CRISPR detection system and application thereof

Abstract

The invention discloses a CRISPR detection system and application thereof. The CRISPR detection system comprises a CRISPR / Cas reaction system and a target gene amplification system, and the CRISPR detection system further comprises a protective nucleic acid sequence and a destroying component for protecting the nucleic acid sequence. The CIRSPR detection steps are controllable, a CRISPR detection system and an amplification system are integrated in one system, the detection efficiency is improved, the cost is low, the operation is relatively simple, and the application range is wide.

Description

Technical Field

[0001] The present disclosure relates to the field of molecular biomedicine, and in particular to a CRISPR detection system and its application. Background Art

[0002] Since humans first realized that DNA is a genetic material in 1928, research on RNA and DNA has never stopped. In the process of continuous development of medicine and detection technology, people have gradually realized that the detection of DNA and RNA is an essential tool and key step in achieving precision medicine. Through the detection and analysis of nucleic acids, researchers can understand the pathogenic mechanism of many genetic diseases, which can be used to distinguish the specific types of cancer and can also be used for the diagnosis of infectious diseases.

[0003] In 2012, people discovered the potential of CRISPR technology for gene editing. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a repetitive sequence in the genome of prokaryotes. It is an immune weapon produced by the struggle between bacteria and viruses in the history of life evolution. Simply put, viruses can integrate their genes into bacteria and use bacterial cell tools to replicate their own genes. In order to remove the foreign invading genes of viruses, bacteria have evolved the CRISPR system. Using this system, bacteria can quietly remove viral genes from their genomes. This is a unique immune system of bacteria and an acquired immune system that archaea and bacteria use to resist the invasion of foreign genetic materials such as viruses. Later, CRISPR technology was confirmed to be used in the field of nucleic acid detection, and more specific detection tools for different types of nucleic acids were discovered. However, there are still many shortcomings in the application of CRISPR-Cas platform in the field of detection: ① The CRISPR detection system requires the preparation of RNP complex in advance, and the reaction proceeds immediately after the addition of DNA, and the process is uncontrollable; ② CRISPR molecular detection is divided into two stages, the amplification stage and the detection stage. The amplification stage has mutual influences and is difficult to integrate into a single system, which affects the application potential of the platform for rapid detection. Summary of the invention

[0004] The following is a summary of the subject matter described in detail herein. This summary is not intended to limit the scope of the claims.

[0005] The disclosed embodiments provide a CRISPR detection system, including a CRISPR / Cas reaction system and a target gene amplification system, wherein the CRISPR detection system also includes a protective nucleic acid sequence and a destructive component of the protective nucleic acid sequence.

[0006] In some exemplary embodiments, the CRISPR detection system includes an sgRNA that recognizes a target sequence, and the protective nucleic acid sequence includes a DNA sequence that is at least partially complementary to the sgRNA; the destructive component of the protective nucleic acid sequence includes a double-stranded specific nuclease.

[0007] In some exemplary embodiments, the DNA sequence is at least 30% complementary to the sequence of the sgRNA.

[0008] In some exemplary embodiments, the DNA sequence is at least 30% complementary, 31% complementary, 32% complementary, 33% complementary, 34% complementary, 35% complementary, 36% complementary, 37% complementary, 38% complementary, 39% complementary, 40% complementary, 41% complementary, 42% complementary, 43% complementary, 44% complementary, 45% complementary, 46% complementary, 47% complementary, 48% complementary, 49% complementary, 50% complementary, 51% complementary, 52% complementary, 53% complementary, 54% complementary, 55% complementary, 56% complementary, 57% complementary, 58% complementary, 59% complementary, 60% complementary, 61% complementary, 62% complementary to the sequence of the sgRNA , 63% complementary, 64% complementary, 65% complementary, 66% complementary, 67% complementary, 68% complementary, 69% complementary, 70% complementary, 71% complementary, 72% complementary, 73% complementary, 74% complementary, 75% complementary, 76% complementary, 77% complementary, 78% complementary, 79% complementary, 80% complementary, 81% complementary, 82% complementary, 83% complementary, 84% complementary, 85% complementary, 86% complementary, 87% complementary, 88% complementary, 89% complementary, 90% complementary, 91% complementary, 92% complementary, 93% complementary, 94% complementary, 95% complementary, 96% complementary, 97% complementary, 98% complementary, 99% complementary, and 100% complementary.

