β-glucuronidase and its application in bilirubin production

Abstract

The present invention discloses a β-glucuronidase and its application in bilirubin production, belonging to the field of biomedicine technology. The present invention obtains a product containing β-glucuronidase by constructing a recombinant plasmid, transforming, expressing and isolating and purifying, which can be used to prepare bilirubin by pig bile reaction. The β-glucuronidase provided by the present invention has high enzyme activity and thermal stability, a wide pH range and temperature range, and strong adaptability. In addition, it contains Fe 2+ and Mg 2+ The metal ion solution has a promoting effect on β-glucuronidase, which is beneficial for improving enzyme activity. The β-glucuronidase produces bilirubin with high yield and purity and can be widely used in the production process of bilirubin.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a beta-glucuronidase and its application in bilirubin production. Background Art

[0002] Bilirubin is an important lipid drug and the main ingredient in over 100 Chinese patent medicines listed in the 2020 edition of the Pharmacopoeia, such as Angong Niuhuang Wan, Niuhuang Jiedu Wan, and Dahuoluo Wan. It is in extremely high market demand and currently commands high prices. Bilirubin is also a key component of the rare and precious Chinese medicinal material, bezoar, and possesses extremely high medicinal value. Currently, bilirubin is primarily extracted from animal bile (such as pig bile), but over 90% of the bilirubin in pig bile exists as conjugated bilirubin bound to glucuronic acid. Traditional bilirubin production processes use chemical methods such as high temperature and strong alkali to remove the glucuronic acid group from bound bilirubin, but this can easily lead to bilirubin oxidation, resulting in low yields and severe environmental pollution. Leading international pharmaceutical companies such as Roche, Novartis, and Merck have already begun research on enzymatic bilirubin preparation, while domestic research is just beginning. There is a need to conduct research and industrial development on key technologies for the green preparation of bilirubin lipid drugs. Summary of the Invention

[0003] The present invention aims to provide a β-glucuronidase and its application in bilirubin production. The β-glucuronidase has high enzyme activity and thermal stability, and can improve the yield and purity of bilirubin preparation.

[0004] The purpose of the present invention can be achieved through the following technical solutions:

[0005] The present invention provides a beta-glucuronidase, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0006] Furthermore, the preparation steps of the β-glucuronidase are as follows:

[0007] (1) Construction of recombinant plasmid: The β-glucuronidase CP076 gene was inserted into the pET28a expression plasmid using restriction endonucleases BamHI and XhoI. Positive clones were screened for Kan resistance, amplified by PCR, and identified by enzyme digestion to obtain the recombinant plasmid. The recombinant plasmid pET28a-CP076 was verified by sequencing.

[0008] (2) Transformation of recombinant plasmid: The recombinant plasmid was used to transform E. coli BL21 (DE3) competent cells to obtain the recombinant strain E. coli BL21 (DE3)-pET28a-CP076;

[0009] (3) Inducible expression:

[0010] The recombinant strain E. coli BL21(DE3)-pET28a-CP076 carrying the β-glucuronidase gene was activated on a Kan-resistant LB plate and cultured overnight at 37°C. After colonies grew, a single clone was picked and inoculated into 5 mL of liquid LB medium containing 50 μg / mL Kan antibiotic at 37°C and agitated at 220 r / min for 12-14 h. A 1% inoculum was then transferred to 500 mL of liquid LB medium containing 50 μg / mL Kan antibiotic and agitated at 37°C and 220 r / min until the OD 600 When the pH reaches 0.6-0.8, IPTG (final concentration 0.1 mM) was added and cultured at 16°C with an oscillation rate of 220 rpm for 16-18 h. After the culture was completed, the fermentation broth was obtained and centrifuged at 8000 rpm for 10 min. The supernatant was discarded and the cells were collected and stored at -80°C for later use.

