Deoxyribose transferase mutant as well as preparation method, application and use method thereof

Abstract

The invention discloses a deoxyribose transferase mutant as well as a preparation method, application and a use method thereof. The amino acid sequence of the deoxyribose transferase mutant is obtained by mutating the 37th residue of the amino acid sequence as shown in SEQ ID NO: 2 into X1, wherein X1 is any one of W, L, I, P, N, A, S, T, D, F, M, K and C; or X2 is obtained by mutating the 46th residue into X2, and X2 is any one of W, P, V, S, T, E, G, M, Y and R; or the 51st residue is mutated into X3, and X3 is any one of H, P, A, L, Q, T, D, F, E, M, K, C and R. The deoxyribose transferase mutant has the activity of catalyzing deoxyribose transfer on deoxyribonucleoside with a modification group on a glycosyl, can be used for producing 2 '-modified deoxyribonucleoside, and has the characteristics of low cost, environment friendliness, high conversion rate, simple process and the like.

Description

Technical Field

[0001] The present application relates to the technical field of enzyme catalysis of 2'-deoxyguanosine, and more specifically, to a deoxyribose transferase mutant and a preparation method, application and use method thereof. Background Art

[0002] Nucleoside 2'-deoxyribosyl transferases are a class of enzymes that play a role in DNA repair, DNA modification, and RNA modification, and they play an important role in biology. The main function of this enzyme is to catalyze the transfer of deoxyribose, usually involving the transfer of a deoxyribose (2'-deoxyribose) from one nucleotide molecule to a specific position on another nucleotide molecule.

[0003] According to the different substrate specificity, deoxyribosyl transferases can be divided into two categories: one is N-deoxyribosyl transferase I (Nucleoside 2'-deoxyribosyl transferase I, PDT), which can only catalyze the transfer of deoxyribose between purines; the other is N-deoxyribosyl transferase II (Nucleoside 2'-deoxyribosyl transferase II, NDT), which can catalyze the transfer of deoxyribose between purine and pyrimidine.

[0004] In DNA and RNA, different types of modified nucleosides have different biological functions in cells. They can affect the stability, repair, translation and regulation of DNA and RNA, such as 2'-modified deoxyribonucleosides. 2'-modified deoxyribonucleosides refer to deoxyribonucleoside molecules with chemical modification groups or additional groups on the 2' position of the deoxyribose. These modified nucleosides may include different functional groups, such as methyl, phosphate, sugar and other chemical groups, which can change the properties and functions of nucleosides.

[0005] 2'-modified deoxyribonucleosides include 2'-deoxythymidine and 2'-deoxyguanosine. 2'-Deoxyguanosine (dGR) is a compound belonging to nucleosides. It is a structural component of DNA and an important raw material for synthesizing antiviral and anti-tumor nucleic acid drugs such as oligodeoxynucleotides. It plays an important role in cell activities and organisms. Chemically modified 2'-deoxyguanosine analogs have many applications in the field of anticancer drug treatment. For example, Forodesine, a leukemia treatment drug approved by the FDA in 2017, can effectively inhibit the metabolism of 2'-deoxyguanosine in cancer cells and further inhibit their DNA synthesis and metabolism. In addition, 2'-deoxyguanosine can also be used as a new nucleoside immune signaling molecule to activate plant basic immunity and enhance plant disease resistance. It has great application potential in the field of new biological pesticides in the future.

[0006] Although 2'-deoxyguanosine is widely used in cancer treatment and biopesticides, research on its synthesis method is not in-depth enough. At present, the synthesis of 2'-deoxyguanosine mainly relies on chemical synthesis methods. In addition to chemical methods, the synthesis of 2'-deoxyguanosine can also be achieved with the help of existing synthetic biology methods. Studies have shown that starting from 2'-deoxythymidine and synthesizing 2'-deoxyguanosine with the help of enzymatic reactions can more economically and efficiently prepare a molecule that plays a role in DNA synthesis and repair. However, the co-substrate guanine (Guanine, G) has poor solubility in water, which has an adverse effect on the synthesis of 2'-deoxyguanosine. In contrast, guanosine (Guanosine, GR) is more water-soluble than guanine. Ribonucleoside hydrolase (RihC) is a hydrolase that can rapidly and cooperatively catalyze the hydrolysis of nucleosides into nucleobases. By adding ribonucleoside hydrolase and deoxyribosyltransferase to the reaction system, 2'-deoxythymidine and guanosine can be used as substrates to synthesize 2'-deoxyguanosine through a bioenzymatic method, further improving the yield.

[0007] Based on this, the present invention provides a deoxyribose transferase mutant that can be directly used as a catalyst to catalyze the deoxyribose transfer reaction between a substrate, namely a 2'-modified deoxyribonucleoside, and a base to produce a new 2'-modified deoxyribonucleoside. Summary of the invention

[0008] The purpose of the present invention is to solve the problem of low catalytic efficiency of deoxyribosyltransferase in the prior art. To this end, the present invention provides a deoxyribosyltransferase mutant and its preparation method, application and use method.

