A method for constructing a systemic lupus erythematosus mouse model and its application

The Rasgrp1 gene was edited by the CRISPR/Cas9 system to construct a systemic lupus erythematosus mouse model carrying p.T214I and p.K322X loci, which solved the complexity and instability of the existing model and achieved efficient and simple disease research and drug screening.

CN119432926BActive Publication Date: 2025-08-26BEIJING CHILDRENS HOSPITAL AFFILIATED TO CAPITAL MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411647446.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-18
Publication Date
2025-08-26
Estimated Expiration
2044-11-18

AI Technical Summary

Technical Problem

The existing mouse models of systemic lupus erythematosus have complex genetic background, long onset cycle, susceptible to environmental factors and complex breeding process, making it difficult to effectively study the pathogenesis of the disease and develop targeted drugs.

Method used

By designing sgRNAs that identify p.T214I and p.K322X sites, and using the CRISPR/Cas9 system for gene editing, a systemic lupus erythematosus mouse model carrying Rasgrp1 complex heterozygous mutations was constructed, including mouse fertilized egg injection, hybridization and homozygous mutant mice to form a typical systemic lupus erythematosus phenotype.

Benefits of technology

It provides a systemic lupus erythematosus mouse model with single pathogenic factors, stable heredity, high modeling rate and simple operation. It is suitable for in-depth discussion of pathogenesis and screening of therapeutic drugs, with typical pathological characteristics and phenotype of systemic lupus erythematosus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119432926B_ABST
    Figure CN119432926B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for constructing a systemic lupus erythematosus mouse model and its application. The present invention discovers for the first time the correlation between Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X) and the phenotype of systemic lupus erythematosus in mice. Based on this, the present invention constructs for the first time a novel systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X), laying the foundation for the study of the pathogenesis and intervention strategies of systemic lupus erythematosus, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a method for constructing a systemic lupus erythematosus mouse model and its application. Background Art

[0002] Systemic lupus erythematosus (SLE) is a common autoimmune disease characterized by chronic inflammatory damage to multiple organ systems. Its etiology and pathogenesis remain incompletely elucidated. It is currently believed that a combination of genetic, inflammatory, hormonal, and environmental factors may lead to an imbalance in immune homeostasis, dysregulation, the deposition of antigen-antibody and complement complexes in blood vessels, immune responses, and thrombosis, ultimately leading to local or systemic tissue and organ damage. SLE can cause symptoms such as inflammation and pain in the skin, kidneys, joints, blood, heart, and lungs, and can even be life-threatening. Currently, there is no clear cause of SLE and no known cure. Therefore, research into the etiology and pathogenesis of SLE is crucial. The development of animal models facilitates this research and is crucial for understanding both the pathogenesis and treatment options.

[0003] At present, the systemic lupus erythematosus mouse models studied at home and abroad are mainly divided into two types, namely spontaneous mouse models and artificially induced mouse models. Spontaneous mouse models include NZB, NZB / NZW F1, MRL / lpr, MRL / n, BXSB mice, etc. Artificially induced mouse models use chemical substances (such as pristane, concanavalin A, bacterial lipopolysaccharide, etc.) to induce lupus-like symptoms in mice. However, the genetic and environmental backgrounds of hybrid mice and induced mice are complex, and there are various deficiencies in the research. The reason why the NZB / NZW mouse model shows lupus phenotypes is unknown, and the disease cycle is long (6 months), it is easily affected by environmental factors, and the experimental process is difficult to control, which brings difficulties to the study of the pathogenesis of the disease. Although the cause of the disease in the MRL / lpr mouse model is clear and is caused by the deletion of the Fas gene, the MRL / lpr mouse model does not fully conform to the characteristics of the human disease. For example, the MRL / lpr model does not show gender differences, and the mice must be produced by complex mating of LG / J, AKR / J, C3H / HeDi and C57BL / 6J strains of mice to the 12th generation. The breeding process is complicated and the price is relatively high.

[0004] Therefore, in order to better explore the pathogenesis of systemic lupus erythematosus and develop drugs targeting systemic lupus erythematosus, there is an urgent need in this field to develop a method for constructing a systemic lupus erythematosus mouse model with a high modeling rate, short modeling time, and simple operation. Summary of the Invention

[0005] In view of this, in order to overcome the deficiencies of the prior art, the object of the present invention is to provide a method for constructing a systemic lupus erythematosus mouse model and its application.