[0011] (4) Separation and purification:

[0012] The cells were mixed with lysis buffer at a ratio of 1 g:10 mL, resuspended by shaking until no obvious lumps were left, and disrupted using an ultrasonic disruptor to obtain a cell disruption solution. The cell disruption solution was centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was obtained to obtain the cell disruption solution supernatant, i.e., the crude enzyme solution. The crude enzyme solution was purified by column chromatography to obtain an eluate, which was further dialyzed to obtain a concentrated enzyme solution for SDS-PAGE detection and enzyme activity determination.

[0013] Furthermore, the restriction endonucleases are BamHI and XhoI.

[0014] Furthermore, the content of Kan antibiotic in the liquid LB culture medium containing Kan antibiotic is 50 μg / mL.

[0015] Furthermore, the shaking culture temperature is 37° C. and the shaking rate is 220 r / min.

[0016] Furthermore, the inducer is IPTG with a final concentration of 0.1 mM, the temperature of the low-temperature shaking culture is 16° C., and the shaking rate is 220 r / min.

[0017] The present invention also provides a use of the beta-glucuronidase in the production of bilirubin. The beta-glucuronidase reacts with a substrate, pig bile, to prepare bilirubin.

[0018] Further, the steps of preparing bilirubin are as follows:

[0019] The collected fermentation broth was divided into two parts, one of which was used as the whole-cell conversion liquid, and the other was centrifuged, resuspended in buffer, and then broken as the crude enzyme solution. 1.5L of pig bile was measured, the pH was slowly adjusted with acetic acid at 30°C, 0.05wt% promoter and 0.1wt% antioxidant were added, and the whole-cell conversion liquid (50% by volume) or crude enzyme solution (6% by volume) was added. The conversion reaction was carried out at the optimal temperature. After 4 hours of reaction, the bilirubin content was detected by liquid phase and ultraviolet.

[0020] Furthermore, the pH of the pig bile is adjusted to 4.5-5.5, and the optimum temperature is 30-50°C.

[0021] Furthermore, the antioxidant is sodium bisulfite, and the promoter is one of MgSO4 and FeSO4.

[0022] Beneficial effects of the present invention:

[0023] The β-glucuronidase prepared by the present invention has high enzyme activity and thermal stability, is adaptable to a wide pH range and temperature range, and has a high metal ion Fe 2+ and Mg 2+ The β-glucuronidase can be used to prepare bilirubin from pig bile, has simple preparation steps, and has high bilirubin yield and purity, and can be widely used in the production process of bilirubin. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] The present invention will be further described below with reference to the accompanying drawings.

[0025] Figure 1 Schematic diagram of the recombinant plasmid structure of the present invention;

[0026] Figure 2 It is an SDS-PAGE detection analysis diagram of the present invention;

[0027] In the figure: M, protein marker; channel 1, total amount of empty cell disruption; channel 2, supernatant of empty cell disruption; channel 3, precipitate of empty cell disruption; channel 4, total amount of cell disruption solution; channel 5, supernatant of cell disruption solution; channel 6, precipitate of cell disruption solution; channel 7, flow-through solution; channel 8, 100mM imidazole eluent; channel 9, 150mM imidazole eluent; channel 10, 200mM imidazole eluent; channel 11, 500mM imidazole eluent.

[0028] Figure 3 It is the standard curve diagram of p-nitrophenol of the present invention;

[0029] Figure 4 This is a graph showing the optimal pH test results for β-glucuronidase of the present invention;

[0030] Figure 5 This is a graph showing the pH stability test results of the β-glucuronidase of the present invention;

[0031] Figure 6 This is a graph showing the results of detecting the optimum reaction temperature of β-glucuronidase of the present invention;

[0032] Figure 7 This is a graph showing the results of a thermal stability test of the β-glucuronidase of the present invention;

[0033] Figure 8 This is a graph showing the results of detecting the effect of metal ions on the activity of β-glucuronidase according to the present invention.

[0034] Figure 9 It is the bilirubin standard curve diagram of the present invention.