[0009] In order to achieve the above invention objectives, this application adopts the following technical solutions:

[0010] In the first aspect, the present application provides a deoxyribosyltransferase mutant, named BPNDT, wherein the amino acid sequence of the deoxyribosyltransferase mutant is any one of the following:

[0011] (1) a mutant sequence obtained by mutating the amino acid residue at position 37 of the amino acid sequence shown in SEQ ID NO: 2 to X1; wherein X1 is selected from any one of W, L, I, P, N, A, S, T, D, F, M, K and C;

[0012] (2) a mutant sequence obtained by mutating the amino acid residue at position 46 of the amino acid sequence shown in SEQ ID NO: 2 to X2; wherein X2 is selected from any one of W, P, V, S, T, E, G, M, Y and R;

[0013] (3) a mutant sequence obtained by mutating the amino acid residue at position 51 of the amino acid sequence shown in SEQ ID NO: 2 to X3; wherein X3 is selected from any one of H, P, A, L, Q, T, D, F, E, M, K, C and R; or

[0014] (4) Based on (1), (2) and (3), conventional one or more amino acid substitutions, additions and deletions are performed to obtain a derivative sequence having at least 80% homology with the aforementioned mutant sequence and having the same biological activity.

[0015] SEQ ID NO: 2 is an existing deoxyribose transferase, which can only realize the deoxyribose transfer of deoxyribonucleosides without a modification group on the sugar group, and has no activity of catalyzing the deoxyribose transfer of deoxyribonucleosides with a modification group on the sugar group. The research of the present invention shows that after the 37th amino acid residue of the amino acid sequence shown in SEQ ID NO: 2 is mutated to W, L, I, P, N, A, S, T, D, F, M, K and C, or the 46th amino acid residue is mutated to W, P, V, S, T, E, G, M, Y and R, or the 51st amino acid residue is mutated to H, P, A, L, Q, T, D, F, E, M, K, C and R, the deoxyribose transferase mutant obtained has the activity of catalyzing the deoxyribose transfer of deoxyribonucleosides with a modification group on the sugar group.

[0016] SEQ ID NO: 2

[0017] Met Ala Lys Ile Tyr Leu Ala Ser Pro Phe Phe Asn Glu Glu Gln Leu LysHis Val Ser LysAla Glu Gln Val Leu Arg Asp Leu Gly His Thr Val Phe Ser ProArg Glu Asn Gln Leu Pro GluVal Glu Phe Gly Ser Phe Glu His Arg Thr Phe ValPhe Lys Asn Asp Leu Glu His Ile Lys TrpAla Asp Ile Thr Phe Gly Ile Ile GlyAsp Asn Tyr Asp Asp Thr Gly Thr Ala Trp Glu Leu GlyAla Ser Tyr Ile Leu GlyLys Pro Val Met Leu Phe Ser Pro Thr Gly Glu Ile Ile Asn Leu Met IleThr AspSer Leu His Ala Tyr Phe Glu Asp Trp Asn Asp Val Glu Asn Tyr Asp Phe Ala ThrLeuPro Ile Lys Pro Tyr Leu Lys Ala Val Lys.

[0018] Based on this, the deoxyribose transferase mutant provided by the present invention can be used as a catalyst to catalyze the deoxyribose transfer reaction between the substrate, i.e., 2'-modified deoxyribonucleoside (its own base type is different from the substrate base type) and the base to produce a new 2'-modified deoxyribonucleoside.

[0019] It should be noted that, under the premise that the amino acid sequence of the deoxyribosyltransferase mutant is disclosed in the present invention, those skilled in the art can easily carry out conventional one or more amino acid substitutions, additions and deletions on this basis without inventiveness to obtain a derivative sequence having at least 80% or more, preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more homology with the aforementioned mutant sequence, and having the same biological activity (i.e., the activity of catalyzing the deoxyribose transfer of deoxyribonucleosides with modified groups on the sugar group), and these derivative sequences all fall within the scope of protection of the present invention.

[0020] In a second aspect, the present invention provides a vector. When the vector is a nucleic acid molecule, the nucleic acid molecule is an isolated nucleic acid molecule that can encode the deoxyribose transferase mutant described in the first aspect.

[0021] In an optional embodiment, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:1.

[0022] SEQ ID NO: 1

[0023] ATGGCAAAAATATATCTAGCTTCACCCTTTTTCAATGAAGAGCAGCTTAAGCACGTGTCCAAAGCGGAACAGGTTCTGCGTGATTTGGGCCACACCGTGTTCTCGCCGCGCGAGAACCAATTACCGGAAGTTGAGTTTGGTAGCTTTGAGCATCGTACCTTTGTGTTCAAAAACGACCTGGAACATATTAAGTGGGCAGATATCACCTTC GGCATTATCGGCGACAACTACGACGACACCGGTACGGCTTGGGAACTGGGCGCTAGCTATATCCTGGGTAAACCGGTAATGTTGTTTTCTCCAACTGGTGAGATCATCAACCTGATGATTACCGATAGCCTGCATGCGTACTTCGAGGATTGGAATGATGTTGAAAACTACGACTTCGCCACGCTGCCGATTAAGCCGTATTTGAAGGCG GTCAAATAA.