[0009] In some exemplary embodiments, the CRISPR detection system further comprises a Cas enzyme, specific primers for amplifying the target sequence, a DNA polymerase, a detection probe and a reaction mixture; wherein the Cas enzyme is selected from any one or more of Cas12a, Cas12b, homologs thereof, or modified forms thereof.

[0010] In some exemplary embodiments, the Cas enzyme is a Cas12a enzyme.

[0011] In some exemplary embodiments, the target gene amplification system is a constant temperature amplification system.

[0012] In some exemplary embodiments, the isothermal amplification system is any one or more of RAA amplification, RPA amplification, LAMP amplification, and their variant systems.

[0013] In some exemplary embodiments, the detection probe carries any one or more of a FAM label, a HEX label, a VIC label, and a ROX label.

[0014] In some exemplary embodiments, the reaction temperature of the RAA amplification, RPA amplification and LAMP amplification ranges from 10°C to 65°C.

[0015] In some exemplary embodiments, the RPA reaction temperature is between 16°C and 45°C; preferably between 37°C and 42°C.

[0016] In some exemplary embodiments, the LAMP reaction temperature is between 37°C-65°C; preferably about 65°C.

[0017] In some exemplary embodiments, the RAA reaction temperature is between 30°C and 42°C; preferably between 37°C and 39°C.

[0018] In some exemplary embodiments, the double-stranded specific nuclease is added after the RAA amplification, RPA amplification and LAMP amplification are performed for 1-15 minutes, preferably 3-12 minutes, more preferably 5-10 minutes.

[0019] The disclosed embodiments also provide a CRISPR detection kit, which includes the components of the above-mentioned CRISPR detection system.

[0020] The present disclosure also provides a method for controllable CRISPR detection, which uses the components of the above-mentioned CRISPR detection system or the above-mentioned CRISPR detection kit, and includes the following steps:

[0021] Mixing the components of the CRISPR detection system, wherein the components of the CRISPR detection system include: Cas12a enzyme, sgRNA, a DNA sequence at least partially complementary to the sgRNA, upstream and downstream primers required for the isothermal amplification reaction, a detection probe, and a reaction mixture;

[0022] Add DNA template and amplify the target gene. The reaction temperature is 16℃-65℃ and the reaction time is 5-10min.

[0023] Adding double-stranded specific nuclease DSN and a reaction mixture to the CRISPR detection system;

[0024] After thorough mixing, the reaction system was placed at 25°C-37°C, and then a fluorescence quantitative PCR instrument was used to observe changes in the fluorescence signal.

[0025] The disclosed embodiments also provide an application of a CRISPR nucleic acid detection method, wherein the components of the aforementioned CRISPR detection system, the aforementioned CRISPR detection kit, or the aforementioned CRISPR detection controllable method are applied to the detection of single-stranded DNA or double-stranded DNA, and the application is for non-diagnostic purposes.

[0026] In some exemplary embodiments, the gene detection of monkeypox virus includes using the components of the above-mentioned CRISPR detection system, the above-mentioned CRISPR detection kit or the above-mentioned CRISPR detection controllable method, wherein:

[0027] The upstream primer required for the isothermal amplification reaction is SEQ ID No. 2, and the downstream primer is SEQ ID No. 3;

[0028] sgRNA is SEQ ID No. 4;

[0029] The DNA sequence complementary to the sgRNA is SEQ ID No. 5;

[0030] The detection probe is FAM-TTTATT-BHQ1.

[0031] Compared with the prior art, the present invention makes the CRISPR detection step controllable, and integrates the CRISPR detection system and amplification systems such as RPA / LAMP into one system, thereby improving the detection efficiency. This scheme can be applied to any step of in vitro CRISPR reaction, thereby controlling the starting time of the cleavage activity of the Cas enzyme. The method has low cost and relatively simple operation, and has a wide range of applications.

