A reagent, method and application thereof for detecting single gene RNA G4 by fluorescence imaging

Abstract

The present invention relates to the field of nucleic acid fluorescence detection, and in particular to a reagent, method and application thereof for detecting single gene RNA G4 by fluorescence imaging. The present invention adopts RNA G4 structure targeting module and gene sequence targeting module, and through dual module targeting form, simultaneously binds to target gene sequence and rG4 structure, triggers click chemistry reaction triggered by spatial proximity, and then produces nucleic acid chain of specific sequence restored by click chemistry reaction; then the nucleic acid sequence is used as initiator chain, and through HCR reaction, triggers hairpin H1 and H2 to produce cascade reaction, obtains long repeated double-stranded DNA product, and can realize fluorescence signal amplification detection. This method has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid fluorescence detection, and in particular to a reagent, method and application thereof for detecting single gene RNA G4 by fluorescence imaging. Background Art

[0002] RNA plays an indispensable, complex, and multiple roles in many life processes, such as the classic DNA-to-protein conversion process around RNA metabolism, including splicing, localization, translation, and degradation. Recent studies have shown that RNA has other functions, such as acting as a signaling factor or scaffold, interacting with proteins, directing the subcellular localization of biological molecules, recruiting specific enzymes, etc. In order to gain a deeper understanding of RNA biological processes, researchers have developed RNA imaging tools with time, space, single-molecule resolution, and multiple analysis, combined with fluorescence microscopy, image processing, and sequencing technology, to achieve many milestone discoveries and promote the development of RNA biology. However, to date, there are still many unknowns about RNA-related life processes.

[0003] G-quadruplex (G4) is a special nucleic acid secondary structure formed by the folding of guanine-rich DNA or RNA. G4-seq, a high-throughput sequencing of the whole human genome based on enzyme arrest, found more than 700,000 potential DNA G4 (dG4) sites. RNA G4 (rG4) has also been shown to be widely present in RNA. rG4-seq sequencing has found hundreds of thousands of potential rG4 sites, many of which are located in key gene regulatory sites. The widespread existence of rG4 suggests that it is likely to have important functions.

[0004] rG4 is mainly enriched in the non-coding region of mRNA and exists in ncRNA. Studies have shown that rG4 plays an important role in RNA biology, cellular processes and human diseases, and is involved in regulating gene expression from transcription to protein synthesis, including transcriptional regulation, mRNA splicing, RNA transport and subcellular localization, RNA stability, and translation regulation. However, rG4 has a wide range of polymorphisms, and its dynamic folding and rich interactions with RNA-binding proteins (RBPs) (such as G4 helicases) increase the difficulty of our functional research. Therefore, developing a more functionally diverse and precise rG4 imaging technology to achieve single-molecule-level imaging of a single gene rG4 will help enhance our biological insights into the function of rG4 and its interaction with RBPs, which has important life science significance.

[0005] The existing rG4 detection methods can be divided into three stages. The first stage is represented by G4 antibodies or G4 small molecule fluorescent probes represented by BG4, QUMA-1 and BYBX, which can only achieve G4 structure-specific recognition and can image global G4. The second stage is represented by L-RNA aptamers, which can achieve relative gene selective imaging or intervention. The third stage is single gene specific rG4 imaging methods, including GTFH and MAMPA. GTFH can realize exogenous single gene rG4 imaging, but its disadvantage is that it lacks signal amplification function and cannot image endogenous rG4 at the single molecule level of cells. The advantage of MAMPA is that it uses the principle of rolling circle amplification (RCA) to achieve signal amplification of single gene rG4 imaging, which can achieve single molecule level rG4 imaging, but its disadvantage is that this method cannot be used in living cells, and the method is relatively complicated, requiring the use of a variety of enzymes and nucleic acid raw materials, with high technical difficulty and difficult to achieve.

[0006] Based on the above research status analysis, it is an urgent need in the field to develop a single gene rG4 imaging method that is easier to implement and has the potential for living cell imaging. This method is of great value for rG4 function research and drug development. Summary of the invention

[0007] In order to overcome the shortcomings and disadvantages of the prior art, the primary purpose of the present invention is to provide a reagent for detecting single gene RNA G4 (rG4) by fluorescence imaging, which includes an RNA G4 structure targeting module, a gene sequence targeting module, and hairpins H1 (modified with a fluorescent-quenching group) and H2. Through the dual-module targeting form, combined with click chemistry reaction and HCR reaction, accurate single gene rG4 fluorescence imaging can be achieved.