[0006] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0007] The first aspect of the present invention provides a method for constructing a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X, wherein X in p.K322X refers to a stop mutation.

[0008] Furthermore, the method comprises the following steps:

[0009] (1) Designing sgRNA sequences that recognize the p.T214I site and the p.K322X site respectively;

[0010] (2) preparing sgRNA / Cas9 injection solutions respectively, and injecting the sgRNA / Cas9 injection solutions into mouse fertilized eggs respectively;

[0011] (3) The obtained fertilized eggs were transplanted into pseudopregnant female mice to obtain p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice;

[0012] (4) mating the p.T214I heterozygous mutant mice and mating the p.K322X heterozygous mutant mice to obtain p.T214I homozygous mutant mice and p.K322X homozygous mutant mice;

[0013] (5) The p.T214I homozygous mutant mice were hybridized with p.K322X homozygous mutant mice to obtain a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0014] Furthermore, the sgRNA sequence that recognizes the p.T214I site is shown in SEQ ID NO: 1;

[0015] The sgRNA sequence that recognizes the p.K322X site is shown in SEQ ID NO: 2.

[0016] Furthermore, the contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection are (8.0-15.0) ng / μL and (10-40) ng / μL, respectively.

[0017] Furthermore, the contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection were 12.5 ng / μL and 25 ng / μL, respectively.

[0018] Furthermore, the gene mutation site corresponding to the p.T214I site is c.641C>T;

[0019] The gene mutation site corresponding to the p.K322X site is c.964A>T, which forms a stop codon after mutation.

[0020] In some embodiments, the method of injecting sgRNA / Cas9 injection includes but is not limited to: microinjection, ultrasound-mediated method, electroporation, sonoporation, photoporation, magnetic transfer, heat shock method, calcium phosphate method, liposome and polymer method, nanoparticle method or viral transformation method.

[0021] In some embodiments, the method of injecting sgRNA / Cas9 injection is microinjection.

[0022] In some embodiments, the microinjection method utilizes a glass microinjection needle with an extremely fine tip (0.1-0.5 μm) to directly inject the exogenous gene fragment into pronuclear embryos or cultured cells. The exogenous gene is then embedded into the host chromosome through possible recombination, deletion, duplication, or translocation of the host genome sequence.

[0023] In a specific embodiment of the present invention, the sgRNA / Cas9 injection solution is an sgRNA / Cas9 microinjection solution, which is prepared by the following method: mixing sgRNA and Cas9 (Cas9 mRNA: 25 ng / μL; sgRNA: 12.5 ng / μL) using RNase-free TE-buffer.

[0024] In some embodiments, the sgRNA sequence that recognizes the p.T214I site and the sgRNA sequence that recognizes the p.K322X site are not limited to SEQ ID NO: 1 and SEQ ID NO: 2 used in the specific embodiments of the present invention. Any sgRNA that can specifically recognize the p.T214I site and any sgRNA that can specifically recognize the p.K322X site designed based on the prior art are within the scope of protection of the present invention.

[0025] In some embodiments, the method for designing sgRNA can be to obtain the sequence of the target gene (Rasgrp1) through an online database (e.g., NCBI), analyze the target sequence (20 bp) of the target gene using an online sgRNA design platform (https: / / design.synthego.com / # / ), select targets with high editing efficiency scores and low off-target scores, and then obtain the full-length sgRNA sequence by chemical synthesis.

[0026] In a specific embodiment of the present invention, the sgRNA sequence that recognizes the p.T214I site is shown as SEQ ID NO: 1; the sgRNA sequence that recognizes the p.K322X site is shown as SEQ ID NO: 2.

[0027] In a specific embodiment of the present invention, the mouse fertilized eggs are obtained by the following method: the embryo donor female mouse is superovulated (intraperitoneal injection of PMSG 20 IU / mouse, followed by intraperitoneal injection of HCG 30 IU / mouse 48 hours later), and the fertilized eggs are taken after being caged with the male mouse to obtain the mouse fertilized eggs.

[0028] In the present invention, compared with the Rasgrp1 gene of wild-type mice, the Rasgrp1 mutant gene has the following mutation sites c.641C>T and c.964A>T in the Rasgrp1 gene sequence.