[0024] It should be noted that, based on the degeneracy of codons, those skilled in the art can easily obtain nucleotide sequences encoding the deoxyribosyltransferase mutants, provided that the amino acid sequences of the deoxyribosyltransferase mutants are disclosed in the present invention. No matter what nucleotide sequence it is, as long as it encodes the aforementioned deoxyribosyltransferase mutants, it falls within the protection scope of the present invention.

[0025] It should be noted that the length of the nucleic acid molecule provided by the present invention is not limited to the length of the nucleic acid sequence encoding the deoxyribose transferase mutant. Those skilled in the art know that in order to meet the requirements of the recombination operation, it is necessary to add suitable restriction endonuclease cleavage sites at both ends of the nucleic acid molecule, or to add additional start codons, stop codons, etc. Therefore, the nucleic acid molecules in this case also belong to the protection scope of the present invention.

[0026] In a third aspect, the present invention provides a host cell comprising the vector described in the second aspect.

[0027] It should be noted that the host cells suitable for the present invention include but are not limited to prokaryotic cells, yeast or eukaryotic cells. Preferably, the prokaryotic cells are true bacteria, such as Gram-negative bacteria or Gram-positive bacteria. More preferably, the prokaryotic cells are E. coli BW 25113 cells. Regardless of the form of the host cell, as long as it contains the aforementioned nucleic acid molecules, expression cassettes, or other vectors, it all belongs to the protection scope of the present invention.

[0028] In a fourth aspect, the present invention provides a cell culture comprising the host cell described in the third aspect.

[0029] In a fifth aspect, the present invention provides a method for preparing a deoxyribosyltransferase mutant, the preparation method comprising:

[0030] A deoxyribosyltransferase NDT with a mutation in the amino acid residue at position 37, position 46, or position 51 of the amino acid sequence is selected, and pBAD-NDT-BW25113 is obtained by reacting the deoxyribosyltransferase NDT, ribonucleoside hydrolase RihC, expression vector pBAD-hisB and host bacteria E. coli BW 25113. The recombinant pBAD-NDT-BW25113-wt is used as a DNA template, and sequences of SEQ ID NO: 5 to SEQ ID NO: 76 are used as primers. By using site-directed mutagenesis, pBAD-hisB is used as an expression vector to obtain a mutant plasmid with a mutant gene, and the obtained different mutant plasmids are respectively transformed into E. coli BW 25113 to obtain corresponding different mutants.

[0031] The amino acid sequence of the ribonucleoside hydrolase RihC is shown in SEQ ID NO:4.

[0032] SEQ ID NO: 4

[0033] Met Arg Leu Pro Ile Phe Leu Asp Thr Asp Pro Gly Ile Asp Asp Ala ValAla Ile Ala AlaAla Ile Phe Ala Pro Glu Leu Asp Leu Gln Leu Met Thr Thr ValAla Gly Asn Val Ser Val GluLys Thr Thr Arg Asn Ala Leu Gln Leu Leu His PheTrp Asn Ala Glu Ile Pro Leu Ala Gln GlyAla Ala Val Pro Leu Val Arg Ala ProArg Asp Ala Ala Ser Val His Gly Glu Ser Gly Met AlaGly Tyr Asp Phe Val GluHis Asn Arg Lys Pro Leu Gly Ile Pro Ala Phe Leu Ala Ile Arg AspAla Leu MetArg Ala Pro Glu Pro Val Thr Leu Val Ala Ile Gly Pro Leu Thr Asn Ile AlaLeuLeu Leu Ser Gln Cys Pro Glu Cys Lys Pro Tyr Ile Arg Arg Leu Val Ile MetGly Gly Ser AlaGly Arg Gly Asn Cys Thr Pro Asn Ala Glu Phe Asn Ile Ala AlaAsp Pro Glu Ala Ala CysVal Phe Arg Ser Gly Ile Glu Ile Val Met Cys GlyLeu Asp Val Thr Asn Gln Ala Ile Leu Thr ProAsp Tyr Leu Ser Thr Leu Pro GlnLeu Asn Arg Thr Gly Lys Met Leu His Ala Leu Phe Ser HisTyr Arg Ser Gly SerMet Gln Ser Gly Leu Arg Met His Asp Leu Cys Ala Ile Ala Trp Leu ValArg ProAsp Leu Phe Thr Leu Lys Pro Cys Phe Val Ala ValGlu Thr Gln Gly Glu Phe ThrSerGly Thr Thr Val Val Asp Ile Asp Gly Cys Leu Gly Lys Pro Ala Asn Val GlnVal Ala Leu AspLeu Asp Val Lys Gly Phe Gln Gln Trp Val Ala Glu Val Leu AlaLeu Ala Ser.

[0034] It should be noted that, under the premise that the amino acid sequence of the aforementioned deoxyribosyltransferase mutant is disclosed in the present invention, those skilled in the art can easily think of preparing or producing the deoxyribosyltransferase mutant of the present invention by means of genetic engineering technology (for example, culturing the aforementioned host cell, isolating and purifying the aforementioned deoxyribosyltransferase mutant from the cell culture) or other means (such as chemical synthesis means). Regardless of the method used to prepare or produce the deoxyribosyltransferase mutant of the present invention, it belongs to the protection scope of the present invention.