[0008] Another object of the present invention is to provide a method for detecting single gene RNA G4 (rG4) by fluorescence imaging, which method adopts the above-mentioned RNA G4 structure targeting module and gene sequence targeting module, and simultaneously binds to the rG4 structure and the target gene sequence, triggering a click chemistry reaction triggered by spatial proximity, thereby generating a nucleic acid chain of a specific sequence restored by the click chemistry reaction; then the nucleic acid sequence acts as a complete initiator chain I, through the HCR reaction, triggering a cascade reaction between the hairpin H1 (modified with a fluorescent-quenching group) and H2, to obtain a long repetitive double-stranded DNA product, thereby realizing fluorescence signal amplification detection.

[0009] Another object of the present invention is to provide the use of the above-mentioned reagent for detecting single gene RNA G4 by fluorescence imaging or the method for detecting single gene RNA G4 by fluorescence imaging.

[0010] The purpose of the present invention is achieved through the following technical solutions:

[0011] A reagent for detecting single gene RNA G4 by fluorescence imaging, comprising an RNA G4 structure targeting module, a gene sequence targeting module, and hairpins H1 and H2;

[0012] The nucleic acid sequence of the RNA G4 structure targeting module includes a cleavage initiation chain 1; the 5' end of the cleavage initiation chain 1 is connected or modified with a group that recognizes or targets the G4 structure, and the 3' end is connected or modified with a click group;

[0013] The nucleic acid sequence of the gene sequence targeting module at least includes a cleavage initiation chain 2 and a complementary sequence of the target gene RNA G4 flanking sequence; the 5' end of the nucleic acid sequence of the gene sequence targeting module is modified with a click group; wherein the click group of the RNA G4 structure targeting module and the click group of the gene sequence targeting module can undergo a click chemistry reaction, thereby forming a complete initiation chain I from the cleavage initiation chain 1 and the cleavage initiation chain 2;

[0014] The nucleic acid sequence of the hairpin H1 includes at least the reverse complementary strand of the cleavage initiating strand 2, the reverse complementary strand of the cleavage initiating strand 1, the cleavage initiating strand 1 and a partial sequence of the cleavage initiating strand 2, wherein the reverse complementary strand of the cleavage initiating strand 1 and the cleavage initiating strand 1 contain a number of base sequences a, and then the hairpin H1 folds back and complements to form a hairpin structure; the sequence of the hairpin H1 is connected or modified with a fluorescent group-quenching group, and when the hairpin structure is formed, the fluorescence is quenched, and when the hairpin structure is opened, the fluorescence is excited;

[0015] The nucleic acid sequence of the hairpin H2 includes at least cleavage initiating strand 1, cleavage initiating strand 2, the reverse complementary strand of the partial sequence of the cleavage initiating strand 2, the reverse complementary strand of the cleavage initiating strand 1 and the reverse complementary strand of the plurality of base sequences a.

[0016] The length of the cleavage initiating strands 1 and 2 can be 10-20 bp, and the partial sequence of the cleavage initiating strand 2 can be a portion of the 5' end of the cleavage initiating strand 2, which can stabilize the hairpin structure and thus prevent the free cleavage initiating strand from directly competing with the hairpin H1 to open it prematurely ( Figure 1 ); In the embodiment, the lengths of the cleavage initiating strands 1 and 2 are both 18 bp, and the length of the partial sequence of the cleavage initiating strand 2 is 6 bp;

[0017] The complementary sequence of the target gene RNA G4 flanking sequence may be 12 to 30 bp in length, and the preferred binding position of the sequence is 0 to 15 bases away from the RNA G4 structure (i.e., the distance between the G4 flanking sequence and G4 is 0 to 15 bases); in an embodiment, the complementary sequence of the target gene RNA G4 flanking sequence is 21 to 22 bp in length;

[0018] The cleavage initiating strand 2 and the complementary sequence of the target gene RNA G4 flanking sequence may further include a linker consisting of several bases;

[0019] The click group includes but is not limited to N3 (azide) group and DBCO (cyclooctyne) group; the click group may also be other groups that can undergo click chemical reactions, as long as similar click effects can be achieved within a certain structural variable range, thereby achieving similar imaging effects. Therefore, the protection scope of the present invention should not be limited in this respect.

