agent can be the supernatant of HE39, which can be prepared by the following method: inoculate Phlebiopsis pilatii HE39 onto a PDA plate, culture at 28°C, take the bacterial cake and inoculate it into a PDB medium, culture it at 28°C and 160rpm under constant temperature shaking for 7 days, centrifuge and take the supernatant.

[0021] The invention provides a method for preparing the supernatant of HE39, comprising the following steps: inoculating Phlebiopsis pilatii HE39 onto a PDA plate for culture, taking a bacterial cake and inoculating it into a PDB culture medium, culturing with constant temperature shaking, centrifuging, and taking a supernatant.

[0022] Furthermore, the culture temperature on the PDA plate was 28°C.

[0023] Furthermore, the conditions for constant temperature shaking culture include: constant temperature shaking culture at 28° C. and 160 rpm for 7 days.

[0024] The present invention provides a method for preparing the bacterial agent, comprising the following steps: inoculating the Pseudomonas pilatris into a fermentation medium and performing fermentation culture.

[0025] The fermentation medium can refer to the medium used in the fermentation method of HE39.

[0026] The present invention provides the use of the above-mentioned Phlebiopsis pilatii HE39 in any one of (1) to (5);

[0027] (1) Degradation of lignin and / or cellulose;

[0028] (2) preparing a preparation for degrading lignin and / or cellulose;

[0029] (3) Degradation of combustible materials;

[0030] (4) Improve the activity of lignin-degrading enzymes;

[0031] (5) Increase the weight loss rate of combustible materials in forest land.

[0032] The present invention provides the use of the above-mentioned bacterial agent in any one of (1) to (4);

[0033] (1) Degradation of lignin and / or cellulose;

[0034] (2) Degradation of combustible materials on the ground;

[0035] (3) Improve the activity of lignin-degrading enzymes;

[0036] (4) Increase the weight loss rate of combustible materials in forest land.

[0037] The strain and the bacterial agent provided by the present invention can have good degradation ability for lignin and cellulose in ground cover combustibles, have good laccase activity, lignin peroxidase and manganese peroxidase activity, and can improve the weight loss rate of forestland combustibles.

[0038] The present invention provides a method for using the strain or the bacterial agent, comprising the following steps: using the Phlebiopsis pilatii HE39 or the bacterial agent to treat lignin or a substance containing lignin.

[0039] The present invention provides a method for using the strain or the bacterial agent, comprising the following steps: using the Phlebiopsis pilatii HE39 or the bacterial agent to treat cellulose or a substance containing cellulose.

[0040] The above method can also be used as a method for degrading lignin / cellulose, a method for degrading ground cover combustibles, a method for increasing the activity of lignin degrading enzymes, and a method for increasing the weight loss rate of forestland combustibles. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The proportion of each fungal genus.

[0042] Figure 2 The left picture shows the color development reaction of 2-1-24 colonies on guaiacol-PDA, and the right picture shows the decolorization reaction of HE-1-3-⑨ colonies on aniline blue-PDA plates.

[0043] Figure 3 This is a diagram showing the degradation effect of HE-1-3-⑨ strain on filter paper strips.

[0044] Figure 4 It is the result of changes in the indoor degradable cellulose content of ground cover combustibles.

[0045] Figure 5 This is the colony growth status of strain HE-1-3-⑨.

[0046] Figure 6 This is the phylogenetic tree of lignin-degrading bacteria HE39 based on rDNA-ITS sequences.

[0047] Figure 7 These are the experimental results of the changes in the cellulose degradation rate of ground cover combustibles under different bacterial agent treatments. DETAILED DESCRIPTION

[0048] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0049] Lignin-degrading fungi are widely used in the biodegradation of lignin. In order to explore the degradation effect of lignin-degrading fungi on forest ground combustibles, ground combustibles in broad-leaved Korean pine forests, poplar-birch mixed forests, larch-birch mixed forests, and red spruce forests were used as sources of degradation fungi and degradation test samples, and the mass loss of combustibles and the lignin content after degradation were determined. The results showed that a strain with good lignin degradation ability in ground cover fuels was screened out and identified as Phlebiopsis pilatii HE39; this strain first showed a strong lignin degradation ability, and the lignin degradation rates in poplar-birch and spruce fuels 10 days after treatment were 19.69% and 16.01%, respectively, and the weight loss rates of larch-birch and spruce fuels 60 days after treatment were 23.00% and 22.00%; sucrose, soybean meal and calcium chloride were the most suitable carbon source, nitrogen source and inorganic salt for enzyme production for strain HE39, respectively, and the optimized fermentation medium formula (g / L) was determined as: sucrose 10.0, soybean meal 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.