[0029] The present invention creatively discovered for the first time the correlation between the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) and the systemic lupus erythematosus phenotype in mice. Therefore, the present invention is not limited to the specific construction method itself. Any construction method that uses the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) compound heterozygous mutation site to construct mice with a systemic lupus erythematosus phenotype will fall within the scope of protection of the present invention.

[0030] The second aspect of the present invention provides use of the systemic lupus erythematosus mouse model constructed according to the method of the first aspect of the present invention in screening drugs for treating and / or preventing systemic lupus erythematosus.

[0031] The present invention has found through phenotypic verification that the systemic lupus erythematosus mouse model constructed according to the method described in the first aspect of the present invention has a typical systemic lupus erythematosus phenotype. Therefore, the systemic lupus erythematosus mouse model can be used for the effective screening of candidate preventive and therapeutic drugs for systemic lupus erythematosus.

[0032] In the present invention, the treatment and / or prevention include treatment and prevention. Among them, treatment refers to reducing or eliminating the severity of the symptoms of the disease systemic lupus erythematosus, the frequency of such symptoms, or both. The term includes such effects that occur when the patient suffers from the disease systemic lupus erythematosus or related conditions, that is, reducing the severity of one or more symptoms or effects of systemic lupus erythematosus-related symptoms. Prevention refers to completely or partially preventing or inhibiting the symptoms of the disease or the frequency of such symptoms, or reducing the risk of acquiring a given symptom of the disease. In a specific embodiment of the present invention, the disease is systemic lupus erythematosus. Prevention includes inhibiting and / or preventing the symptoms related to systemic lupus erythematosus, reducing the severity of symptoms related to systemic lupus erythematosus, or improving signs and symptoms related to systemic lupus erythematosus. Prevention includes inhibiting, preventing or reducing the severity of symptoms related to systemic lupus erythematosus. The term includes such effects that occur before the patient begins to suffer from systemic lupus erythematosus or related conditions, that is, delaying the onset of symptoms related to systemic lupus erythematosus, and / or inhibiting or reducing the severity of symptoms related to systemic lupus erythematosus.

[0033] A third aspect of the present invention provides a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0034] Furthermore, the mouse model is a mouse model constructed using the method described in the first aspect of the present invention.

[0035] A fourth aspect of the present invention provides a CRISPR / Cas9 system for Rasgrp1 gene editing.

[0036] Furthermore, the system includes Cas9 mRNA and the sgRNA described in the first aspect of the present invention.

[0037] The CRISPR / Cas system is the most widely used genome editing technology. It consists of a Cas protein with endonuclease function and a single-stranded guide RNA (sgRNA) engineered to target a target gene. The sgRNA directs the Cas protein to perform knockout, insertion, and mutation modifications on the target gene. Among them, the CRISPR / Cas9 system, primarily composed of Cas9 and sgRNA, is the most intensively studied and most maturely applied, a highly effective gene editing tool. As a next-generation gene editing technology, CRISPR / Cas9, due to its ease of use, simplicity, and high efficiency, holds broad application prospects in model animal development, gene function research, and gene therapy.

[0038] In addition, the present invention also provides a kit for screening a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0039] Furthermore, the kit comprises primers for specifically detecting the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0040] Furthermore, the sequences of primers for detecting the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X are shown in SEQ ID NOs: 3-4 and 5-6, respectively.

[0041] In some embodiments, the kit for screening a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X refers to a kit comprising liquid or powdered primers that specifically recognize the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0042] In some embodiments, the kit may also include other reagents required for PCR, such as buffer, dNTPs, and polymerase; and reagents and consumables required for recovering PCR products, such as a gel solution, collection tubes, and wash solutions. Furthermore, the kit includes instructions describing how to test a sample and determine whether it contains the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X based on the test results. Using the DNA of the test sample as a template, the kit and instructions for screening a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X are simple to use and can rapidly identify a large number of samples.

[0043] The fifth aspect of the present invention provides use of the system described in the fourth aspect of the present invention in constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0044] The sixth aspect of the present invention provides the use of the mutation sites p.T214I and p.K322X on the Rasgrp1 gene in constructing a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X.