[0035] In a sixth aspect, the present invention provides an application of a deoxyribosyltransferase mutant, wherein the deoxyribosyltransferase mutant is derived from the vector described in the second aspect, the host cell described in the third aspect, or the cell culture described in the fourth aspect; the deoxyribosyltransferase mutant is used as a catalyst to catalyze the base transfer of deoxyribose on 2'-modified deoxyribonucleoside.

[0036] In other words, the present invention also provides a use of the deoxyribosyltransferase mutant described in the aforementioned embodiment, the host cell described in the aforementioned embodiment, the vector described in the aforementioned embodiment, or a cell culture of the host cell in the preparation of 2'-modified deoxyribonucleosides.

[0037] It should be noted that, based on the catalytic activity of the aforementioned deoxyribosyltransferase mutant, those skilled in the art can easily think of using a mixture containing a deoxyribosyltransferase mutant (e.g., a vector, host cell, or cell culture containing the deoxyribosyltransferase mutant) to prepare 2'-modified deoxyribonucleosides without inventive work. In other words, as long as the catalytic activity of the aforementioned deoxyribosyltransferase mutant is used to prepare 2'-modified deoxyribonucleosides, no matter in what form the deoxyribosyltransferase mutant is added to the reaction system, it falls within the scope of protection of the present invention.

[0038] In a seventh aspect, the present invention provides a method for using the deoxyribosyltransferase mutant, wherein the deoxyribosyltransferase mutant, vector, host cell or cell culture is contacted with a substrate to perform a catalytic reaction, wherein the substrate includes a 2'-modified deoxyribonucleoside and a base.

[0039] The above-mentioned method of use is a method for catalyzing the transfer of 2'-modified deoxyribose of 2'-modified deoxyribonucleoside to a base. The catalytic method provided by the present invention utilizes the aforementioned deoxyribose transferase mutant to catalyze the deoxyribose transfer activity of deoxyribonucleoside with a modified group on the sugar group, and catalyzes the reaction of 2'-modified deoxyribonucleoside and base to complete the transfer of deoxyribose sugar group between bases in one step. The deoxyribose transfer reaction is essentially a base exchange to generate another 2'-modified deoxyribonucleoside.

[0040] Compared with the existing deoxyribose transfer step that requires multiple steps of chemical reactions to complete, the number of reaction steps is greatly reduced, and the corresponding raw material costs are also saved.

[0041] In an optional embodiment, the 2'-modified deoxyribonucleoside is 2'-deoxythymidine, and the base is guanine. Under the condition of the presence of these two substrates, the generated substances are 2'-deoxyguanosine and thymine. It is precisely because the deoxyribosyltransferase mutant of the present invention catalyzes that a 2'-modified deoxyribonucleoside (2'-deoxythymidine) can be quickly converted into another 2'-modified deoxyribonucleoside (2'-deoxyguanosine).

[0042] In an optional embodiment, the catalytic reaction is carried out at pH 7.8-8.2 and 50-60° C. Under the conditions of pH 7.8-8.2 and 50-60° C., the aforementioned deoxyribosyltransferase mutant has good catalytic activity and a high yield of the product.

[0043] It should be noted that the pH and temperature for the catalytic reaction are not limited to the above conditions. Those skilled in the art can easily think of conducting the reaction at other pH and temperatures without creative work. Regardless of the conditions, they are within the scope of protection of the present invention.

[0044] In an optional embodiment, when performing the catalytic reaction, the reaction system contains 195-205 mM 2'-deoxythymidine and 195-205 mM guanosine.

[0045] It should be noted that when the catalytic reaction is carried out, the content of the substrate can be adjusted according to the situation. Those skilled in the art can easily think of using appropriate concentrations of substrates and deoxyribosyltransferase mutants without paying any creative labor. Regardless of the concentration at which these substances are used for the catalytic reaction, they all fall within the scope of protection of the present invention.

[0046] In an eighth aspect, the present application provides a ribonucleoside hydrolase, named RihC, and the amino acid sequence of the ribonucleoside hydrolase is shown in SEQ ID NO:4.

[0047] In the ninth aspect, the present application provides a vector, and when the vector is a nucleic acid molecule, the nucleic acid molecule is an isolated nucleic acid molecule that can encode the ribonucleoside hydrolase described in the eighth aspect.

[0048] In an optional embodiment, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:3.