[0032] Other aspects will be apparent upon reading and understanding the drawings and detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings are used to provide a further understanding of the technical solution of the present disclosure and constitute a part of the specification. Together with the embodiments of the present disclosure, they are used to explain the technical solution of the present disclosure and do not constitute a limitation on the technical solution of the present disclosure. The shape and size of one or more modules in the accompanying drawings do not reflect the actual proportions and are only intended to illustrate the contents of the present disclosure.

[0034] Figure 1 An exemplary sgRNA of the present disclosure and its complementary DNA sequence and the structure of the Cas12a enzyme are shown.

[0035] Figure 2 The structure of an exemplary sgRNA and Cas12a enzyme complex of the present disclosure is shown.

[0036] Figure 3 An exemplary amplification curve graph of the present disclosure is shown.

[0037] Figure 4 Exemplary amplification curves of the system with added DSN and the system without added DSN of the present disclosure are shown.

[0038] Figure 5 Exemplary amplification curves of the systems of the present disclosure with and without the gene of interest are shown. DETAILED DESCRIPTION

[0039] In order to make the purpose, technical solution and advantages of the present disclosure more clear, the embodiments of the present disclosure will be described in detail below. It should be noted that the embodiments and features in the embodiments of the present disclosure can be combined with each other arbitrarily without conflict.

[0040] The embodiments of the present disclosure will be described in detail below in conjunction with the accompanying drawings. The embodiments can be implemented in a plurality of different forms. A person skilled in the art can easily understand the fact that the method and content can be transformed into one or more forms without departing from the purpose and scope of the present disclosure. Therefore, the present disclosure should not be interpreted as being limited to the contents described in the following embodiments. In the absence of conflict, the embodiments in the present disclosure and the features in the embodiments can be combined with each other arbitrarily.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those of ordinary skill in the art to which the present disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used to practice or test the present disclosure, preferred methods and materials are described. For purposes of the present disclosure, the following terms are defined hereinafter.

[0042] In this application, the use of the singular includes the plural unless expressly stated otherwise. It must be noted that, as used in this specification, the singular forms "a", "an", and "the" include plural references unless the context clearly indicates otherwise. In this application, the use of "or" means "and / or" unless otherwise stated.

[0043] The term "about" or "approximately" means within an acceptable error range of a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation according to the practice in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a particular value. In other examples, an amount of "about 10" includes 10 and any amount from 9 to 11.

[0044] In yet other examples, the term "about" in reference to a reference value may also include a range of values ​​that are plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% of that value. Alternatively, particularly with respect to biological systems or processes, the term "about" may mean within an order of magnitude of a value. When describing a particular value in the application and claims, unless otherwise indicated, the term "about" should be assumed to mean within an acceptable error range for the particular value.

[0045] As used in this specification and in one or more claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of "containing", such as "contains" and "contain") are inclusive or open-ended, and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with reference to any method or combination of the present disclosure, and vice versa. In addition, combinations of the present disclosure can be used to implement methods of the present disclosure.

[0046] "Genome" when applied to eukaryotic cells encompasses not only the chromosomal DNA present in the nucleus, but also the organellar DNA present in subcellular components of the cell (eg, mitochondria, plastids).

[0047] "Exogenous" with respect to a sequence refers to a sequence that is from a foreign species, or, if from the same species, a sequence that has been significantly altered in composition and / or locus from its native form through deliberate human intervention.

[0048] "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally may contain synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0049] "Gene editing", also known as genome editing, uses engineered nucleases or "molecular scissors" to insert, delete or replace DNA in the genome of an organism. Gene editing causes site-specific double-strand breaks (DSBs) at the desired location in the genome, and then introduces the desired DNA insertion, deletion or substitution during the repair of the DSB. Gene editing typically uses large-range nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and CRISPR systems.

[0050] "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)" are prokaryotic DNA segments containing short, repetitive sequences. The CRISPR system is a prokaryotic immune system that confers resistance to foreign genetic elements, such as those present in plasmids and bacteriophages, which provides acquired immunity. In this system, Cas proteins or similar proteins cut foreign nucleic acids under the guidance of RNA.

[0051] As used herein, the term "CRISPR nuclease" generally refers to a nuclease present in a naturally occurring CRISPR system, as well as a modified form thereof, a variant thereof (including a nickase mutant), or a catalytically active fragment thereof. CRISPR nucleases can recognize and / or cut target nucleic acid structures by interacting with guide RNAs (e.g., crRNA and optional tracrRNA or artificial gRNAs (e.g., sgRNA)). The term encompasses any nuclease that can achieve gene editing in cells based on a CRISPR system.