[0035] Figure 10 It is a product diagram of the bilirubin extraction of the present invention. DETAILED DESCRIPTION

[0036] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0037] Example 1

[0038] Preparation of β-glucuronidase:

[0039] The nucleotide sequence of β-glucuronidase is shown in SEQ ID NO: 1.

[0040] (1) Construction of recombinant plasmid: The glucuronidase CP076 gene was inserted into the pET28a expression plasmid using restriction endonucleases BamHI and XhoI. Positive clones were screened for Kan resistance, amplified by PCR, and identified by enzyme digestion to obtain the recombinant plasmid. The recombinant plasmid pET28a-CP076 was verified by sequencing.

[0041] (2) Transformation of recombinant plasmid: The recombinant plasmid was used to transform E. coli BL21 (DE3) competent cells to obtain the recombinant strain E. coli BL21 (DE3)-pET28a-CP076.

[0042] (3) Inducible expression:

[0043] The recombinant strain E. coli BL21 (DE3)-pET28a-CP076 carrying the β-glucuronidase gene was activated in an LB plate containing Kan resistance and cultured overnight at 37°C. After the colonies grew, a single clone was picked and inoculated into 5 mL of liquid LB medium containing 50 μg / mL Kan antibiotic, at 37°C, shaking at 220 r / min, and cultured for 12-14 hours. Then, a 1% inoculum was transferred to 500 mL of liquid LB medium containing 50 μg / mL Kan antibiotic, at 37°C, shaking at 220 r / min, and cultured until the OD 600 When the pH reaches 0.6-0.8, IPTG (final concentration 0.1 mM) was added and cultured at 16°C with an oscillation rate of 220 rpm for 16-18 hours. After the culture was completed, the fermentation broth was obtained and centrifuged at 8000 rpm for 10 minutes. The supernatant was discarded and the cells were collected and stored at -80°C for later use.

[0044] (4) Separation and purification:

[0045] The cells were mixed with lysis buffer at a ratio of 1 g:10 mL, resuspended by shaking until no obvious lumps were left, and disrupted using an ultrasonic disruptor to obtain a cell disruption solution. The cell disruption solution was centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was obtained to obtain the cell disruption solution supernatant, i.e., the crude enzyme solution. The crude enzyme solution was purified by column chromatography to obtain an eluate, which was further dialyzed to obtain a concentrated enzyme solution for SDS-PAGE detection and enzyme activity determination.

[0046] SEQ ID NO: 1:

[0047] GGATCCATGCTGTACCCGATCATCACCGAATCCCGTCAGCTGATCGACCTGTCTGGCATCTGGAAATTCAAACTGAACGAAGGTAACGGCCTGACTGAAGAACTGTCTAAAACCCCGCTGGAAGATACCATCGAAATGGCGGTGCCGAGCTCCTACAACGACCTGGTGGAAAGCCAGGAAGTTCGTGACCACGTTGGCTGGGTGTGGTATGAACGTAACTTTACCATCCCGAAAACGCTGCTGAACGAACGTATCGTTCTGCGTTTCGGCTCTGCAACCCACGAAGCGAAAGTTTATCTGAACGGTGAACTGCTGGTTGAACACAAAGGCGGTTTTACCCCGTTCGAAGCAGAAATCAACGACCTGCTGGTTAGCGGCGACAACCGCCTGACTGTGGCAGTGAACAACATCATCGATGAAACCACCCTGCCGGTTGGCCTGGTGAAAGAAGTTGAAGTTGATGGCAAAAAGATTATCAAAAACAGCGTGAACTTCGATTTCTTCAACTATGCGGGTATTCATCGCCCGGTGAAAATCTACACTACTCCGAAAA