[0050] Unless otherwise specified, the experimental methods used in the present invention are all conventional methods in the art; the materials, reagents, methods and instruments used are all conventional materials, reagents, methods and instruments in the art, and those skilled in the art can obtain them through commercial channels or prepare them by conventional methods.

[0051] Overview of the study area: The study area is located in the Yitong Forest Pest Natural Enemy Breeding Demonstration Base of Jilin Academy of Forestry Sciences. The geographical location is 124°50′-125°46′E, 43°03′-43°38′N. It has a continental monsoon climate, with an average annual temperature of 2.8℃, a frost-free period of 120-140d, and an average annual precipitation of 723mm. The average altitude of the experimental site is 300m. The main forest stands include broad-leaved Korean pine (Pinuskoraiensis) forest, ash (Fraxinus mandshurica) forest, Mongolian oak (Querus mongolica) forest, birch (Betula platyphylla) forest, poplar (Populus davidiana) forest, larch (Larix gmelinii) forest, and mixed wood forest. The soil in the study area is mainly dark brown forest soil.

[0052] PDA medium was prepared according to the following proportions: 200 g potato, 20 g glucose, 20 g agar, 3 g KH2PO4, 1.5 g MgSO4·7H2O, 0.01 g VB1, and 1000 mL distilled water.

[0053] PDA-guaiacol medium: guaiacol was added to PDA medium, and the final concentration of guaiacol was 0.02% by volume.

[0054] PDA-aniline blue medium: Add aniline blue to PDA medium, and the final concentration of aniline blue is 0.1g / L.

[0055] PDB medium was prepared according to the following proportions: 200 g potato, 20 g glucose, 3 g KH2PO4, 1.5 g MgSO4·7H2O, 0.01 g VB1, and 1000 mL distilled water.

[0056] Hutcheson's medium was prepared according to the following proportions: KH2PO4 1.0 g, NaCl 0.1 g, MgSO4·7H2O0.3 g, NaNO3 2.5 g, FeCl3 0.01 g, CaCl2 0.1 g, distilled water 1000 mL, pH 7.2.

[0057] The malt extract powder medium was prepared according to the following proportions: glucose 10.0 g, malt extract powder 20.0 g, Tween 80 0.5 g, KH2PO4 3.0 g, and distilled water 1000 mL.

[0058] The basic culture medium was prepared according to the following proportions: glucose 10.0 g, malt extract powder 20.0 g, KH2PO4 3.0 g, Tween 800.5 g, distilled water 1000 mL, natural pH.

[0059] CMC-Na medium was prepared according to the following proportions: 10.0 g sodium carboxymethyl cellulose, 4.0 g ammonium sulfate, 2.0 g potassium dihydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 10.0 g peptone, 15.0 g agar, and 1000 mL distilled water.

[0060] In the embodiment, primer I TS1 and primer I TS4 were both synthesized by Shanghai Bioengineering.

[0061] In the embodiments, if data statistics and analysis are involved, Excel and Organization software are used to perform statistical analysis on the data.

[0062] The following is an introduction through specific embodiments.

[0063] Example 1

[0064] Sample plot setting and sample collection: Representative sites were selected as test plots in four forest types, including broad-leaved Korean pine forest, mixed poplar-birch forest, mixed birch-larch forest, and pure red spruce (Picea koraiensis) forest in the study area according to indicators such as altitude, slope aspect, slope gradient, and slope position. Five 1m×1m small sample plots were randomly set up in each forest type sample plot, and ground cover combustibles in the undecomposed layer and semi-decomposed layer were collected in the summer of 2022 as the source of degradation bacteria and degradation test samples.