[0052] "Cas12a nuclease" and "Cas12a" are used interchangeably herein and refer to an RNA-guided nuclease comprising a Cas12a protein or a fragment thereof (e.g., a protein comprising an active DNA cleavage domain of Cas12a and / or a gRNA binding domain of Cas12a). Cas12a is a component of the CRISPR / Cas (clustered regularly interspaced short palindromic repeats and related systems) genome editing system that can target and cut a DNA target sequence to form a DNA double-strand break (DSB) under the guidance of a guide RNA.

[0053] "Guide RNA" and "gRNA" are used interchangeably herein, and are generally composed of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein the crRNA comprises a sequence that is sufficiently complementary to the target sequence to hybridize with the target sequence and guide the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed that contains features of both crRNA and tracrRNA.

[0054] Details

[0055] CRISPR / Cas system

[0056] The CRISPR / Cas system is a nuclease system composed of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR binding proteins (i.e., Cas proteins), which can cut almost all genomic sequences adjacent to the protospacer-adjacent motif (PAM) in eukaryotic cells (Cong et al. Science 2013. 339: 819-823). "CRISPR / Cas system" is used to collectively refer to transcripts involving CRISPR-associated ("Cas") genes, and other elements involved in their expression or guiding their activity, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr pairing sequences (in the context of endogenous CRISPR systems, covering "direct repeats" and processed partial direct repeats), guide sequences, or other sequences and transcripts from CRISPR loci. In general, CRISPR systems are characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also called a protospacer in endogenous CRISPR systems).

[0057] Formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs of) the target sequence. The tracr sequence (which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence)) can also form part of a CRISPR complex, such as by hybridizing along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence operably linked to the guide sequence.

[0058] Non-limiting examples of Cas proteins include: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a (also known as Cpf1), Cas12b, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa 5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified forms thereof. In some embodiments, the Cas protein is a Cas12a protein.

[0059] Cas12a nuclease (also known as Cpf1) is an RNA-mediated endonuclease that can specifically cut the target double-stranded DNA in the presence of PAM in the target DNA. Unlike Cas9: (1) Cas12a only requires a single crRNA, is smaller in size, and is easier to deliver into cells; (2) Cas12a produces sticky ends after cutting, which is more conducive to precise genome editing; (3) The cutting site of Cas12a is far away from its recognition site, which provides the possibility of continuous multiple editing; (4) The PAM sequence recognized by Cas12a is different from that of Cas9, thus providing different editing site options; for different Cas12a proteins, the PAM sites required for target recognition are different, among which some Cas12a proteins recognize TTN sites and some Cas12a proteins recognize TTTN sites.

[0060] Cas12a recognizes dsDNA containing PAM under the guidance of crRNA, and then promotes the unwinding of target dsDNA. The target chain (TS) in the unwinding target dsDNA forms Rloop with crRNA, thereby releasing the active site of RuvC in Cas12a; and the non-target chain (NTS) in the target dsDNA just unwinding will be cut by RuvC in the released active site at this time; the result of this cutting causes the unwinding of the target DNA, and the TS of the released target dsDNA is cut by RuvC; when Cas12a completes the cutting of TS and NTS in the target dsDNA (cis cutting), dsDNA will be released, and the active site of RuvC with space left at this time will be cut (trans cutting) once ssDNA enters.

[0061] Cas12b, also known as C2C1, recognizes the PAM site TTN under the guidance of crRNA and tracrRNA and cuts the target dsDNA.

[0062] Cas13a, also known as C2C2, recognizes and cuts target ssRNA under the guidance of crRNA. Similar to Cas12a, it has the ability to non-specifically cut ssRNA of any sequence in the system.

[0063] Cas14 is a very small nuclease, about half the size of other family proteins. Cas14a can recognize and cut target ssDNA in a form that is independent of the PAM site. It can be used for ssDNA detection.