[0048] GCTACGTGGAGGACATCACCATCGTGACCGACTTCAAAGAAAACAA

[0049] CGGTTACGTAAACTACGAAGTTCAGGCCGTTGGCAAATGCAACATC

[0050] AAAGTTACCATCATCGACGAAGAGAACAACATCGTTGCGGAAGGCG

[0051] AAGGCAAAGAAGGTAAACTGACCATCAACAACGTGCACCTGTGGGA

[0052] ACCGATGAACGCGTACCTGTACAAACTGAAAGTTGAACTGCTGGAT

[0053] GATGAAGAAATCATCGATACCTACTTCGAAGAATTCGGCGTCCGTA

[0054] CCGTTGAAGTTAAAGATGGTAAATTCCTGATTAACAACAAACCGTTC

[0055] TACTTTAAAGGCTTTGGCAAACACGAAGATTCCTATGTGAACGGCC

[0056] GCGGCATCAACGAAGCCATCAACATTAAAGACTTCAACCTGATGAA

[0057] ATGGATTGGTGCCAACTCTTTCCGCACCAGCCACTACCCGTACTCCG

[0058] AAGAAATCATGCGCCTGGCGGACCGTGAAGGCATCGTTGTTATCGA

[0059] TGAAACCCCGGCTGTGGGTCTGCACCTTAACTTCATGGCTACCGGCT

[0060] TCGGCGGCGACGCCCCGAAACGCGACACCTGGAAAGAAATTGGTAC

[0061] CAAAGAAGCCCATGAACGCATCCTGCGCGAACTGGTTTCCCGTGAT

[0062] AAAAACCACCCGTGCGTGGTGATGTGGTCTGTTGCGAACGAACCGG

[0063] ATTCCGATTCCGAAGGTGCGAAAGAATACTTCGAACCGCTGATTAA

[0064] ACTGACGAAAGAACTGGACCCGCAGAAACGTCCGGTTACCGTGGTG

[0065] ACTTACCTGATGTCTACCCCGGATCGCTGCAAAGTGGGCGATATCGT

[0066] TGACGTGCTGTGCCTGAACCGTTATTACGGTTGGTACGTTGCGGGTG

[0067] GTGATCTGGAAGAAGCGAAACGTATGCTGGAAGATGAACTGAAAG

[0068] GCTGGGAAGAACGTTGTCCGAAAACCCCGATCATGTTCACCGAATA

[0069] CGGCGCGGACACCGTTGCAGGCCTGCACGATACCGTTCCGGTGATG

[0070] TTCACCGAAGAATACCAGGTAGAATACTACAAAGCCAACCACGAAG

[0071] TGATGGACAAATGCAAAAACTTCGTTGGCGAACAGGTTTGGAACTT

[0072] TGCAGACTTCGCGACCAGCCAGGGCATCATCCGTGTGCAGGGTAAC

[0073] AAAAAAGGCATCTTCACCCGCGAACGTAAACCGAAAATGATCGCTC

[0074] ACTCTCTGCGTGAACGTTGGACCAACATCCCGGAATTCGGTTATAAA

[0075] AAATAACTCGAG.

[0076] Example 2

[0077] SDS-PAGE detection:

[0078] Pipette 20 μL of sample (total cell disruption solution, supernatant of cell disruption solution, precipitate of cell disruption solution, and elution solution of each concentration of imidazole), add 5 μL of 5X electrophoresis buffer, mix evenly, boil in a boiling water bath for 10 min, cool to room temperature, and centrifuge at 10,000 rpm for 5 min.

[0079] Take out two electrophoresis glass plates, clean and install them, fill the space between the two glass plates with pure water, let it stand for 15-20 minutes, and observe whether there is any liquid seeping out or the liquid level dropping. If there is no water seeping out or the liquid level remains unchanged, pour out the water and proceed to the next step; otherwise, reinstall it and check for leaks.

[0080] Install the electrophoresis device, add 1X electrophoresis buffer to the inner electrophoresis tank until it is full, add an appropriate amount of 1X electrophoresis buffer to the outer electrophoresis tank, and then add the processed samples and protein electrophoresis gel to the protein gel channels in sequence. Turn on the power, set the voltage to 80V and run electrophoresis for 30 minutes, then increase the voltage to 120V and continue running until the protein bands run to the bottom of the gel plate.