[0065] Isolation and identification of strains: After the collected ground combustible samples of different decomposition layers were crushed appropriately, they were placed in sterile water for oscillation and mixing, and the mother liquor was diluted into a series of concentration gradients (i.e., the mother liquor was diluted 10, 20, and 30 times into a series of concentration gradients). The dilutions were spread on PDA medium plates containing streptomycin (200 μg / L) and placed in a 28°C constant temperature incubator for 5 days. Single colonies with significant differences in morphological characteristics were picked, and pure strains were obtained after repeated separation and purification and numbered and preserved. Fungal genomic DNA was extracted, and PCR amplification was performed using primers I TS1 (TCCGTAGGTGAACCTGCGG, shown in SEQ ID NO: 1) and I TS4 (TCCTCCGCTTATTGATATGC, shown in SEQ ID NO: 2). After 1% agarose gel electrophoresis, the unpurified products were entrusted to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. According to the I TS sequencing results, B last was used for sequence alignment on NCB I, and a phylogenetic tree was constructed using MEGA5.1 software in combination with the related I TS sequences in GenBank.

[0066] A total of 62 fungal strains were isolated by the above method, and the isolated strains were classified and identified by combining morphological observation and IT-rDNA sequencing. After identification, a total of 21 species were classified into 18 genera: Aspergillus, Cerrena, Coniochaeta, Coniothyrium, Discosia, Fusarium, Phoma, Paraconiothyrium, Paramyrothecium, Peniophora, Pestalotiopsis, Phlebiopsis, Plectosphaerella, Trichoderma, Microdiplodia, Myrothecium, Schizophyllum and Letendraea. Among them, Pseudocephalosporium was the dominant genus, accounting for 55% of the total number of isolated strains, followed by Pseudocephalosporium and Pseudocephalosporium, accounting for 11% and 6% of the total number of isolated strains, respectively. Figure 1 ).

[0067] Example 2

[0068] 2.1 Screening of fungi that can degrade lignin: One strain was selected from each of the 21 species identified as a representative strain for screening lignin-degrading fungi. The guaiacol plate colorimetric method and the aniline blue plate decolorization method were used to evaluate whether the strain had the ability to secrete extracellular lignin-degrading enzymes. A bacterial cake was prepared at the edge of the colony of the pure strain, inoculated in the center of the PDA-guaiacol plate, and cultured at a constant temperature of 28°C. After the strain grew for 5 days, the colonies with obvious color circles formed around them were picked, and the diameters of the colonies and color circles on the PDA-guaiacol medium were measured with a vernier caliper to screen strains with a larger ratio of color circles to colony diameters. The screened bacterial beads were inoculated on the PDA-aniline blue plate, cultured at a constant temperature of 28°C, the formation time of the decolorization circle was observed and recorded, and the diameters of the colonies and decolorization circles on the PDA-aniline blue medium were measured with a vernier caliper.

[0069] The guaiacol colorimetric method can better reflect the laccase activity of the strain, while the decolorization of aniline blue is related to the production of lignin peroxidase and manganese peroxidase. Through observation and calculation, among the 18 genera, only strains of Phlebiopsis, Cerrena, Paraconiothyrium, Coniothyrium, Letendraea, and Peniophora can oxidize guaiacol to produce a color circle ( Figure 2), among which 9 fungi, including HE-1-3-⑨, YM-1-3-①5, YM-3-4-⑥, 2-1-24, YM-1-4-⑤, 2-1-36, Red 1-3-4-⑥, YY-3-3-③ and 1-2-25, had larger color circle diameters, as shown in Table 1, and their φC / φF were all greater than 1, which suggested that they might be lignin-degrading fungi with high laccase activity; among which 4 fungi, including Red 1-3-4-⑥, HE-1-3-⑨, 2-1-24 and YM-1-4-⑤, could also decolorize aniline blue ( Figure 2 ), which can produce peroxidase, and preliminarily judge that the four strains are lignin-degrading fungi.