[0020] The group that recognizes or targets the G4 structure includes but is not limited to the G4 structure targeting ligand BYBX derivative (for example, BYBX-5); the group that recognizes or targets the G4 structure may also be other G4 small molecule ligands, G4 targeting peptides, G4 targeting nucleic acid aptamers, G4 antibodies, etc., to achieve recognition or targeting of the G4 structure; any strategy that can achieve G4 structure recognition or targeting in the field can be used to assemble the single gene rG4 imaging reagent or method based on click chemistry and HCR proposed in this scheme, and therefore the protection scope of the present invention should not be limited in this respect;

[0021] The connection mode of the group that recognizes or targets the G4 structure and the cleavage initiation chain 1 includes but is not limited to covalent connection; as long as the connection mode can achieve similar connection effects within a certain variable range of reaction type, variable range of reaction conditions, and variable range of reactive group structure, the protection scope of the present invention should not be limited in this respect;

[0022] In the embodiment, the BYBX derivative is BYBX-5, and the covalent connection between the compound and the nucleic acid is achieved by using BYBX-5 precursor compound BYBC-5-NHS as a raw material and reacting the activated ester with the modified amino group on the nucleic acid;

[0023] The structural formula of BYBC-5-NHS is shown below:

[0024]

[0025] The fluorescent group-quenching group includes but is not limited to ROX and BHQ2, etc.; the fluorescent group-quenching group can also select other types of groups with fluorescence resonance energy transfer function or multiple pairs of combinations, so the protection scope of the present invention should not be limited in this aspect;

[0026] The reagent for detecting single gene RNA G4 by fluorescence imaging also includes a buffer solution and a fluorescent staining solution;

[0027] The buffer solution includes but is not limited to SSC buffer solution, and the fluorescent stain solution includes but is not limited to DAPI stain solution; the buffer solution and fluorescent stain solution may also be other buffer solutions and fluorescent stain solutions commonly used in the art, and therefore the protection scope of the present invention should not be limited in this respect;

[0028] In an embodiment, the gene sequence targeting module may specifically be:

[0029] (DBCO) ACTGTGTGACTAGATATCAAAAAAAAAATAT+the complementary sequence of the target gene RNA G4 flanking sequence;

[0030] A method for detecting single gene RNA G4 by fluorescence imaging comprises the following steps:

[0031] (1) Mixing the cell sample to be tested with the RNA G4 structure targeting module and the gene sequence targeting module in the above-mentioned reagent for detecting single gene RNA G4 by fluorescence imaging, incubating, and then washing the cells;

[0032] (2) Add hairpins H1 and H2 to the washed cells, incubate, and wash the cells;

[0033] (3) Add DAPI staining solution, wash cells, and detect;

[0034] The cell samples to be tested include but are not limited to cells; the samples to be tested may also be other types of samples, such as tissue sections, etc.;

[0035] The cells are fixed and permeabilized;

[0036] In the embodiment, the final concentration of the RNA G4 structure targeting module and the gene sequence targeting module in step (1) in the system is 0.5 μM; the final concentration of the hairpin H1 and H2 in step (1) in the system is 0.5 μM; the staining time in step (3) is 15 min, the detection system is 2×SSC buffer, the incubation time is 1-4 h, and the incubation temperature is 37°C; the concentration, molar ratio, incubation time and temperature of the above modules or nucleic acids in the present invention are not limited to the scope of the embodiments, as long as similar imaging effects can be achieved within a certain variable range, and therefore the protection scope of the present invention should not be limited in this respect;

[0037] In addition, the nucleic acid sequences of the priming strand and hairpin in the present invention are not limited to the sequences in the embodiments, as long as similar imaging effects can be achieved within a certain variable range, and therefore the protection scope of the present invention should not be limited in this respect;

[0038] Application of the reagent for detecting single gene RNA G4 by fluorescence imaging or the method for detecting single gene RNA G4 by fluorescence imaging in detecting RNA G4;

[0039] Application of the reagent for detecting single gene RNA G4 by fluorescence imaging or the method for detecting single gene RNA G4 by fluorescence imaging in screening drugs that regulate RNA G4 structure or function or screening proteins that bind to RNA G4;

[0040] The protein may be different G4 helicases, including but not limited to Dhx36, Dhx9, Blm, Wrn, Brip1, Ddx21 and Mov10;

[0041] A method for screening helicases comprises the following steps:

[0042] (1) Transfecting cells with the helicase to be tested;

[0043] (2) adding the RNAG4 structure targeting module and the gene sequence targeting module in the above reagent for detecting single gene RNA G4 by fluorescence imaging to the transfected cells, incubating, and then washing the cells;

[0044] (2) Add hairpins H1 and H2 to the washed cells, incubate, and wash the cells;

[0045] (3) Add DAPI staining solution, wash cells, and detect;

[0046] The application scenarios of the present invention include but are not limited to fixed cell imaging, and therefore the protection scope of the present invention should not be limited in this aspect.