[0081] After electrophoresis, carefully remove the protein gel from the glass plate, rinse with water, add Coomassie Brilliant Blue dye, and place on a horizontal shaker for 1-2 hours. After staining, rinse with water 2-3 times, add appropriate amount of decolorizing solution until the bands are clear, and the test results are shown in the table. Figure 2 SDS-PAGE analysis showed that CP076 was abundantly expressed in E. coli BL21(DE3) and was mostly soluble, eluting at an imidazole concentration of 150 mM. Comparison of protein electrophoresis bands revealed a molecular weight of approximately 70 kDa for β-glucuronidase.

[0082] Example 3

[0083] Determination of the optimal pH of β-glucuronidase:

[0084] Preparation of p-nitrophenol standard curve: Weigh 15.762 mg of p-nitrophenol and dissolve it in 100 mL of pure water to make a 500 μM p-nitrophenol stock solution. Then dilute it to 450 μM, 400 μM, 350 μM, 300 μM, 250 μM, 200 μM, 150 μM, 100 μM, and 50 μM, and measure the absorbance at 405 nm. The absorbance (OD) is plotted on the horizontal axis with the p-nitrophenol concentration (μmol / L). 405 ) is used as the vertical axis to draw the standard curve. Figure 3 .

[0085] With 4-nitrobenzene-β-D glucuronide as substrate, β-glucuronidase can react with substrate 4-nitrobenzene-β-D glucuronide (pNPG) to generate p-nitrophenol. To determine the activity of β-glucuronidase, accurately draw 10 μL of the concentrated enzyme solution prepared in Example 1 and add it to 40 μL of a buffer solution containing 1.25 mM 4-nitrobenzene-β-D glucuronide at different pH values (buffer: 50 mM acetic acid-sodium acetate buffer at pH 4.0-6.0, 50 mM Tris-HCl buffer at pH 6.5-10.0), and react at 40°C for 10 minutes. After the reaction is complete, 200 μL of 0.4 M Na2CO3 solution is added to terminate the reaction. After the termination reaction, the sample is diluted by multiples and the content of p-nitrophenol is detected at 405 nm using a spectrophotometer. Water is used instead of the concentrated enzyme solution as the CK control group, and three parallel experiments are set up. The test results are shown in Tables 1 and Figure 4 .

[0086] Table 1

[0087]

[0088]

[0089] Enzyme activity is defined as: under certain conditions, the amount of enzyme required to catalyze the production of 1 μmol of p-nitrophenol per minute per 1 μL of enzyme solution is one activity unit (U / μL). The enzyme activity is calculated using a standard curve. The enzyme activity calculation formula is:

[0090] Enzyme activity (U / μL) = (OD 405 ×V1×D) / (t×V2)

[0091] OD 405 : Substitute the concentration value corresponding to the standard curve of p-nitrophenol; V1: total volume of the reaction system; D: dilution factor; t: reaction time; V2: volume of concentrated enzyme solution participating in the reaction.

[0092] From Table 1 and Figure 4 The optimal pH for β-glucuronidase is 5.0, at which its activity reaches a maximum of 3994 U / μL. Between pH 4 and 5, β-glucuronidase activity increases, while between pH 5.5 and 10, it generally decreases.

[0093] pH stability determination of β-glucuronidase:

[0094] The concentrated enzyme solution was added to buffer solutions of different pH values and mixed evenly. The solution was incubated at 40°C for 30 min. The residual activity of the concentrated enzyme solution was determined according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group. Three parallel experiments were performed. The test results are shown in Tables 2 and Figure 5 .

[0095] Table 2

[0096]

[0097]

[0098] From Table 3 and Figure 5 It can be seen that the β-glucuronidase easily loses its activity under excessively acidic conditions for a long time, but can maintain its enzyme activity well under other pH conditions for a long time.

[0099] Example 4

[0100] Determination of the optimal reaction temperature of β-glucuronidase:

[0101] The temperature gradient was set at 30°C, 40°C, 50°C, 60°C, 70°C, 80°C, and 90°C. 10 μL of the concentrated enzyme solution prepared in Example 1 was added to 40 μL of pH 5.0 buffer and reacted for 10 min at different temperatures. The enzyme activity was detected according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group, and three parallel experiments were set up. The test results are shown in Table 3 and Figure 6 .