[0070] Table 1 Guaiacol plate color development and aniline blue plate decolorization results

[0071]

[0072] Note: φF: colony diameter; φC: color development zone diameter; φD: decolorization zone diameter

[0073] 2.2 Screening of cellulose-degrading fungi

[0074] (1) The Congo red staining method was used to screen cellulose-degrading strains. The purified strains were inoculated in a triangular shape on a CMC-Na medium plate and cultured at a constant temperature of 28°C. After the strains grew colonies on the plate, Congo red reagent was added to the culture medium for staining, and then 1 mol / L NaCl solution was added for decolorization. The colonies that produced hydrolysis circles were picked, and the diameters of the hydrolysis circles and colonies on the CMC-Na medium were measured with a vernier caliper. The ones with a larger ratio were selected for filter paper strip degradation tests to verify the actual degradation ability of the cellulose-degrading strains.

[0075] Experimental results: The identified strains were inoculated on CMC-Na plates for culture. After staining and decolorization, the hydrolysis zones of six strains from the genera Coniochaeta, Pestalotiopsis, Aspergillus, Coniothyrium, Phlebiopsis and Cerrena were obvious, and φH / φF was greater than 1, namely HE-1-3-⑨, 1-1-41, 1-2-1, 2-1-24, YY-3-3-⑥ and 2-2-32. The six strains were preliminarily judged to be cellulose-degrading fungi. The sizes of the colonies and the hydrolysis zones around them are shown in Table 2. The size of the hydrolysis zone is related to the amount and activity of cellulase produced by the fungus. The larger the hydrolysis zone, the stronger the ability of the strain to degrade cellulose. Among them, the φH / φF of strain HE-1-3-⑨ was significantly higher than that of other tested strains, indicating that it has the greatest potential for producing cellulase.

[0076] Table 2 CMC-Na plate staining results

[0077]

[0078] Note: φH: diameter of hydrolysis circle

[0079] (2) Filter paper strip degradation test, including the following steps: preparing bacterial cakes at the edge of the colony of the screened strain, inoculating them in PDB medium, and culturing them at 28°C and 160 rpm for 5 days to obtain strain seed liquid, and obtaining bacterial suspension after centrifugation. Add filter paper strips to Hutcheson's inorganic salt medium, inoculate 1 mL of bacterial liquid, and culturing them at 28°C and 160 rpm. Regularly observe the degradation of the filter paper strips, and judge the degradation ability of cellulose-degrading bacteria according to the degree of breakage of the filter paper strips.

[0080] After 7-15 days of inoculation with each strain, the filter paper strips showed ulceration. The degradation effect of HE-1-3-⑨ strain on the filter paper strips is shown in the figure. Figure 3 As shown, it shows that strain HE-1-3-⑨ has the ability to degrade cellulose.

[0081] Based on the above results, it can be seen that strain HE-1-3-⑨ has the ability to degrade both lignin and cellulose.

[0082] Example 3

[0083] Ground cover combustible degradation test: The strain screened in Example 2 was inoculated onto a PDA plate and cultured at a constant temperature of 28°C for 7 days. A bacterial cake was prepared in the area where mycelium grew vigorously using a borer (φ=6 mm). The bacterial cake was inoculated into a conical flask containing 100 mL of PDB culture medium and cultured at a constant temperature of 28°C and 160 rpm for 7 days. The culture was centrifuged at 4000 rpm for 10 min, and the supernatant was taken as the suspension of the lignin-degrading strain.

[0084] The surface combustible sample of the undecomposed layer in Example 1 was dried to constant weight and cut into pieces. Weigh 2g of the broken sample and place it in a 50mL triangular flask containing 20mL of malt extract powder culture medium, inoculate 600μL of bacterial solution (i.e., the suspension of lignin-degrading strains prepared by the above method) for the determination of the mass loss of combustibles and the lignin content during the degradation process. Prepare another triangular flask containing combustible samples of different forest types, and add sterile water equal to the bacterial solution as a control. All the above triangular flasks were placed in an artificial incubator and cultured at 25°C and 80% humidity. Sampling began on the 10th day after inoculation. Each time, three triangular flasks treated with different bacterial solutions were taken to determine the mass loss, lignin content and cellulose content of the samples. Sampling was performed once every 10 days, and the last sampling was performed on the 60th day.