[0049] SEQ ID NO: 3

[0050] ATGCGTTTACCTATCTTCCTCGATACTGACCCCGGCATTGACGATGCCGTCGCCATTGCCGCCGCGATTTTTGCACCCGAACTCGACCTGCAACTGATGACCACCGTCGCGGGTAATGTCTCGGTTGAGAAAACTACCCGCAATGCCCTGCAACTGCTGCATTTCTGGAATGCGGAGATTCCGCTCGCCCAAGGGGCCGCTGTGCCACTGGTACGCGCACCGCGTGATGCGGCATCTGTGCACGGCGAATCGGGAATGGCTGGCTACGACTTTGTTGAGCACAACCGAAAGCCGCTCGGGATACCGGCGTTTCTGGCGATTCGGGATGCCCTGATGCGTGCACCAGAGCCTGTTACCCTGGTGGCCATCGGCCCGTTAACCAATATTGCGCTGTTACTTTCACAATGCCCGGAATGCAAGCCGTATATTCGCCGTCTGGTGATCATGGGTGGTTCTGCCGGACGCGGCAACTGTACGCCAAACGCCGAGTTTAATATTGCTGCCGATCCAGAAGCTGCTGCCTGTGTCTTCCGCAGTGGTATTGAAATCGTCATGTGCGGTTTGGATGTCACCAATCAGGCAATATTAACTCCTGACTATCTCTCTACACTGCCGCAGTTAAACCGTACCGGGAAAATGCTTCACGCCCTGTTTAGCCACTACCGTAGCGGCAGTATGCAAAGCGGCTTGCGAATGCACGATCTCTGCGCCATCGCCTGGCTGGTGCGCCCGGACCTGTTCACTCTCAAACCCTGTTTTGTGGCAGTGGAAACTCAGGGCGAATTTACCTCAGGCACGACGGTGGTTGATATCGACGGTTGCCTGGGCAAGCCAGCCAATGTACAGGTGGCATTGGATCTGGATGTGAAAGGCTTCCAGCAGTGGGTGGCTGAGGTGCTGGCTCTGGCGT CGTAA。

[0051] It should be noted that, based on the degeneracy of codons, those skilled in the art can easily obtain nucleotide sequences encoding these mutants on the premise that the amino acid sequence of ribonucleoside hydrolase is disclosed in the present invention. No matter what kind of nucleotide sequence, as long as it encodes the aforementioned ribonucleoside hydrolase, it falls within the protection scope of the present invention.

[0052] Compared with the prior art, this application has the following beneficial effects:

[0053] In the present invention, a series of mutants are obtained by mutation at some specific sites of the amino acid sequence of N-deoxyribosyltransferase II, and the transglycosylation activity of the mutants is significantly improved. When used as catalysts, they catalyze the deoxyribose transfer reaction between the substrate, i.e., 2'-modified deoxyribonucleoside, and the base to produce a new 2'-modified deoxyribonucleoside, so that 2'-deoxythymidine can be synthesized to obtain 2'-deoxyguanosine at a higher conversion rate, which is helpful for the development of medical research and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 is the reaction flow chart of dGR;

[0055] Figure 2 It is the HPLC detection spectrum of 2'-deoxyguanosine standard;

[0056] Figure 3 It is the HPLC detection spectrum of 2'-deoxythymidine standard;

[0057] Figure 4 This is the HPLC detection spectrum of guanosine standard;

[0058] Figure 5 It is the HPLC detection spectrum of guanine standard;

[0059] Figure 6 It is the HPLC detection spectrum of thymine standard;

[0060] Figure 7 The HPLC detection spectrum of the conversion product. DETAILED DESCRIPTION

[0061] The method of the present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods known to those skilled in the art. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0062] The present invention will be further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0063] Unless otherwise specified, the test methods used in the following examples are conventional methods.

[0064] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0065] Vector pBAD-hisB: purchased from Invitrogen, product catalog number: V430-01.

[0066] Host bacteria E. coli BW 25113: purchased from Biovector NTCC INC, catalog number 355297.

[0067] 2'-Deoxythymidine standard: purchased from Macklin, catalog number T807542.

[0068] 2'-Deoxyguanosine standard: purchased from Nuowei, product number 312693-72-4.

[0069] Guanosine standard: purchased from Macklin, product number G6043.

[0070] Guanine standard: purchased from Macklin, product number G810378.

[0071] Thymine standard: purchased from Energy Chemical, product number E080211.

[0072] Example 1: Construction of recombinant bacteria and BPNDT mutant library

[0073] The N-deoxyribosyltransferase II in Example 1 of the present invention is derived from Bacillus paranthracis, hereinafter abbreviated as BPNDT. The amino acid sequence of the deoxyribosyltransferase is shown in the sequence table SEQ ID NO: 2. The bpndt gene fragment corresponding to the deoxyribosyltransferase was synthesized by Nanjing GenScript Biotechnology Co., Ltd. and recombined into the pBAD vector (purchased from Invitrogen) to obtain the recombinant vector pBAD-NDT. The recombinant plasmid pBAD-NDT was transformed into E. coli BW25113 (purchased from Biovector NTCC) to obtain the prokaryotic expression strain pBAD-NDT-BW25113, the enzyme expressed by which is BPNDT.

[0074] Through sequence alignment, we selected the LNRDT from Lactobacillus reuteri that was closest to the BPNDT sequence from Bacillus thuringiensis. Using this three-dimensional structure as a template, we used Swiss-model homology modeling to simulate the three-dimensional structure of BPNDT. We used Discovery Studio software to analyze the structure of LNRDT binding to 2'-deoxythymidine and the key sites of enzyme-substrate interaction. Combined with the software analysis results, we selected three amino acid sites for site-directed saturation mutagenesis: Arg37, Phe46, and Trp51.