[0045] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0046] (1) The present invention discovered for the first time the correlation between Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X) and the phenotype of systemic lupus erythematosus in mice. Based on this, the present invention constructed for the first time a new systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X), laying the foundation for the study of the pathogenesis and intervention strategies of systemic lupus erythematosus.

[0047] (2) Compared with the commercial MRL / lpr systemic lupus erythematosus mouse model, the novel systemic lupus erythematosus mouse model provided by the present invention is simpler to breed. Compared with the artificially induced systemic lupus erythematosus mouse model and the NZB / NZW systemic lupus erythematosus mouse model, the novel systemic lupus erythematosus mouse model provided by the present invention has a single pathogenic factor and is more conducive to studying the pathogenesis of systemic lupus erythematosus.

[0048] (3) The novel systemic lupus erythematosus mouse model provided by the present invention has the advantages of stable inheritance, high modeling rate, short modeling time, and simple operation. Experimental verification of the constructed systemic lupus erythematosus mouse model found that the mouse model has the pathological characteristics and phenotype of systemic lupus erythematosus and can be used in the screening of therapeutic drugs for systemic lupus erythematosus.

[0049] (4) The novel systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations (p.T214I, p.K322X) constructed using the construction method provided by the present invention provides a good visual animal model for in-depth exploration of the pathogenic mechanism of systemic lupus erythematosus, high-throughput screening of systemic lupus erythematosus prevention and treatment drugs, exploration of gene therapy methods and feasibility, and screening of candidate drugs for the treatment and / or prevention of systemic lupus erythematosus. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Sanger sequencing results were used to genotype mice with compound heterozygous mutations in Rasgrp1 (p.T214I, p.K322X);

[0051] Figure 2 The results of antinuclear antibody (ANA) tests are shown in Figure A, where ANA concentration is detected by Elisa; Figure B, where ANA is detected by Hep2 cells; ANA antibody concentrations in compound heterozygous mutant mice are higher than those in wild-type mice, indicating autoimmunity. CHE refers to compound heterozygous mutant mice constructed by the present invention.

[0052] Figure 3 is the result of anti-ds-DNA antibody detection. The concentration of ds-DNA antibodies in compound heterozygous mutant mice is higher than that in wild type, indicating autoimmunity. Wherein, CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0053] Figure 4 The urine protein concentration is measured. A higher urine protein concentration in compound heterozygous mutant mice than in wild-type mice indicates kidney damage. CHE refers to compound heterozygous mutant mice constructed by the present invention.

[0054] Figure 5 The spleen morphology observation result shows that the spleen of compound heterozygous mutant mice is significantly larger than that of wild type, indicating autoimmunity, wherein CHE refers to the compound heterozygous mutant mice constructed by the present invention;

[0055] Figure 6 The results of spleen histological observations show that the spleen structure of normal mice is clear, without hyperplasia and germinal center formation, while the splenic white pulp of compound heterozygous mutant mice is diffusely hyperplastic, with fibrous thickening of the central artery wall and germinal center formation, suggesting autoimmunity. CHE refers to the compound heterozygous mutant mice constructed by the present invention.

[0056] Figure 7 The figure shows the result corresponding to the immune complex deposition in the kidney. Normal mice have no immune complex deposition, while mutant mice have a large amount of immune complex deposition. Among them, CHE refers to the compound heterozygous mutant mouse constructed by the present invention. DETAILED DESCRIPTION

[0057] The present invention will be further described below with reference to specific embodiments. The specific embodiments are intended only to explain the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and intent of the present invention. The scope of the present invention is defined by the claims and their equivalents.

[0058] The reagents and raw materials used in the present invention are readily available to those skilled in the art and, unless otherwise specified, can be obtained from commercial sources. Experimental methods not specifying specific conditions in the present invention are generally carried out under conventional conditions or conditions recommended by the manufacturer. In particular, the following examples are only used to illustrate the present invention and should not be construed to limit the scope of the present invention in any way.

[0059] Example 1 Preparation of mice with compound heterozygous Rasgrp1 mutations (p.T214I, p.K322X)

[0060] 1. Experimental Materials

[0061] C57BL / 6J mice: Saiye Biotechnology Co., Ltd.; Cas9 mRNA: Thermo Fisher Scientific, USA (A29378).