[0047] In an embodiment, the imaging object selected by the present invention is a person BCL2 Gene mRNA 5'UTR region rG4 and human RANKL Gene mRNA 5'UTR region rG4; by changing the targeted gene sequence in the gene sequence targeting module, other single genes rG4 can be imaged in theory, so the protection scope of the present invention should not be limited in this aspect.

[0048] Principle of the present invention:

[0049] The present invention first analyzes the reasons why accurate single gene rG4 imaging is difficult:

[0050] (1) Single gene rG4 imaging generally requires a method that can simultaneously recognize the base sequence and G4 structure. Although the base sequences that form G4 are different, the G4 formed by different base sequences have similar spatial structures and charge distributions, while the traditional ligand-receptor binding mode mainly relies on the key principle or hydrogen bonding. As a result, traditional G4 small molecule ligands, G4 antibodies and other methods can generally only recognize the G4 structure but not the differences in its base sequence, or can only relatively selectively recognize G4 with a specific topological structure and still fail to achieve single gene specificity.

[0051] (2) Realizing single-gene rG4 imaging requires that the signal of the imaging method is strong enough to be detected. Among the methods that can currently achieve single-gene rG4 imaging, the GTFH method is a single G4 fluorescent ligand guided by a nucleic acid complementary chain. However, in this method, a single target G4 can only bind to one fluorescent signal. There is a lack of signal amplification strategy, which will result in signal loss and make it impossible to achieve single-molecule imaging. The MAMPA method uses a click reaction of two nucleic acid modules guided by a nucleic acid complementary chain and a G4 ligand, and uses the principle of rolling circle amplification (RCA) and corresponding enzymes, FISH probes, etc. to achieve signal amplification of single-gene rG4 imaging. However, this method requires reagents such as DNA ligase and DNA polymerase, and the implementation operation includes steps such as nucleic acid module binding incubation, locked ring DNA incubation, DNA ligation, rolling circle amplification, and FISH probe hybridization. It is relatively complicated and difficult to achieve.

[0052] After clarifying the reasons for the difficulty in accurate single gene rG4 imaging, the present invention solves the above problems by the following means:

[0053] (1) The present invention selects a dual-module targeting format to achieve precise single-gene rG4 imaging, in which one module has gene sequence targeting, and the other module realizes the recognition of rG4 structure. The two modules simultaneously bind to the target gene sequence and rG4 structure, which triggers the spatial proximity triggering click chemistry reaction and produces a nucleic acid chain of a specific sequence restored by the click chemistry reaction ( Figure 2 A).

[0054] (2) To achieve single-molecule imaging, the present invention selects hybridization chain reaction (HCR) as a signal amplification method, wherein the basic principle of HCR is as follows: Figure 2As shown in B: Only when the complete initiator chain DNA (Initiator, I) exists, the corresponding hairpin DNA 1 (Hairpin 1, H1) can be competitively bound by I, and its hairpin structure is opened, exposing a section of single-stranded DNA, which can compete for binding with hairpin DNA 2 (Hairpin 2, H2), opening the H2 hairpin structure and exposing another section of single-stranded DNA, which can compete for binding and open H1, and so on. Alternating competitive binding can form a long repetitive double-stranded DNA product, and by modifying the fluorescent group on the hairpin DNA, fluorescent signal amplification detection can be achieved.

[0055] (3) Based on the above principles (1) and (2), the present invention further combines click chemistry reaction and HCR to form a complete single gene rG4 imaging scheme. Specifically, the present invention uses the specific sequence restored by the click chemistry reaction as a complete priming chain. Only when the gene sequence targeting module and the RNA G4 structure targeting module simultaneously bind to the target G4, the click chemistry reaction will occur, thereby restoring the complete priming chain. Only the complete priming chain restored by the click chemistry reaction can trigger the HCR reaction, thereby causing H1 and H2 to be alternately turned on, fluorescence quenching to fail, long repetitive double-stranded DNA to be formed, and the fluorescence signal to be turned on, thereby realizing signal amplification detection of single gene rG4 ( Figure 2 C).