[0102] Table 3

[0103]

[0104]

[0105] Temperature has a great influence on the activity and stability of enzymes, as shown in Table 3 and Figure 6 It can be seen that the optimal reaction temperature of the β-glucuronidase is 40°C. At T=40°C, the enzyme activity reaches a maximum value of 3952 U / μL.

[0106] Thermal stability assay of β-glucuronidase:

[0107] The concentrated enzyme solution prepared in Example 1 was added to the buffer solution with the optimal pH and mixed evenly. The mixture was incubated at different temperatures for 30 min. After the incubation, the mixture was placed on ice for cooling. The residual activity of the enzyme solution was then determined according to the above method. Water was used instead of the concentrated enzyme solution prepared in Example 1 as the CK control group. Three parallel experiments were performed. The test results are shown in Table 4 and Figure 7 .

[0108] Table 4

[0109]

[0110]

[0111] From Table 4 and Figure 7 It can be seen that the β-glucuronidase exhibits good thermal stability in the temperature range of 30-60°C and can maintain high enzyme activity for a long time; above 60°C, the β-glucuronidase denatures and inactivates due to the high temperature, and the enzyme activity decreases significantly.

[0112] Example 5

[0113] Detection of the effect of metal ions on β-glucuronidase activity:

[0114] A certain concentration of MnSO4, KCl, NaCl, MgSO4, FeSO4, CuSO4, and CaCl2 solution was prepared, and the concentrated enzyme solution prepared in Example 1 was evenly mixed with each ion solution to make the final concentration of each ion in the mixed solution reach 2mM. The mixture was incubated at 40°C for 30 minutes. The residual activity of the concentrated enzyme solution was measured according to the above method. Water was used instead of the ion solution as the CK control group, and three parallel experiments were set up. The test results are shown in Tables 5 and Figure 8 .

[0115] Table 5

[0116]

[0117]

[0118] The catalytic activity of enzymes can be affected by metal ions, which can inhibit or promote the activity. Figure 8 It can be seen that compared with the control group, Fe 2+ Mg 2+ It has a promoting effect on the β-glucuronidase, while Cu 2+ It has a significant inhibitory effect on the β-glucuronidase.

[0119] Example 6

[0120] Preparation of bilirubin:

[0121] Weigh 10.0 mg of bilirubin standard, dissolve it in chloroform in a 100 mL brown volumetric flask, add chloroform to the scale and shake well. Transfer 10 mL of chloroform solution to a 50 mL brown bottle, add 95% ethanol to dilute to the scale, this is the standard solution. Each milliliter of standard solution is equivalent to 0.00002 g of bilirubin. Measure 0, 1, 2, 3, 4, and 5 mL of standard solution into stoppered colorimetric tubes, add 9, 8, 7, 6, 5, and 4 mL of 95% ethanol respectively, so that the amount of liquid in each colorimetric tube is 9 mL, and then add 1 mL of diazotization reagent respectively and mix well. After standing in the dark at 30°C for 30 minutes, measure the absorbance at a wavelength of 520 nm. OD 520 The vertical axis is the bilirubin concentration in each tube and the horizontal axis is the standard curve. Figure 9 .

[0122] The concentrated enzyme solution prepared in Example 1 was collected and divided equally into two portions, one of which was used as a whole-cell conversion solution, and the other was centrifuged, resuspended in a buffer solution, and then crushed to form a crude enzyme solution. 1.5 L of porcine bile was measured, and the pH was slowly adjusted to 5.0 with acetic acid at 30°C. 0.1 wt% sodium bisulfite and 0.05 wt% anhydrous magnesium sulfate were added. One group was added with the whole-cell conversion solution at a volume fraction of 50%, and the other group was added with the crude enzyme solution at a volume fraction of 6%. The conversion reaction was carried out at pH = 5.0 and 40°C. After 4 hours of reaction, the bilirubin content was detected by liquid phase and ultraviolet light. The bilirubin yield of the whole-cell conversion solution was 85%, and the bilirubin yield of the crude enzyme solution was 90%.