[0062] 2. Experimental methods

[0063] (1) Preparation of sgRNA and Cas mRNA: Obtain the sequence of the target gene through an online database (such as NCBI). The target sequence (20 bp) of the target gene can be analyzed using the online sgRNA design platform (https: / / design.synthego.com / # / ), and targets with high editing efficiency scores and low off-target scores can be selected. The full-length sgRNA sequence is obtained by chemical synthesis, and Cas9 mRNA is purchased from the company;

[0064] p.T214I site sgRNA sequence: GAAGGACTTGAACTCAAGGTAGG (SEQ ID NO: 1);

[0065] p.K322X site sgRNA sequence: TGTCCCACATGAGATCAATAAGG (SEQ ID NO: 2).

[0066] (2) Prepare sgRNA / Cas9 microinjection solution (sgRNA / Cas9 microinjection solution for p.T214I site and sgRNA / Cas9 microinjection solution for p.K322X site respectively): Use RNase-free TE-buffer to mix sgRNA and Cas9 (Cas9: 25 ng / μL; sgRNA: 12.5 ng / μL).

[0067] (3) Obtaining fertilized eggs: The embryo donor female mouse was superovulated (intraperitoneal injection of PMSG 20 IU / mouse, followed by intraperitoneal injection of HCG 30 IU / mouse 48 hours later), and the fertilized eggs were obtained after being placed in the same cage with the male mouse.

[0068] (4) Prepare pseudo-pregnant female mice: Select healthy female mice and place them in a cage with sterilized male mice.

[0069] (5) Microinjection of sgRNA / Cas9 into fertilized eggs: sgRNA / Cas9 microinjection solution targeting the p.T214I site and sgRNA / Cas9 microinjection solution targeting the p.K322X site were injected into different fertilized eggs respectively.

[0070] (6) The fertilized eggs were transplanted into pseudo-pregnant female mice to obtain offspring: The two different fertilized eggs obtained above were transplanted into pseudo-pregnant female mice to obtain offspring p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice, respectively.

[0071] (7) Mouse genotype identification:

[0072] 1) Design of PCR primers

[0073] p.T214I site primer

[0074] Forward primer (F1): 5'-ACTGACTCTTGTTTTCTTCTCCCTT-3' (SEQ ID NO: 3);

[0075] Reverse primer (R1): 5'-CCATAGCTTGATAGGCTGAGTGAAT-3' (SEQ ID NO: 4).

[0076] p.K322X site primers

[0077] Forward primer (F1): 5'-TCTGCTGTCGTCTGTCCTATGTAT-3' (SEQ ID NO: 5);

[0078] Reverse primer (R1): 5'-TCTAAAGTGAGGAGAGCTGGGTA-3' (SEQ ID NO: 6).

[0079] 2) PCR amplification

[0080] 3) Sanger sequencing

[0081] (8) The p.T214I site heterozygous mutant mice are mated with males and females, and the p.K322X site heterozygous mutant mice are mated with males and females to obtain p.T214I site homozygous mutant mice and p.K322X site homozygous mutant mice.

[0082] (9) Mice homozygous for the p.T214I mutation were crossed with mice homozygous for the p.K322X mutation, and all offspring were double-mutant mice.

[0083] 3. Experimental results

[0084] The genotype of mice with compound heterozygous mutations in Rasgrp1 (p.T214I, p.K322X) was determined by Sanger sequencing. Figure 1 As shown, p.T214I corresponds to c.641C>T, and p.K322X corresponds to c.964A>T. The results show that Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mice were successfully constructed.

[0085] Example 2 Identification of lupus phenotype in the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mouse model constructed in Example 1

[0086] 1. Experimental Materials

[0087] ANA test: Shanghai ELISA Cat#ml002245;

[0088] Urine protein test: Jiangcai Biotechnology Cat# JL-T0030;

[0089] 4% paraformaldehyde: Biyuntian P0099;

[0090] Hematoxylin and eosin staining kit: Biotech C0105S.

[0091] 2. Experimental methods

[0092] (1) Elisa method for ANA detection

[0093] 1) The kit should be taken out of the refrigerated environment and equilibrated at room temperature for 15-30 minutes, and the standard wells and sample wells should be designed.

[0094] Before use, mix all reagents thoroughly. Do not allow the liquid to produce a large amount of foam, so as to avoid adding a large number of bubbles when adding samples, which may cause errors in adding samples.