[0075] The amino acid mutation sequence of the deoxyribose transferase BPNDT SEQ ID NO: 2 has any mutation selected from the following group:

[0076] No. 37 R → W;

[0077] No. 37 R → L;

[0078] No. 37 R → I;

[0079] No. 37 R → P;

[0080] No. 37 R→N;

[0081] No. 37 R → A;

[0082] No. 37 R → S;

[0083] No. 37 R→T;

[0084] No. 37 R→D;

[0085] No. 37 R→F;

[0086] No. 37 R → M;

[0087] No. 37 R → K;

[0088] No. 37 R → C;

[0089] No. 46 F → W;

[0090] No. 46 F → P;

[0091] No. 46 F → V;

[0092] No. 46 F → S;

[0093] No. 46 F → T;

[0094] No. 46 F → E;

[0095] No. 46 F → G;

[0096] No. 46 F → M;

[0097] No. 46 F → C;

[0098] No. 46 F → R;

[0099] No. 51 W → H;

[0100] No. 51 W → P;

[0101] No. 51 W → A;

[0102] No. 51 W → L;

[0103] No. 51 W → Q;

[0104] No. 51 W → T;

[0105] No. 51 W→D;

[0106] No. 51 W→F;

[0107] No. 51 W → E;

[0108] No. 51 W → M;

[0109] No. 51 W → K;

[0110] No. 51 W → C;

[0111] The 51st bit W→R.

[0112] Using the recombinant pBAD-NDT-BW25113-wt as a DNA template, the sequences in Table 1 below as primers, and site-directed mutagenesis, pBAD-hisB was used as an expression vector to obtain a mutant plasmid carrying a mutant gene, wherein site-directed mutagenesis refers to the introduction of desired changes (usually changes that characterize a favorable direction) into a target DNA fragment (which can be a genome or a plasmid) by methods such as polymerase chain reaction (PCR), including addition, deletion, and point mutation of bases.

[0113] Table 1

[0114]

[0115]

[0116]

[0117] The specific process of constructing the mutant library is as follows:

[0118] The PCR system and conditions were as follows, and 2×ApexHF FS PCR Master Mix DNA polymerase was used.

[0119] The volume of a single PCR reaction solution is 50 μL, which contains the following components:

[0120] DNAtemplate (10ng / μL pBAD-NDT-BW25113-wt): 1μL;

[0121] Prime-F (10 μM): 1 μL;

[0122] Prime-R (10 μM): 1 μL;

[0123] 2×ApexHF FS PCR Master Mix: 25μL;

[0124] ddH2O: 22 μL.

[0125] PCR reaction conditions: 95℃5min, 95℃30sec, 55℃30sec, 72℃4min, 30 cycles, 72℃10min, 4℃forever.

[0126] After PCR amplification, 1.5 μL DpnI (20 U / μL) was added to the above PCR reaction solution to remove excess template, and the digestion condition was 37° C. for 3 h.

[0127] The obtained different mutant plasmids were transformed into E. coli BW 25113 competent cells respectively to obtain different mutants, and all mutants together constituted a mutant library.

[0128] It should be noted that, from the process of constructing the mutant library, it can be seen that the above-mentioned wild-type plasmid is artificially manipulated to introduce the desired mutation in a specific region to form a mutant plasmid.

[0129] Example 2: Induction and expression of BPNDT mutant protein

[0130] The NDT mutant strain constructed in Example 1 was cultured overnight in 3 mL 2YT liquid culture medium (0.5% NaCl, 1% yeast extract, 1.6% tryptone) with a final concentration of 50 μg / mL streptomycin at 37° C., 220 rpm, and then inoculated at a ratio of 1% (v / v) into 5 mL 2YT liquid culture medium containing a final concentration of 50 μg / mL streptomycin, and cultured at 37° C., 220 rpm, to obtain an NDT mutant culture solution.

[0131] When the OD of the NDT mutant culture medium 600nm When the pH value reached 0.8-1.0, arabinose was added at a final concentration of 0.2 mM to induce protein expression. The mixture was induced at 25°C and 220 rpm overnight to obtain the induced bacterial liquid of different NDT mutants.

[0132] Determine the OD of the induction culture of different NDT mutants 600nm , calculate the required amount of bacteria according to the reaction volume, centrifuge at 4°C, 12000rpm, 3min, collect the bacteria quantitatively, resuspend the bacteria in 100mM Tris-HCl buffer, pH 8.0, and obtain quantitative enzyme solutions of different NDT mutants.

[0133] The preparation method of the required RihC protease solution is basically the same as above.

[0134] Example 3: Catalytic activity detection of wild-type deoxyribosyltransferase and mutant deoxyribosyltransferase

[0135] RihC enzyme solution, 2'-deoxythymidine and guanosine were added to the enzyme solutions of different BPNDT mutants prepared in Example 2. In the 100mM Tris-HCl buffer reaction system with pH 8.0, the concentration of NDT enzyme solution was 30OD / mL, the concentration of RihC enzyme solution was 1OD / mL, the concentration of 2'-deoxythymidine was 200mM, and the concentration of guanosine was 200mM. The mixed reaction solution was catalyzed at 55°C and 220rpm for 7.5 hours to obtain a conversion solution.

[0136] After the catalytic reaction was completed, the conversion solution obtained above was heat-treated in a metal bath at 100° C. for 10 min. After the heat treatment was completed, it was centrifuged at 4° C. and 12,000 rpm for 5 min to collect the supernatant.