[0085] Take out the degraded ground cover combustible sample from the conical flask, remove the surface hyphae with tweezers, dry it to constant weight, and calculate the mass loss rate of the sample after degradation.

[0086]

[0087] Qingdao Stand Testing Group Co., Ltd. used the ELISA double antibody sandwich method to determine the lignin content and cellulose content of ground combustible samples during the degradation process, and calculated the lignin degradation rate and cellulose degradation rate.

[0088]

[0089] In the study, it was found that YM-1-4-⑤ grew slowly and was not suitable for degradation. Therefore, combined with the growth rate of the strain, three strains of bacteria, including Hong 1-3-4-⑥, HE-1-3-⑨ and 2-1-24, were selected to carry out the degradation test of ground cover fuel. As can be seen from Table 3, during the 60 days of degradation, the quality of ground cover fuels in each forest type showed a fluctuating downward trend as a whole, and the weight loss was more obvious in the first 10 days, up to 25.17%. There were differences in the weight loss rate of fuels in different forest types. The overall weight loss rate of larch-birch, spruce and poplar birch fuels was higher than that of broad-leaved Korean pine forest fuels. After 60 days of degradation, the weight loss rate of larch-birch, spruce and poplar birch fuels could reach up to 23.00%, 22.00% and 26.33%, while the maximum weight loss rate of broad-leaved Korean pine forest fuels was only 11.83%. Among them, the highest weight loss rates of larch-birch and spruce combustibles both occurred after being degraded by the strain HE-1-3-⑨.

[0090] Table 3 Changes in the mass loss of fuels in different forest types during the degradation process

[0091]

[0092] During the degradation process, the lignin content in the ground cover fuel showed obvious differences under different strains (Table 4). In the first 10 days, except for the fuel in the broad-leaved Korean pine forest, the lignin content in the fuels of other forest types decreased rapidly, which was consistent with the mass loss results of the fuels in the same stage. The weight loss of the fuel samples may be partly attributed to the degradation of lignin; among them, the strain HE-1-3-⑨ first showed a strong lignin degradation ability, and the highest degradation rates of lignin in the poplar birch and spruce fuels appeared after being degraded by the strain HE-1-3-⑨, reaching 19.69% and 16.01%, respectively. In the 10d-20d stage, the lignin content in the spruce fuels degraded by the strains Hong 1-3-4-⑥ and HE-1-3-⑨ continued to decrease, and the lignin content in the broad-leaved Korean pine fuels treated with the strain 2-1-24 increased, showing an enrichment phenomenon; Comprehensively considering the entire degradation process, the lignin degradation effect in spruce fuels and poplar-birch fuels was better than that in larch-birch and broad-leaved Korean pine fuels, and the highest degradation rates after 60d were 23.42% and 23.28%, respectively. The strains Hong 1-3-4-⑥ and HE-1-3-⑨ showed strong lignin degradation ability. Combined with the speed of lignin degradation, the strain HE-1-3-⑨ was determined as the target strain.

[0093] Table 4 Changes in lignin content of ground cover fuels of different forest types during degradation

[0094]

[0095] Changes in cellulose content in ground cover fuels of different forest types Figure 4 As shown. Similar to lignin, the cellulose content decreased significantly during 0-10 days, among which the largest decrease was in the broad-leaved Korean pine forest combustibles, with a degradation rate of about 1.79-2.83 times that of other combustibles. At the end of the indoor degradation, compared with other strains, strain HE-1-3-⑨ showed higher activity and the best cellulose degradation effect, with a degradation rate of about 16.79%-21.90%; after 60 days of degradation, the cellulose content of the broad-leaved Korean pine forest combustibles decreased the most and the degree of degradation was the highest compared with different forest types.

[0096] Based on the results of the indoor degradation test of ground cover combustibles, strains Hong 1-3-4-⑥ and HE-1-3-⑨ showed relatively high lignin degradation ability, and strain HE-1-3-⑨ had relatively strong cellulose degradation ability. Although strain 2-1-24 screened in the early stage has the ability to degrade both lignin and cellulose, it is not effective when ground cover combustibles are used as degradation substrates. Therefore, Hong 1-3-4-⑥ and HE-1-3-⑨ were finally selected as the source strains for the preparation of microbial agents and applied to the field degradation test.