[0095] 2) Adding standards, samples, and blank wells: Add 50 μL of standards of different concentrations to each standard well; blank wells (blank control wells do not add samples or enzyme-labeled reagents, and all other steps are the same); test sample wells: dilute the sample 1:5 with specimen diluent and add 50 μL to the reaction wells.

[0096] 3) Add the sample to the bottom of the ELISA plate well, avoiding touching the well wall as much as possible, and gently shake to mix.

[0097] 4) Immediately add 50 μL of biotinylated antibody, cover the plate, gently shake to mix, and incubate at 37°C for 1 hour.

[0098] 5) Washing: Carefully remove the sealing film, discard the liquid, spin dry, fill each well with washing solution, shake for 30 seconds, then spin dry, repeat 3-5 times, and pat dry.

[0099] 6) Add 50 μL each of substrate A and substrate B to each well, gently shake to mix, and incubate at 37°C in the dark for 15 minutes.

[0100] 7) Termination: Add 50 μL of stop solution to each well to terminate the reaction (the blue color immediately turns yellow). The results should be measured immediately after adding the stop solution.

[0101] 8) Measurement: Use the blank well as the zero setting and measure the absorbance (OD) of each well at 450 nm. The measurement should be performed within 15 minutes after adding the stop solution.

[0102] (2) Hep2 ANA detection

[0103] 1) Preparation: Remove the Hep2 antigen slide and wait for it to return to an ambient temperature of 18°C-25°C before opening the package. Dissolve one bag of PBS powder for washing in purified water to 1 L, add one tube of Tween, and mix thoroughly. Use for washing and specimen dilution.

[0104] 2) Dilution: Dilute the serum to be tested 1:100 with washing buffer.

[0105] 3) Sample addition: Add diluted serum or positive and negative controls to the reaction wells of the inverted plate at 25 μL / well. Avoid creating bubbles when adding samples.

[0106] 4) Incubation: Place the antigen sheet in the corresponding groove of the inverted plate and incubate at an ambient temperature of 18°C ​​to 25°C for 30 minutes to ensure that each specimen is in contact with the antigen matrix and that the specimens do not contact each other.

[0107] 5) Washing: Take out the antigen piece, gently rinse off the reaction solution from one side with washing solution, soak it in washing solution, let it stand for 5 minutes, and then rinse it once with purified water.

[0108] 6) Sample addition: Add ANA fluorescent secondary antibody to the reaction wells of the inverted plate at 25 μL / well. Avoid creating bubbles when adding samples.

[0109] 7) Incubation: After wiping off excess liquid around and on the reverse side of the antigen piece with paper, place the antigen piece in the corresponding groove and incubate at an ambient temperature of 18°C-25°C for 30 minutes to ensure that each specimen is in contact with the antigen matrix and that the specimens do not come into contact with each other.

[0110] 8) Washing: Repeat step 5) above.

[0111] 9) Sealing: After wiping the excess liquid around and on the back of the antigen piece with paper, add sealing agent to the reaction well of the antigen piece and place the cover slip on the antigen piece to complete the sealing.

[0112] 10) Observation of results: The results were photographed under a confocal microscope.

[0113] (3) Elisa method for dsDNA detection

[0114] 1) Equilibrate all reagents to room temperature for at least 30 minutes.

[0115] 2) Prepare working wash solution: Dilute the stock solution 100-fold with ddH2O.

[0116] 3) Prepare working sample diluent (WSD): dilute the stock solution 20-fold with ddH2O.

[0117] 4) Prepare anti-mouse Ig-HRP conjugate: dilute 100-fold with WSD solution and use immediately.

[0118] 5) Prepare serum and dilute it 1:100 with Low NSB Sample Diluent (LNSD). All samples must be diluted in the same diluent for proper comparison.

[0119] 6) Add 200 μL of working wash solution to the well plate and let it sit for 5 minutes. Before adding the sample, spin off the liquid and pat dry on a paper towel.

[0120] 7) Design the sample loading and set up a blank well for sample wash solution, with Blank OD < 0.3.

[0121] 8) First Incubation: Add 100 μL of standard, sample, and blank sample wash buffer to the pre-designated wells of the plate. Tap the plate to mix the reagents and incubate for 60 minutes. Wash the plate four times and pat dry with a fresh paper towel.