[0056] (4) The present invention first determined that the split initiation chain would not trigger HCR under appropriate conditions. The intact initiation chain and the split initiation chain were co-incubated with the hairpins H1 and H2 in a solution system at 37°C, respectively. After incubation for 2 h, agarose nucleic acid electrophoresis and gel imaging were performed. It was finally determined that when the molar ratio of the hairpin to the initiation chain was 1:(0.025~0.1), there was a high HCR positive response and a low unexpected initiation.

[0057] (5) It was further verified that the initiator chain restored by the click chemistry reaction can trigger the HCR reaction. The 5' end of one of the cleavage initiator chains was modified with a DBCO group, and the 3' end of the other cleavage initiator chain was modified with an azide group. In the solution system, the two cleavage initiator chains were assisted by an RNA auxiliary chain (Helper RNA) to undergo a click chemistry reaction. RNase A was then added to digest the RNA chain to release the complete initiator chain restored by the click chemistry reaction. The complete initiator chain restored by the click chemistry reaction was then incubated with H1 and H2. After a certain period of incubation, agarose nucleic acid electrophoresis and gel imaging were performed. The results showed that the complete initiator chain restored by the chemical reaction could normally trigger the HCR reaction, and the free module that was not restored did not trigger the HCR reaction.

[0058] (6) The present invention selects the 5'UTR region rG4 of the human BCL2 gene or RANKL gene mRNA as the imaging target, and endows the cleavage initiation chain with sequence targeting function and structure targeting function, that is, the cleavage initiation chain 1 is covalently linked to BYBX-5 and modified with N3 (azide) group at its 3' end, and the cleavage initiation chain 2 is covalently linked to the complementary chain of the target rG4 side sequence (CGGGGGCCAACGGCACCTCTC) and modified with DBCO (cyclooctyne) group at its 5' end, thereby synthesizing representative RNA G4 structure targeting module and gene sequence targeting module, which are respectively referred to as RNA G4 structure targeting module and gene sequence targeting module, forming a complete imaging solution.

[0059] (7) The present invention cultured 293T cells in a container such as a confocal culture dish, and after the cells adhered to the wall, the cells were fixed and permeabilized, and the above-mentioned RNA G4 structure targeting module (final concentration 0.5 μM) and gene sequence targeting module (final concentration 0.5 μM) were added and incubated at 37 degrees for 1 hour, and fluorescent hairpins H1 (final concentration 0.5 μM) and H2 (final concentration 0.5 μM) were added and incubated at 37 degrees for 2 hours, and DAPI was added for staining for 15 minutes. The cells were washed with 1×PBS or 2×SSC between each step, and finally photographed using a laser confocal microscope. The results showed that sporadic signals appeared in the cytoplasm of 293T cells, and the analysis showed that the signal was an imaging signal of rG4 in the 5'UTR region of the human BCL2 gene or RANKL gene mRNA.

[0060] (8) The present invention can also culture 293T cells in a container such as a confocal culture dish. After the cells adhere to the wall, the cells are transfected with different G4 helicases, including Dhx36, Dhx9, Blm, Wrn, Brip1, Ddx21 and Mov10, and then the corresponding gene (for example: human BCL2 gene) mRNA 5'UTR region rG4 is selected as the imaging target, and the above (7) process is used for imaging. Finally, a laser confocal microscope is used to take pictures. By quantitatively analyzing the fluorescence signal, the helicase with the dehelicating function of the gene rG4 can be screened.

[0061] The above experimental data fully demonstrate that the RNA G4 structure targeting module, gene sequence targeting module and corresponding hairpin nucleic acid proposed in the present invention can realize the imaging of single gene rG4 in cells, and the operation simplicity is much higher than the existing technical solutions.

[0062] Compared with the prior art, the present invention has the following advantages and effects:

[0063] (1) The present invention combines the basic principle of HCR as a signal amplification strategy to achieve signal amplification detection of rG4. Compared with the imaging method without signal amplification, the imaging signal of the present invention is stronger.

[0064] (2) The RNA G4 structure targeting module and the gene sequence targeting module of the present invention need to bind to the target G4 and its flanking sequence at the same time to cause a click chemistry reaction and then trigger the HCR reaction. Compared with the single-targeting method, the dual-module principle of the present invention has stronger imaging specificity.

[0065] (3) The present invention reveals that the fundamental reason for the difficulty in single-gene rG4 imaging is the difficulty in achieving specific recognition of the G4 sequence and the lack of a suitable signal amplification strategy. Based on this, the concept of combining click chemistry with HCR imaging of rG4 is proposed, thereby endowing the rG4 imaging method with the scientific idea and experimental method of high sequence specificity and high signal-to-noise ratio.