[0064] Guide RNA

[0065] In one aspect, the RNA component contained in CRISPR is sometimes referred to as a guide RNA (gRNA). The guide RNA generally comprises a guide sequence and a backbone sequence, and these two sequences can be in the same molecule or in different molecules.

[0066] Example 1

[0067] In this embodiment, a completely complementary DNA sequence of sgRNA is added to the CRISPR detection system to form a DNA-RNA hybrid double strand (see Figure 1 ), so sgRNA cannot self-assemble with Cas12a enzyme, that is, in this case, the target gene cannot be cut. When the current technical solution is used, the DNA template (target gene) for RAA / RPA / LAMP amplification reaction will not be affected by the CRISPR system cutting, and the amplification reaction can be carried out normally; at this time, Cas12a enzyme is added to the system (see Figure 1), sgRNA, DNA sequence completely complementary to sgRNA, upstream and downstream primers required for isothermal amplification reaction (RAA / RPA / LAMP), detection probe (FAM / HEX / VIC / ROX labeling), reaction mixture (providing components and reaction environment required for amplification); after adding DNA template, the reaction can be carried out, and the reaction temperature is 16℃-45℃; after a period of amplification reaction (5-10min), double-stranded specific nuclease (DSN) is added to the system. DSN can specifically degrade double-stranded DNA and DNA in DNA-RNA hybrids, and has almost no activity on single-stranded nucleic acid molecules and double-stranded RNA; after adding DSN, the double-stranded chain composed of sgRNA and DNA will be destroyed, the DNA in the hybrid chain will be degraded, and the fluorescent probe DNA in sgRNA and substrate will not be destroyed; after adding DSN, sgRNA can be reassembled with Cas12 enzyme to form RNP (see Figure 2 ), at which point the amplification reaction is complete, the DNA template is fully amplified, CRISPR detection begins, and because the target DNA is fully amplified, the efficiency is increased, and the fluorescent signal can be detected within 1 minute to 35 minutes (see Figure 3 ).

[0068] Example 2

[0069] In the present embodiment, a partial complementary DNA sequence of sgRNA is added to the CRISPR detection system to form a DNA-RNA hybrid double strand, so sgRNA cannot be self-assembled with Cas12a enzyme, that is, in this case, the target gene cannot be cut. When the current technical solution is used, the DNA template (target gene) for RAA / RPA / LAMP amplification reaction will not be affected by the CRISPR system cutting, and the amplification reaction can be carried out normally; at this time, Cas12a enzyme, sgRNA, incompletely complementary DNA sequence with sgRNA, upstream and downstream primers required for isothermal amplification reaction (RAA / RPA / LAMP), detection probe (FAM / HEX / VIC / ROX labeling), and reaction mixture (providing components and reaction environment required for amplification) are added to the system; after adding the DNA template, the reaction can be carried out, and the reaction Temperature 16-45°C; After the amplification reaction has been going on for a period of time (5-10 minutes), add double-stranded specific nuclease (DSN) to the system. DSN can specifically degrade double-stranded DNA and DNA in DNA-RNA hybrids, and has almost no activity against single-stranded nucleic acid molecules and double-stranded RNA; After adding DSN, the double-stranded DNA composed of sgRNA and DNA will be destroyed, the DNA in the hybrid chain will be degraded, and the fluorescent probe DNA in sgRNA and substrate will not be destroyed; After adding DSN, sgRNA can reassemble with Cas12 enzyme to form RNP (see Figure 2), at which point the amplification reaction is complete, the DNA template is fully amplified, CRISPR detection begins, and because the target DNA is fully amplified, the efficiency is increased, and the fluorescent signal can be detected within 1 minute to 35 minutes (see Figure 3 ).