[0122] 9) Second incubation: Add 100 μL of diluted anti-mouse Ig HRP to each well, incubate for 30 min, and wash the plate 5 times.

[0123] 10) Incubate substrate: Add 100 μL TMB substrate and incubate for 15 min. (If the optical density (OD) recorded by the microplate reader is not higher than 2.0, shorten the incubation time or read the OD at 405-410 nm for valid results.)

[0124] 11) Stop reaction: Add 100 μL of stop solution to each well and tap gently to mix. The enzyme reaction will stop and the liquid in the well will turn yellow.

[0125] 12) Within 30 minutes, detect the absorbance at a wavelength of 450 nm.

[0126] (4) Urine protein test

[0127] 1) Preparation of CBB application solution: CBB reagent is prepared at a ratio of 1:4, i.e., 5-fold dilution.

[0128] 2) Add 500 μL of sample, standard distilled water, and 3 mL of CBB application solution to the sample group, standard group, and blank group, respectively.

[0129] 3) Mix thoroughly, let stand for 5 minutes, and measure the absorbance of each tube at a wavelength of 595 nm and an optical path of 1 cm. Adjust the zero value with double water.

[0130] (5) HE staining of kidney and spleen

[0131] 1) Mice were sacrificed by cervical dislocation, and spleen tissue was obtained and fixed in 4% paraformaldehyde at 4°C for 48 hours.

[0132] 2) The tissue was removed and fixed, and dehydrated with 30% sucrose solution at 4°C for 12 hours until the tissue sank.

[0133] 3) Embed in paraffin and cut into sections with a thickness of 4 μm using a paraffin microtome.

[0134] 4) Dewax paraffin sections and place in water: Xylene I and II for 15 min each → 100% ethanol I and II → 95% ethanol I and II → 80% ethanol → 70% ethanol → 50% ethanol for 1-2 min each.

[0135] 5) Washing: Wash twice with ordinary water and once with distilled water.

[0136] 6) Stain with hematoxylin for 10 min and wash with tap water for 10 min.

[0137] 7) Hydrochloric acid-ethanol color separation: Separate for 10-30 seconds. Check the degree of color separation at any time. When the nucleus is dark blue and the cytoplasm is colorless or light gray, wash with tap water for 10 minutes.

[0138] 8) Bluing with ammonia water for 2-3 minutes, then washing with tap water for 10 minutes.

[0139] 9) Dehydration: 70% and 80% alcohol for 1-2 minutes each.

[0140] 10) Stain with eosin for 1-3 minutes, observe under a microscope at any time, and wash with distilled water for 5 minutes.

[0141] 11) Dehydration and transparency: 95% alcohol I and II for 1-2 minutes each → 100% alcohol I and II for 15 minutes each → xylene I and II for 15 minutes each.

[0142] 12) Seal the slides with neutral gum and collect images under an optical microscope.

[0143] (6) Kidney immune complex deposition

[0144] 1) Take fresh kidney tissue from mice, immerse it in PBS, and place it on ice.

[0145] 2) Fix with 2 mL of 4% PFA at 4°C for 24 hours.

[0146] 3) Dehydrate with 1-2 mL of 30% sucrose solution at 4°C for 12-16 hours until the tissue sinks.

[0147] 4) Aspirate dry water, place the tissue in a suitable container, and add OCT embedding medium.

[0148] 5) Place the embedding cassette in liquid nitrogen for quick freezing, and store the embedded tissue block in a -80°C refrigerator.

[0149] 6) Adjust the freezing microtome temperature to -15°C.

[0150] 7) Take the tissue block out from -80°C and equilibrate it in the cabinet for 30 minutes.

[0151] 8) Take out the specimen tray and place it at room temperature. Fix the tissue block in the specimen tray with OCT.

[0152] 9) The slices were sliced ​​to a thickness of 6 μm and were adsorbed onto a glass slide at room temperature.

[0153] 10) Rinse the OCT with PBS.

[0154] 11) Add 4% PFA for fixation at room temperature for 15 minutes, and rinse three times with PBS.

[0155] 12) Allow to dry for 15-30 minutes and circle the tissue with a tissue pen.

[0156] 13) Block with 0.5% BSA at 20-22°C for 1 hour.