[0066] (4) The single gene rG4 imaging method based on click chemistry and HCR proposed in the present invention is much easier to operate than the existing technical solutions.

[0067] (5) The technical method disclosed in the present invention can be repeated by personnel with professional knowledge in the field and has high technical feasibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 It is a schematic diagram of the complete priming chain I, hairpin H1 and H2 structure and the complementary sequence position of the target gene RNA G4 flanking sequence, wherein A: a schematic diagram of the complete priming chain I, hairpin H1 and H2 structure, B: a schematic diagram of the complementary sequence position of the target gene RNA G4 flanking sequence.

[0069] Figure 2 It is a schematic diagram of the principle of the present invention, wherein A: the gene sequence targeting module and the RNA G4 structure targeting module simultaneously bind to the target gene sequence and the rG4 structure; B: whether the HCR is triggered when the initiator chain I exists or not; C: the G4 imaging principle based on click chemistry reaction and HCR.

[0070] Figure 3 It is a nucleic acid electrophoresis gel imaging image after the complete initiation chain or the split initiation chain triggers HCR.

[0071] Figure 4 This is a nucleic acid electrophoresis gel image after releasing the initiator chain recovered by the click chemistry reaction.

[0072] Figure 5 This is the nucleic acid electrophoresis gel imaging image after the initiator chain recovered by click chemistry reaction triggers HCR.

[0073] Figure 6This is a schematic diagram of the synthetic route of BYBC-5-NHS.

[0074] Figure 7 It is an intermediate of 1 H NMR spectrum (DMSO-d6).

[0075] Figure 8 This is the 1H NMR spectrum (DMSO-d6) of intermediate BC-5.

[0076] Fig. 9 This is the 1H NMR spectrum (DMSO-d6) of the intermediate BYBC-5.

[0077] Fig.10 This is the mass spectrum of the product BYBC-5-NHS.

[0078] Fig.11 It is the mass spectrum of the gene sequence targeting module.

[0079] Fig.12 This is a fixed cell imaging image of rG4 in the 5'UTR region of BCL2 gene mRNA and rG4 in the 5'UTR region of RANKL gene mRNA in 293T cells using a single gene rG4 imaging method based on click chemistry and HCR, wherein A: control group, B: rG4 in the 5'UTR region of BCL2 gene mRNA, C: rG4 in the 5'UTR region of RANKL gene mRNA. DETAILED DESCRIPTION

[0080] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0081] In the embodiment, the HCR buffer is 10 mM Tris-HCl buffer (containing 0.5 M NaCl and 0.1 M KCl), pH 7.4.

[0082] 1× PBS buffer: 20× PBS buffer (Shanghai Biotech B540627-0500) was diluted with DEPC-treated water (Ragen NR0001-500ml).

[0083] 2×SSC buffer: 20×SSC buffer (Shanghai Biotech B548110-0200) was diluted with DEPC-treated water (Ragen NR0001-500ml).

[0084] 5×DAPI staining solution: 1000×DAPI (5 mg / ml, Bio-Tech C1002) was diluted to 25 μg / ml with 2×SSC buffer.

[0085] Example 1 Preparation of Nucleic Acid Solution

[0086] The nucleic acid dry powder synthesized according to Table 1 (purchased from AGI Biotech, Shanghai Bioengineering, Beijing Qingke or Jinweizhi) was dissolved in HCR buffer or 2×SSC buffer to prepare a concentration of 100 μM or 10 μM.