[0097] Example 4 Bacterial species identification

[0098] After strain HE-1-3-⑨ was cultured on PDA medium at 28°C for 7 days, the surface of the colony of strain HE-1-3-⑨ was white and fluffy, with slender hyphae and a relatively uniform and loose arrangement ( Figure 5 ).

[0099] According to the results of I TS sequencing, the I TS sequence of strain HE-1-3-⑨ was compared with the model strains and closely related strains in GenBank, and the phylogenetic tree was constructed using MEGA 5.1 software. The results of phylogenetic tree analysis are shown in Figure 6 , strain HE-1-3-⑨ was identified as Phlebiopsis pilatii and named as HE39.

[0100] On February 5, 2024, the strain HE-1-3-⑨ was deposited in the General Microbiology Center of China Microorganism Culture Collection (CGMCC), and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China. The strain name is HE39, and the recommended classification name belongs to Phlebiopsis pilatii, and the deposit number is CGMCC No.41168.

[0101] Example 5

[0102] Optimization of culture medium components: The following ingredients were selected as carbon sources, nitrogen sources, and inorganic salts to replace glucose, malt extract powder, and potassium dihydrogen phosphate in the basal culture medium.

[0103] The specific experimental method includes the following steps:

[0104] The strain HE39 was inoculated on a PDA plate and cultured at 28°C for 7 days. A fungus cake was prepared in the vigorous mycelial growth area using a hole puncher (φ=6mm). The fungus cake was inoculated into a triangular flask containing 100mL of PDB medium, and cultured at 28°C and 160rpm for 7 days. The supernatant was taken as the suspension of lignin-degrading strains and used as seed liquid for subsequent experiments. The seed liquid was inoculated into a 250mL triangular flask containing 50mL of the corresponding culture medium, with an inoculation amount of 3% (volume percentage), and cultured at 28°C and 180rpm for 3 days. After centrifugation, the supernatant was taken to determine the enzyme activities of LiP, MnP and Lac. The enzyme activity of LiP was determined by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit; the enzyme activity of MnP was determined by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit; the enzyme activity of Lac was determined by Qingdao Kechuang Quality Inspection Co., Ltd. using an ELISA kit.

[0105] Based on the results of various enzyme activity tests, the optimal carbon source, nitrogen source, and inorganic salt were selected as the new fermentation medium formula to provide a source of nutrients for the subsequent preparation of field degradation agents.

[0106] Different carbon sources: Sucrose, corn flour, and soluble starch were used to replace glucose in the basal medium;

[0107] Different nitrogen sources: Yeast powder, tryptone, and soybean powder were used to replace the malt extract powder in the basal medium;

[0108] Different inorganic salts: replace potassium dihydrogen phosphate in the basal culture medium with calcium chloride, sodium chloride, and magnesium sulfate respectively.

[0109] By replacing the carbon source, nitrogen source and inorganic salt in the basic medium, the effects of different components on the ability of strain HE39 to produce lignin-degrading enzymes were analyzed, and the results are shown in Table 5. According to the results of enzyme activity determination, when sucrose was used as the carbon source, the Li P and MnP of strain HE39 reached the maximum, which were 568.27U / L and 42.32U / L, respectively; when soybean powder was used as the nitrogen source, the Lac of strain HE39 reached the maximum, which was 100.53U / L; when calcium chloride was used as the inorganic salt, the Li P of strain HE39 had the highest activity. In summary, sucrose, soybean powder and calcium chloride are the most suitable carbon source, nitrogen source and inorganic salt for enzyme production of strain HE39, respectively, so as to determine the optimized fermentation medium (g / L): sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, Tween 80 0.5. The above formula will be used as the source of nutrients for the subsequent preparation of bacterial agents.