[0157] 14) Add FITC-anti-mouse IgG diluted 1:500 in PBS, just enough to cover the tissue (usually 25–50 μL). Incubate in a humidified chamber at room temperature in the dark for 30 minutes.

[0158] 15) Wash three times with PBS.

[0159] 16) Add 2 drops of mounting medium to the edge of the tissue, cover with a glass slide, remove bubbles and excess liquid, and let dry at room temperature.

[0160] 3. Experimental results

[0161] Antinuclear antibody (ANA) test results Figure 2 As shown, the results showed that the ANA antibody concentration of the compound heterozygous mutant mice constructed in Example 1 of the present invention was higher than that of the wild type, indicating autoimmunity.

[0162] Anti-ds-DNA antibody test results Figure 3 As shown, the results showed that the concentration of ds-DNA antibodies in the composite heterozygous mutant mice constructed in Example 1 of the present invention was higher than that in the wild type, indicating autoimmunity.

[0163] Urine protein concentration test results Figure 4 As shown, the results showed that the urine protein concentration of the compound heterozygous mutant mice constructed in Example 1 of the present invention was higher than that of the wild type, indicating kidney damage.

[0164] The morphological observation results of spleen Figure 5 As shown, the results showed that the spleen of the compound heterozygous mutant mouse constructed in Example 1 of the present invention was significantly larger than that of the wild type, suggesting autoimmunity.

[0165] The results of spleen histological observation were as follows Figure 6 As shown, the results showed that the spleen of normal mice had a clear structure, without hyperplasia and germinal center formation, while the composite heterozygous mutant mice constructed in Example 1 of the present invention had diffuse hyperplasia of the spleen white pulp, fibrous thickening of the central artery wall, and germinal center formation, suggesting autoimmunity.

[0166] Kidney immune complex deposition results such as Figure 7 As shown, the results showed that normal mice had no immune complex deposition, while the compound heterozygous mutant mice constructed in Example 1 of the present invention had a large amount of immune complex deposition.

[0167] The above results demonstrate that the Rasgrp1 compound heterozygous mutation (p.T214I, p.K322X) mouse model constructed in Example 1 of the present invention is a systemic lupus erythematosus mouse model.

[0168] The above is a further detailed description of the present invention in conjunction with specific preferred embodiments, and the specific implementation of the present invention should not be considered to be limited to these descriptions. For those skilled in the art to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all of these should be considered to fall within the scope of protection of the present invention.

Claims

1. A method for constructing a systemic lupus erythematosus mouse model carrying Rasgrp1 compound heterozygous mutations p.T214I and p.K322X, characterized in that: The method comprises the following steps: (1) Designing sgRNA sequences that recognize the p.T214I site and the p.K322X site, respectively; (2) preparing sgRNA / Cas9 injection solutions respectively, and injecting the sgRNA / Cas9 injection solutions into mouse fertilized eggs respectively; (3) The resulting fertilized eggs were transplanted into pseudopregnant female mice to obtain p.T214I heterozygous mutant mice and p.K322X heterozygous mutant mice; (4) mating the p.T214I heterozygous mutant mice and mating the p.K322X heterozygous mutant mice to obtain p.T214I homozygous mutant mice and p.K322X homozygous mutant mice; (5) hybridizing the p.T214I homozygous mutant mice with the p.K322X homozygous mutant mice to obtain a systemic lupus erythematosus mouse model carrying the Rasgrp1 compound heterozygous mutations p.T214I and p.K322X; The sgRNA sequence that recognizes the p.T214I site is shown in SEQ ID NO: 1; The sgRNA sequence that recognizes the p.K322X site is shown in SEQ ID NO: 2; The gene mutation site corresponding to the p.T214I site is c.641C>T; The gene mutation site corresponding to the p.K322X site is c.964A>T.

2. The method according to claim 1, characterized in that The contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution are (8.0-15.0) ng / μL and (10-40) ng / μL, respectively.

3. The method according to claim 2, characterized in that The contents of the sgRNA and Cas9 mRNA in the sgRNA / Cas9 injection solution are 12.5 ng / μL and 25 ng / μL, respectively.

Citation Information

Patent Citations

  • Construction method of animal model of systemic lupus erythematosus

    CN118703569A

  • Compositions and methods of treating systemic lupus erythematosus

    WO2020101880A1