[0070] Example 3

[0071] Target: Monkeypox virus

[0072] Target gene sequence (SEQ ID No.1):

[0073] TGTCTACACAGGCATAAAATGTAGGAGAGTTACTAGGCCCCACTGATTCAATACGAAAAGACCAATCTCTCCTAGTTATTTGGCAGTACTCATTAATAACGGTGACAGGGTTAACACCTTTCCAATAAATAATTTTTTTAACCGGAATAACATCATCAAA AGACTTATTATCCTCTCATTGATTTTTCGCGGGATACATCATCTATTATAGCATCAGCATCAGAATCTGTAGGCCGTGTATCAGCATCCATTGTCGTAGACCAACGAGGAGGAGTATCGTCGGAACTGTACACCATAGTACTACGTTGAAGATCATAC

[0074] RPA / RAA upstream primer F:TTACTAGGCCCCACTGATTCAATACGAAAAG (SEQ ID No. 2)

[0075] RPA / RAA downstream primer R: TACTCCTCCTCGTTGGTCTACGACAATGGA (SEQ ID No. 3)

[0076] crRNA / gRNA: (SEQ ID No.4) (The italicized and underlined parts are the complementary matching parts in the gRNA and the template DNA sequence)

[0077] DNA sequence complementary to crRNA / gRNA: CCGTTATTAATGAGTACTGCATCTACACTTAGTAGAAATTA (SEQ ID No. 5)

[0078] Cas nuclease used: Lba Cas12a (New England Biolabs) and corresponding reaction buffer (New England Biolabs)

[0079] RPA reaction system (self-prepared)

[0080] DNS(Evrogen)

[0081] Reporter probe: FAM-TTTATT-BHQ1

[0082] 22-30 μL RPA reaction buffer was added to each dry powder reaction tube, and then RPA upstream primer (1-2 μL, concentration 0.1-1.0 μM), downstream primer (1-2 μL, concentration 0.1-1.0 μM), Cas enzyme reaction system (including 1 μM Cas12a enzyme 1-2 μL, 0.9-1.9 μM gRNA 3-5 μL, 1-3 μM complementary DNA sequence 3-5 μL, Cas enzyme reaction buffer 3-5 μL, mixed in advance at 37°C for 5-30 min), nucleic acid template (1-2 μL, concentration greater than 500 copies / μL) was added to each reaction tube and water was added to make up to 67.5 μL, and then 2.5 μL of magnesium acetate was added, and the reaction was carried out at a constant temperature of 25°C-37°C for 5-15 min; after the amplification reaction, 5-50 μL was taken from the reaction tube and added to 20 μL of DSN reaction system, and the DSN reaction system contained DSN 0.1-2U and 2-4μL of reaction buffer, add water to make up to 20μL, and then place it in a fluorescence quantitative PCR instrument to record the fluorescence changes.

[0083] Test 1: A total of 6 systems were tested, including target genes, primers, RPA reaction system, Cas enzyme, reaction buffer, etc. No DSN was added in the initial state. After the RPA / RAA reaction, 0.2 / 0.3 / 0.4 / 0.5U DNS was added to 4 systems respectively, and an equal volume of enzyme-free water was added to the other two systems. The fluorescence changes of the systems were monitored. The results are as follows: Figure 4 In the systems with 0.2 / 0.3 / 0.4 / 0.5U DNS added, fluorescence changes were detected immediately after adding DNS, and reached a stable state in about 16 minutes, while the fluorescence value of the system without adding DSN did not change significantly.

[0084] Test 2: A total of 4 systems were tested. System A / B contained the target gene, primers, RPA reaction system, Cas enzyme, reaction buffer, etc. The target gene in system C / D was replaced with an equal amount of enzyme-free water, and the other components were the same as A / B. No DSN was added in the initial state. After the RPA / RAA reaction was completed, 0.5U DNS was added to the A / C system respectively, and an equal volume of enzyme-free water was added to the B / D system to monitor the fluorescence changes of the system. The results are as follows Figure 5 , the fluorescence value of system A containing the target gene and adding 0.5U DNS was detected after adding DNS, and reached a stable state in about 20 minutes, while the fluorescence value of system B containing the target gene but without adding DSN and system D without containing the target gene and without adding DSN did not change significantly, and the fluorescence value of system C without adding the target gene but adding DNS also did not change significantly (see Figure 5 ).

[0085] summary:

[0086] In the prior art, the technical solution of integrating the CRISPR detection system and amplification systems such as RPA / LAMP into one system to improve the detection efficiency has the technical problem that the amplification reaction will be affected by the CRISPR detection, that is, the sgRNA to be amplified will self-assemble with the Cas enzyme at room temperature to form ribonucleoprotein RNP. When the target gene is recognized, the RNP complex will cut it; when a specific Cas enzyme (such as Cas12a) is used, while cutting the target gene, it will also initiate its incidental cutting enzyme activity, cut the single-stranded DNA substrate, and affect the amplification of the DNA template (target gene) used for the amplification reaction.