[0123] After the conversion, adjust the pH of the pig bile to 6.0, add 50% chloroform (volume fraction), stir for 3 minutes and then let it stand for 10 minutes, stir again for 3 minutes and then let it stand for 30 minutes, use a separatory funnel to separate the lower layer of liquid, and repeat this process twice. The lower layer of liquid is placed in a rotary evaporator for rotary evaporation (the temperature must not exceed 85°C). After the rotary evaporation is completed, the bilirubin is dissolved and collected with boiling anhydrous ethanol, filtered, dried and weighed. The product after bilirubin extraction is shown in the figure. Figure 10 , where 1 is the product after adding whole-cell transformation solution, and 2 is the product after adding crude enzyme solution.

[0124] The purity of bilirubin obtained by extracting the product of the whole cell conversion solution is 95%, and the purity of bilirubin obtained by extracting the product of the crude enzyme solution is 98%.

[0125] The yield of bilirubin converted by crude enzyme is higher than that of bilirubin converted by whole cells, and the purity of bilirubin obtained by crude enzyme conversion is higher than that obtained by whole cells conversion.

[0126] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus.

[0127] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. An application of β-glucuronidase in bilirubin production, characterized in that: β-glucuronidase reacts with substrate pig bile to prepare bilirubin, wherein the nucleotide sequence of the β-glucuronidase is shown in SEQ ID NO: 1; The steps for preparing bilirubin are as follows: The pH of pig bile was slowly adjusted with acetic acid, and a promoter, antioxidant and β-glucuronidase were added. The conversion reaction was carried out at the optimal temperature. After 4 hours of reaction, the bilirubin content was detected by liquid phase and ultraviolet light. The pH of the pig bile is adjusted to 4.5-5.5, and the optimum temperature is 30-50°C; The accelerator is one of MgSO4 and FeSO4, and the antioxidant is sodium bisulfite.

2. The use of a β-glucuronidase in bilirubin production according to claim 1, characterized in that: The preparation steps of the β-glucuronidase are as follows: (1) Construction of recombinant plasmid: Use restriction endonucleases to insert the β-glucuronidase gene into the pET28a expression plasmid, screen positive clones, amplify by PCR and identify by enzyme digestion to obtain the recombinant plasmid; (2) Transformation of recombinant plasmid: Use the recombinant plasmid to transform BL21 (DE3) competent cells to obtain the recombinant strain; (3) Induced expression: After activation culture, the recombinant strain was transferred to liquid LB medium containing Kan antibiotics and cultured with shaking until OD 600 The pH value is 0.6-0.8, and the inducer is added and cultured at low temperature with shaking to obtain the fermentation liquid, and the bacteria are collected after centrifugation; (4) Isolation and purification: Mix the bacteria with lysis buffer, resuspend by oscillation, and disrupt by ultrasonication; The cell disrupted liquid is centrifuged and the supernatant is taken to obtain a crude enzyme solution, which is then purified and dialyzed to obtain a finished product.

3. The use of a β-glucuronidase in bilirubin production according to claim 2, characterized in that: The restriction endonucleases are BamHI and XhoI.

4. The use of a β-glucuronidase in bilirubin production according to claim 2, characterized in that: The content of Kan antibiotic in the liquid LB culture medium containing Kan antibiotic is 50 μg / mL.

5. The use of a β-glucuronidase in bilirubin production according to claim 2, characterized in that: The shaking culture temperature was 37° C., and the shaking rate was 220 r / min.

6. The use of a β-glucuronidase in bilirubin production according to claim 2, characterized in that: The inducer is IPTG with a final concentration of 0.1 mM. The temperature of the low-temperature shaking culture is 16° C. and the shaking rate is 220 r / min.

Images