[0137] The supernatant obtained above was filtered with a 0.22 μM filter membrane, and the filtrate was collected for HPLC detection of the yield of 2'-deoxyguanosine. HPLC used a YMC Triart C18 column, the mobile phase was 10% methanol + 90% water, the flow rate was 0.60 mL / min, the column temperature was 40°C, the injection volume of a single sample was 10 μL, and the detection wavelength was 260 nm.

[0138] It should be noted that HPLC (high performance liquid chromatography) is a commonly used separation and analysis method, which can be used to detect and determine the yield of 2'-deoxyguanosine.

[0139] To determine the yield of 2'-deoxyguanosine, the separated 2'-deoxyguanosine components can be collected in an HPLC experiment and compared and quantified using appropriate standards. The preparation of standards can refer to relevant literature or use standards of known concentrations. In this Example 3, 2'-deoxyguanosine standards, 2'-deoxythymidine standards, guanosine standards, guanine standards, and thymine standards were used.

[0140] In a specific HPLC experiment, a single standard or multiple standards can be used to establish a material standard curve, which can more accurately measure the content of the target compound in the sample. In this Example 3, four standards and the conversion solution sample were injected into the chromatographic column together, and the retention time and peak area or peak height between them were compared and compared and quantified.

[0141] Results, such as Figure 2 As shown, the retention time of the 2'-deoxyguanosine standard is 13.941 min.

[0142] like Figure 3 As shown, the retention time of the 2'-deoxythymidine standard is 17.978 min.

[0143] like Figure 4 As shown, the retention time of the guanosine standard is 11.576 min.

[0144] like Figure 5 As shown, the retention time of the guanine standard is 7.588 min.

[0145] like Figure 6 As shown, the retention time of the thymine standard is 10.654 min.

[0146] like Figure 7 As shown, there is also a peak with a retention time of 13.978 min in the conversion solution.

[0147] It should be noted that retention time refers to the time from the injection point to the peak top of the compound in the chromatographic column. Retention time is a commonly used chromatographic parameter used for identification and quantitative analysis of compounds.

[0148] The difference in retention time can be used to identify and distinguish different substances. In the chromatogram, each peak represents a specific substance, and different substance peaks will appear at different time points. By comparing the retention time of the standard and the sample, it can be determined whether the sample contains the same compound as the standard. If the retention times are basically the same, it can be considered that the sample contains the same compound as the standard; if the retention times are inconsistent, it can be considered that the sample contains a different compound than the standard.

[0149] Combination Figure 2-Figure 7 It can be seen that Figure 7 The retention time of the conversion solution Figure 2 The 2'-deoxyguanosine standard in Figure 3-Figure 6 The retention times of the corresponding standards differ greatly, indicating that 2'-deoxyguanosine is generated using 2'-deoxythymidine and guanosine as substrates.

[0150] During the analysis process, the retention time can also be measured to assist in judging the progress of the reaction for quantitative analysis. By establishing a standard curve, the content of the target compound in the sample can be determined. The preparation of the standard curve requires the use of standards of known concentrations, measuring their retention time and peak area, and then fitting a curve based on these data. By comparing the retention time and peak area of ​​the target compound in the sample with the relevant standard curve, the content of the target compound in the sample can be determined, and the conversion rate can be calculated.

[0151] For example, in the reaction of synthesizing 2'-deoxythymidine from 2'-deoxyguanosine, if 2'-deoxythymidine and 2'-deoxyguanosine have different retention times, it is possible to determine whether the reaction has occurred by measuring the change in retention time and further calculate the conversion rate.

[0152] In this Example 3, the experiment was repeated three times and the average value was taken. After screening and verification, the mutation status, conversion rate and mutation site of the wild type and mutant are shown in Table 2 below.

[0153] Table 2

[0154]

[0155]

[0156] As can be seen from Table 2, BPNDT represents the wild-type deoxyribosyltransferase in the prior art, R37W, R37L, R37I, R37P, R37N, R37A, R37S, R37T, R37D, R37F, R37M, R37K, R37C, F46W, F46P, F46V, F46S, F46T, F46E, F46G, F46M, F46 6Y, F46R, W51H, W51P, W51A, W51L, W51Q, W51T, W51D, W51F, W51E, W51M, W51K, W51C and W51R represent different mutant deoxyribosyltransferases, respectively. It can be seen that when different mutant deoxyribosyltransferases are used to catalyze 2'-deoxythymidine and guanosine, the conversion rates of 2'-deoxyguanosine obtained are different.

[0157] At the 37th amino acid residue, the conversion rate of the mutant deoxyribosyltransferase with the mutation site at R37L was the highest, followed by the conversion rate of the mutant deoxyribosyltransferase with the mutation site at R37I, and both were much higher than the wild-type deoxyribosyltransferase. The conversion rates of the other 11 mutant deoxyribosyltransferases were slightly higher, close to, or lower than the wild-type deoxyribosyltransferase, and these mutant deoxyribosyltransferases all had certain catalytic activity for 2'-deoxythymidine and guanosine.