[0110] Table 5 Enzyme activity of strain HE39 under different culture medium components

[0111]

[0112] In addition, the study found that the degradation rate of lignin sometimes increased during the degradation process, showing an enrichment phenomenon. On the one hand, it may be because lignin, as a difficult-to-degrade substance, combines with other macromolecules in ground cover combustibles such as cellulose to form a barrier structure, which limits the entry of microorganisms and inhibits their physiological metabolic activities. On the other hand, the easily degradable components (soluble carbon, nitrogen, phosphorus, etc.) in ground cover combustibles are lost rapidly in the early stages of degradation, resulting in a rapid decrease in the proportion of easily degradable components in the combustibles, which increases the proportion of difficult-to-degrade components such as lignin, affecting its degradation rate. Therefore, research on the degradation of lignin in ground cover combustibles needs to comprehensively consider the influence of other components.

[0113] Lignin-degrading bacteria can be applied in many fields. In the agricultural field, by screening efficient lignin-degrading bacteria and optimizing enzyme production conditions, they can be applied to the degradation of agricultural production waste (straw) to improve the degradation efficiency. In animal husbandry, lignin-degrading bacteria can be used to destroy the lignin structure in plant feed, improve the digestion and utilization of feed by animals, and thus reduce feed costs. In the industrial field, lignin-degrading fungi can be used to construct a co-cultivation system, biologically pretreat straw, and reduce the structural barrier of lignin biomass, thereby effectively improving the efficiency of biomass conversion to produce biofuels. In the forestry field, lignin-degrading bacteria can be used to improve soil quality and structure, improve plant growth efficiency, and thus promote the stability of the ecosystem.

[0114] Example 6 Field degradation bacterial agent and preparation method thereof

[0115] Fermentation medium (g / L): sucrose 10.0, soybean powder 20.0, calcium chloride 3.0, Tween 80 0.5, prepared with water.

[0116] The method for preparing a microbial agent comprises the following steps: selecting the screened fungus HE39 as a source strain for preparing a microbial agent, opening a pure cultured strain plate in a sterile operating table, using a sterilized puncher (outer diameter 6 mm) to prepare a bacterial cake in an area where mycelium grows vigorously, inoculating 40 bacterial cakes into a 1000 mL triangular flask containing 400 mL of fermentation medium, culturing at 28° C. and 160 rpm for 5 days, centrifuging at 4000 rpm for 10 minutes to obtain a supernatant, and obtaining a degradation strain microbial agent.

[0117] Example 7

[0118] The field degradation test was conducted in the pure forests of birch and larch and the mixed forest of Quercus mongolica and Pinus sylvestris at the Yitong Base of Jilin Academy of Forestry Sciences. A 10m×10m standard plot was set for each forest type, and three 1m×1m small plots were set in each standard plot. Before the start of field degradation, the ground cover combustibles in the plot were collected, dried to constant weight, and then put into nylon mesh bags, 10.0g per bag, and the forest type and sample number were marked on the bag. The initial mass was weighed and recorded, and then put back into the plot and fixed with a metal mesh.

[0119] The selected degradation fungal strains were selected as the source strains for the preparation of the microbial agent. The pure cultured degradation strain plate was opened in the sterile operating table, and the bacterial cake was prepared in the vigorous mycelium growth area with a sterilized puncher (outer diameter 6mm). 40 bacterial cakes were inoculated into a 1000mL triangular flask containing 400mL of the optimized fermentation medium, and 0.5g of Tween 80 was added. The suspension of the degradation strain was obtained by constant temperature shaking culture at 28℃ and 160rpm for 5 days, and the bacterial suspension was bottled separately for later use. Three doses (low, medium and high, 50mL, 100mL and 150mL respectively) were divided into three doses, and different microbial agents were sprayed on the nylon mesh bags in the small sample square by manual spraying. The spraying should be as uniform as possible so that the combustibles in the bag can contact the microbial agent. Each standard plot of the three forest types was treated in the same way. The combustible samples were collected once every 14 days, and 5 bags were taken each time, for a total of 6 samplings, and the cellulose content of the samples was determined. The detection method of cellulose degradation rate is referred to Example 3.