[0087] Table 1 Related sequences in the examples

[0088] sequence name Sequence (5'-3') Complete initiation chain I CGGTGCCTCTGATTCCTGACTGTGTGACTAGATATC Card issuance H1 GATATCTAGTCACACAGTCAGGAATCAGAGGCACCGCTGTATTATGACCGGTGCCTCTGATTCCTGACTGTG Card issuance H2 CGGTGCCTCTGATTCCTGACTGTGTGACTAGATATCCACAGTCAGGAATCAGAGGCACCGGTCATAATACAG Card issuance H1 (ROX) <![CDATA[GATATCTAGTCACACAGTCAGGAA T(ROX) CAGAGGCACCGCTGTATTATGACCGGTGCCTCTGA T(BHQ2) TCCTGACTGTG]]> <![CDATA[Split-induced strand 1 (I 分裂1 )]]> CGGTGCCTCTGATTCCTG <![CDATA[Split-induced strand 2 (I 分裂2 )]]> ACTGTGTGACTAGATATC <![CDATA[Cleavage-induced strand 1-N3 (I 分裂1 -N3)]]> <![CDATA[CGGTGCCTCTGATTCCTG(N3)]]> <![CDATA[Split-induced chain 2-DBCO (I 分裂2 -DBCO)]]> (DBCO)ACTGTGTGACTAGATATC BCL2 gene sequence targeting module (DBCO)ACTGTGTGACTAGATATCAAAAAAAAAATATCGGGGGCCAACGGCACCTCTC RANKL gene sequence targeting module (DBCO)ACTGTGTGACTAGATATCAAAAAAAAAATATCCCTCTCGCTTCGGAGCTTCC RNA G4 structure targeting module <![CDATA[(BYBX-5)TATCGGTGCCTCTGATTCCTG(N3)]]> Helper RNA UAGUCACACAGUCAGGAAUCAGAG

[0089] Note: The fluorescent group and the quencher group (ROX and BHQ2) are modified on the bold nucleic acid. When the hairpin H1 (ROX) forms a hairpin structure, the fluorescent group and the quencher group (ROX and BHQ2) are close to each other, and the fluorescence of the fluorescent group (ROX) will be absorbed by the quencher group (BHQ2), so no fluorescence is shown; if the hairpin is opened, the fluorescent group and the quencher group are far away (the spatial distance becomes longer), and the quencher group (BHQ2) cannot absorb the fluorescence of the fluorescent group (ROX), and the fluorescence of the fluorescent group (ROX) is revealed.

[0090] Example 2 Annealing of hairpin nucleic acid

[0091] Place the prepared hairpin DNA (H1, H2) in a metal bath, heat to 95°C for 5 min, then slowly cool it to 30°C. After cooling, store it at 4°C or -20°C.

[0092] Example 3 Screening of conditions for cleavage initiation chain not initiating HCR with hairpin

[0093] In the HCR buffer system, different concentrations of intact initiator chain I, split initiator chain (I 分裂1 and I 分裂2 ) were incubated with hairpin H1 and H2 (final concentration 1 μM) at 37°C for 2 h. After incubation, nucleic acid electrophoresis (120 V, 45 min) was performed in 3% agarose gel (high-purity low-electrosmotic agarose, Sevier Bio GC205013-100g; SerRed nucleic acid dye, Sevier Bio G3606) and 1×TAE (50×TAE, Sevier Bio G3001-500ML, diluted to 1× with deionized water) and recorded using a gel imager.

[0094] The experimental results are as follows Figure 3 As shown, compared with the negative control ( Figure 2 Compared with the fourth lane), when the molar ratio of complete priming chain I, hairpin 1 and hairpin 2 is (0.025~0.1):1:1, it has a high HCR positive response; I 分裂1 ,I 分裂2When the molar ratio of the hairpin H1 and H2 is (0.25~1):(0.25~1):1:1, there is also HCR response (unexpected initiation), but with the split initiation chain I 分裂1 and I 分裂2 As the concentration in the system decreases, that is, the molar ratio of the split initiation chain and the hairpin decreases, the HCR response (unexpected initiation) gradually decreases. 分裂1 ,I 分裂2 When the molar ratio of hairpins H1 and H2 is (0.025~0.1): (0.025~0.1):1:1, the response of unexpected initiation is low, while when the molar ratio of complete initiator chain I, hairpin 1 and hairpin 2 is (0.025~0.1):1:1, there is a high HCR positive response. It can be seen that the molar ratio of the initiator chain and the hairpin is very important. By controlling their concentration and molar ratio, the positive signal can be much larger than the background signal, and the signal-to-noise ratio can be high enough.