[0087] In order to make the CRISPR detection step controllable, the complementary DNA sequence of sgRNA is added to the CRISPR detection system to form a DNA-RNA hybrid double-stranded chain, so that the sgRNA cannot react with the Cas12a enzyme to self-assemble. After the amplification reaction is completed, double-stranded specific nuclease (DSN) is added to the system to specifically degrade the double-stranded DNA and the DNA in the DNA-RNA hybrid, thereby controlling the starting time of the cutting activity of the Cas enzyme.

[0088] Compared with the prior art, the present invention uses a CRISPR detection system and its detection method or kit to make the CRISPR detection step controllable, and at the same time integrates the CRISPR detection system and amplification systems such as RPA / LAMP into one system and improves the detection efficiency. It can be conveniently applied to any step of in vitro CRISPR reaction to control the starting time of the cleavage activity of the Cas enzyme. The method is low in cost and relatively simple to operate, and has a wide range of applications.

Claims

1. A CRISPR detection system, comprising a CRISPR / Cas reaction system and a target gene amplification system, wherein: The CRISPR detection system also includes a protective nucleic acid sequence and a destructive component of the protective nucleic acid sequence.

2. The CRISPR detection system according to claim 1, wherein: The CRISPR detection system includes an sgRNA that recognizes a target sequence, and the protective nucleic acid sequence includes a DNA sequence that is at least partially complementary to the sgRNA; the destructive component of the protective nucleic acid sequence includes a double-stranded specific nuclease.

3. The CRISPR detection system according to any one of claims 1 to 2, wherein: The CRISPR detection system also includes a Cas enzyme, specific primers for amplifying the target sequence, a DNA polymerase, a detection probe and a reaction mixture; wherein the Cas enzyme is selected from any one or more of Cas12a, Cas12b, their homologues, or their modified forms.

4. The CRISPR detection system according to claim 3, wherein: The Cas enzyme is a Cas12a enzyme.

5. The CRISPR detection system according to claim 1, wherein: The target gene amplification system is a constant temperature amplification system.

6. The CRISPR detection system according to claim 5, wherein: The isothermal amplification system is any one or more of RAA amplification, RPA amplification, LAMP amplification and their variant systems.

7. A CRISPR detection kit, comprising the components of the CRISPR detection system described in claims 1 to 6.

8. A method for controllable CRISPR detection, the method using the components of the CRISPR detection system according to any one of claims 1 to 6 or the CRISPR detection kit according to claim 7, comprising the following steps: Mixing the components of the CRISPR detection system, wherein the components of the CRISPR detection system include: Cas12a enzyme, sgRNA, a DNA sequence at least partially complementary to the sgRNA, upstream and downstream primers required for the isothermal amplification reaction, a detection probe, and a reaction mixture; Add DNA template and amplify the target gene. The reaction temperature is 16℃-65℃ and the reaction time is 5-10min. Adding double-stranded specific nuclease DSN and a reaction mixture to the components of the CRISPR detection system; After thorough mixing, the reaction system was placed at 25°C-37°C, and then a fluorescence quantitative PCR instrument was used to observe changes in the fluorescence signal.

9. An application of a CRISPR nucleic acid detection method, wherein the components of the CRISPR detection system described in any one of claims 1 to 6, the CRISPR detection kit described in claim 7, or the method for controllable CRISPR detection described in claim 8 are applied to the detection of single-stranded DNA or double-stranded DNA, and the application is for non-diagnostic purposes.

10. The use according to claim 9, for the gene detection of monkeypox virus, comprising using the components of the CRISPR detection system according to any one of claims 1 to 6, the CRISPR detection kit according to claim 7 or the method for controllable CRISPR detection according to claim 8, wherein: The upstream primer required for the isothermal amplification reaction is SEQ ID No. 2, and the downstream primer is SEQ ID No. 3; sgRNA is SEQ ID No. 4; The DNA sequence complementary to the sgRNA is SEQ ID No. 5; The detection probe is FAM-TTTATT-BHQ1.

Images