[0158] At the 46th amino acid residue, the conversion rate of the mutant deoxyribosyltransferase with the mutation site F46Y was the highest, followed by the conversion rate of the mutant deoxyribosyltransferase with the mutation site F46W. Although the conversion rates of the other eight mutant deoxyribosyltransferases were close to or lower than those of the wild-type deoxyribosyltransferase, it is undeniable that these mutant deoxyribosyltransferases all had certain catalytic activity towards 2'-deoxythymidine and guanosine.

[0159] At amino acid residue 51, the conversion rate of mutant deoxyribosyltransferase with mutation site W51L was the highest, followed by the conversion rate of mutant deoxyribosyltransferase with mutation site W51D, and both were much higher than the wild-type deoxyribosyltransferase. The conversion rates of the other 11 mutant deoxyribosyltransferases were slightly higher, close to or lower than the wild-type deoxyribosyltransferase, and these mutant deoxyribosyltransferases all had certain catalytic activity for 2'-deoxythymidine and guanosine.

[0160] It should be noted that the mutant deoxyribose transferase of the present invention is to solve the problem that the existing deoxyribose transferase cannot catalyze the deoxyribose transfer of deoxyribonucleosides (2'-deoxythymidine) with modified groups on the sugar group, and the 36 mutant deoxyribose transferases in Table 2 obviously have certain catalytic activity on 2'-deoxythymidine and guanosine, and can generate 2'-deoxyguanosine. As for the difference in conversion rate, in actual use, the mutant deoxyribose transferase with different mutation sites can be selected according to the needs.

[0161] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions under the concept of the present invention belong to the protection scope of the present invention. It should be pointed out that for ordinary technicians in this technical field, some improvements and modifications without departing from the principle of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A deoxyribosyltransferase mutant, characterized in that: The amino acid sequence of the deoxyribose transferase mutant is any one of the following: (1) a mutant sequence obtained by mutating the amino acid residue at position 37 of the amino acid sequence shown in SEQ ID NO: 2 to X1; wherein X1 is selected from any one of W, L, I, P, N, A, S, T, D, F, M, K and C; (2) a mutant sequence obtained by mutating the amino acid residue at position 46 of the amino acid sequence shown in SEQ ID NO: 2 to X2; wherein X2 is selected from any one of W, P, V, S, T, E, G, M, Y and R; (3) a mutant sequence obtained by mutating the amino acid residue at position 51 of the amino acid sequence shown in SEQ ID NO: 2 to X3; wherein X3 is selected from any one of H, P, A, L, Q, T, D, F, E, M, K, C and R; or (4) Based on (1), (2) and (3), conventional one or more amino acid substitutions, additions and deletions are performed to obtain a derivative sequence having at least 80% homology with the aforementioned mutant sequence and having the same biological activity.

2. A carrier, characterized in that When the vector is a nucleic acid molecule, the nucleotide sequence of the nucleic acid molecule can encode the deoxyribosyltransferase mutant according to claim 1.

3. A host cell, characterized in that The host cell comprises the vector according to claim 3.

4. A cell culture, characterized in that The cell culture comprises the host cell of claim 4.

5. A method for preparing the deoxyribosyltransferase mutant according to claim 1, characterized in that: The preparation method is: A deoxyribosyltransferase NDT with a mutation in the amino acid residue at position 37, position 46, or position 51 of the amino acid sequence is selected, and pBAD-NDT-BW25113 is obtained by reacting the deoxyribosyltransferase NDT, ribonucleoside hydrolase RihC, expression vector pBAD-hisB and host bacteria E. coli BW 25113. The recombinant pBAD-NDT-BW25113-wt is used as a DNA template, and sequences of SEQ ID NO: 5 to SEQ ID NO: 76 are used as primers. By using site-directed mutagenesis, pBAD-hisB is used as an expression vector to obtain a mutant plasmid with a mutant gene, and the obtained different mutant plasmids are respectively transformed into E. coli BW 25113 to obtain corresponding different mutants. The amino acid sequence of the ribonucleoside hydrolase RihC is shown in SEQ ID NO:

4.

6. An application of a deoxyribosyltransferase mutant, characterized in that: The deoxyribose transferase mutant is derived from the vector of claim 2, the host cell of claim 3 or the cell culture of claim 4; The deoxyribosyltransferase mutant is used as a catalyst to catalyze the base transfer of the deoxyribose on the 2'-modified deoxyribonucleoside.

7. A method for using the deoxyribosyltransferase mutant according to claim 6, characterized in that: The method of use is: The deoxyribose transferase mutant, vector, host cell or cell culture is contacted with a substrate to perform a catalytic reaction, wherein the substrate includes a 2'-modified deoxyribonucleoside and a base.

8. The method for using the deoxyribosyltransferase mutant according to claim 7, characterized in that: The reaction conditions of the catalytic reaction are: pH 7.8-8.2, 50-60°C.

9. A ribonucleoside hydrolase, characterized in that The amino acid sequence of the ribonucleoside hydrolase is shown in SEQ ID NO:

4.

10. A carrier, characterized in that When the vector is a nucleic acid molecule, the nucleotide sequence of the nucleic acid molecule can encode the ribonucleoside hydrolase according to claim 9.

Images