[0120] Field degradation of ground cover cellulose Figure 7 As shown in the figure, with the extension of degradation time, the cellulose degradation rate of combustibles in different forest types treated with microbial agent HE39 and microbial agent H46 (microbial agent prepared by using red 1-3-4-⑥ according to the method of Example 6) showed an increasing trend, and was significantly higher than the control group (no microbial agent was used). At the end of the field degradation, the cellulose degradation rates of combustibles in birch, larch, Mongolian oak-Mongol pine forests were 15.29%-20.59%, 8.66%-12.68%, and 14.32%-18.66%, respectively, which were 1.74-2.69 times, 1.79-3.08 times, and 4.01-5.53 times higher than the control, respectively. During the entire degradation process, the degradation effect of microbial agent HE39 was always better than that of microbial agent H46; the cellulose degradation effects of the two microbial agents at different doses were all high dose > medium dose > low dose > control group.

[0121] Example 8

[0122] The experimental method is as in Example 7. Field degradation effect: The degradation effect of lignin in the ground cover combustibles of birch, larch and Mongolian oak-Mongol pine forests with bacterial agents was better than that of the control group without bacterial agents. After 84 days of field degradation, the lignin degradation rate could reach up to 23.48%.

[0123] The present invention obtains 4 strains of lignin-degrading fungi from ground cover combustible samples collected in the wild by qualitative screening, and finally obtains strain HE39 with strong comprehensive ability to degrade lignin by measuring the mass loss of combustibles and the lignin degradation rate during the ground cover combustible degradation test. Its degradation significantly improves the mass loss of ground cover combustibles and the lignin degradation rate, indicating that the use of lignin-degrading fungi to reduce the load of ground cover combustibles has certain feasibility and further research and development value. In the present invention, the weight loss rate of poplar and birch combustibles is the highest, which can reach 26.33% after 60 days of degradation; after degradation by HE39, its lignin degradation rate can reach 23.28%, which is higher than that of other strains.

[0124] The lignin-degrading strain HE39 screened by the present invention has a promoting effect on the degradation of lignin in ground cover combustibles. Therefore, in order to achieve the purpose of efficiently degrading ground cover combustibles, other strains with degradation ability can also be introduced in practical applications to prepare a composite bacterial agent, and the optimal enzyme production conditions can be explored to achieve a synergistic degradation effect. The present invention can provide a basis for reducing the forest combustible load by using microorganisms to reduce the forest fire risk level and fire losses.

[0125] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A strain of Pseudomonas pilatus, characterized in that: The strain name is Phlebiopsis pilatii HE39, and the preservation number is CGMCC No.41168.

2. The fermentation method of Pseudomonas pilatus according to claim 1, characterized in that: The following steps are involved: Phlebiopsis pilatii HE39 was inoculated into the culture medium for fermentation.

3. The fermentation method of Pseudomonas pilatus according to claim 2, characterized in that: The method comprises the following steps: in the culture medium, the carbon source is selected from one or more of sucrose, corn flour, soluble starch and glucose.

4. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the nitrogen source is selected from one or more of tryptone, soybean powder, yeast powder and malt extract powder.

5. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the inorganic salt is selected from one or more of calcium chloride, sodium chloride, magnesium sulfate and potassium dihydrogen phosphate.

6. The fermentation method of Pseudomonas pilatus according to claim 2 or 3, characterized in that: In the culture medium, the carbon source content is 10.0 g / L, the nitrogen source content is 20.0 g / L, and the inorganic salt content is 3.0 g / L.

7. A bacterial agent, characterized in that The method comprises the Pseudomonas pilatei of claim 1 and / or the supernatant of Pseudomonas pilatei of claim 1.

8. The method for preparing the bacterial agent according to claim 7, characterized in that: The method comprises the following steps: inoculating the Pseudomonas pilatus described in claim 1 into a fermentation medium and performing fermentation culture.

9. Use of Pseudomonas pilatus according to claim 1 in any one of (1) to (5); (1) Degradation of lignin and / or cellulose; (2) preparing a preparation for degrading lignin and / or cellulose; (3) Degradation of combustible materials; (4) Improve the activity of lignin-degrading enzymes; (5) Increase the weight loss rate of combustible materials in forest land.

10. Use of the bacterial agent according to claim 7 in any one of (1) to (4); (1) Degradation of lignin and / or cellulose; (2) Degradation of combustible materials on the ground; (3) Improve the activity of lignin-degrading enzymes; (4) Increase the weight loss rate of combustible materials in forest land.

Images