[0095] Example 4: Verification that the initiation chain of click chemistry recovery can trigger HCR reaction

[0096] (1) In the HCR buffer system, the cleavage initiator chain 1-N3 (I 分裂1 -N3, 3' end covalently linked to N3 group), cleavage initiator chain 2-DBCO (I 分裂2 -DBCO, with a DBCO group covalently linked to the 5' end) and Helper RNA (purchased from GENEWISE) were mixed at a molar ratio of 1:1:1 or 2:2:1 and incubated at 37°C for 1.5 h to allow the two modules to undergo click chemistry reaction, wherein the final concentrations of the cleavage initiator strand 1-N3 and cleavage initiator strand 2-DBCO were 2 μM, and the final concentration of the Helper RNA was 2 μM or 1 μM;

[0097] (2) Then, RNase A (Tiangen Biochemical RT405-02, final concentration 10 ng / ml) was added to the product obtained in step (1) and incubated at 37°C for 0.5 h to digest the RNA chain and release the trigger chain recovered by the click chemistry reaction. Some groups were sampled and temporarily stored at 4°C for subsequent testing;

[0098] (3) diluting the system containing the initiator chain recovered by the click chemistry reaction obtained in step (2), and incubating it with the hairpins H1 and H2 at a certain molar ratio at 37°C for 2 h;

[0099] (4) The samples obtained in steps (2) and (3) were subjected to nucleic acid electrophoresis (120 V, 45 min) in a 3% agarose gel and 1×TAE and recorded using a gel imager.

[0100] Figure 4This is a nucleic acid electrophoresis gel imaging image of the primer chains released by steps (2) and (3) for click chemistry reaction recovery. When the split primer chains 1-N3 and split primer chains 2-DBCO complement the helper RNA to form a DNA-RNA hybrid chain (lanes 5 and 6), the click groups are close in space, and the click chemistry reaction will occur; after the hybrid chain is digested with RNase A, the primer chains for click chemistry reaction recovery are obtained (lanes 7 and 8); in the absence of helper RNA, the split primer chains 1-N3 and split primer chains 2-DBCO will not click spontaneously.

[0101] Figure 5 This is the nucleic acid electrophoresis gel imaging image after the initiator chain restored by the click chemistry reaction triggered HCR. It can be seen from the figure that when the concentrations of the split initiator chain 1-N3 and the split initiator chain 2-DBCO in the reaction system are 0.025~0.05 μM, and the final concentrations of H1 and H2 are 1 μM, the initiator chain restored by the click chemistry reaction can trigger the HCR reaction normally, and the free modules that have not been restored hardly trigger the HCR reaction.

[0102] Example 5 Synthesis of BYBC-5-NHS, the precursor compound of G4 ligand derivative BYBX-5

[0103] The synthetic route of BYBC-5-NHS is as follows Figure 6 As shown, the specific synthesis method is:

[0104] (1) Synthesis of intermediate BY: 2-Methylthiobenzothiazole (5.0 mmol) was placed in a reaction flask, 5.0 ml of acetonitrile was added as solvent, and then an excess of methyl iodide (15.0 mmol) was added. The mixture was heated to 80°C in a sealed and light-proof environment, and the reaction was stirred at a constant temperature for about 8 h. After confirming that the reaction raw materials were completely converted into products by thin layer chromatography, 10.0 ml of ethyl acetate was added to fully precipitate the intermediate BY. After standing for 10 min, the filter cake was filtered and dried to obtain a white intermediate BY product with a yield of 78%. Figure 7 For 1 H NMR spectrum (DMSO-d6).

[0105] 1 H NMR (400 MHz, DMSO-d6, 25 ℃)δ 8.41 (d, J = 8.1 Hz, 1H), 8.20 (d, J= 8.4 Hz, 1H), 7.85 (t, J = 7.4 Hz, 1H), 7.73 (t, J = 7.5 Hz, 1H), 4.12 (s,3H), 3.13 (s,3H).

[0106] (2) Synthesis of intermediate BC-5: 1,1,2-trimethyl-1H-benz[e]indole (5.0 mmol) was placed in a reaction flask, 5.0 ml of acetonitrile was added as solvent, and then an excess of bromohexanoic acid (10.0 mmol) was added. The mixture was heated to 110°C in a sealed and light-proof environment, and the reaction was stirred at a constant temperature for about 12 h. After confirming that the reaction raw materials were completely converted into products by thin layer chromatography, 10.0 ml of ethyl acetate was added to fully precipitate the intermediate BC-5. After standing for 10 min, the filter cake was filtered and dried to obtain a light yellow intermediate BC-5 product with a yield of 60%. Figure 8 for 1 H NMR spectrum (DMSO-d6).

[0107] 1 H NMR (400 MHz, DMSO) δ 12.03 (s, 1H), 8.38 (d, J = 8.3 Hz, 1H), 8.30 (d, J = 8.9 Hz, 1H), 8.22 (d, J = 7.9 Hz, 1H), 8.16 (d, J = 8.9 Hz, 1H),7.79 (t, J = 7.0 Hz, 1H), 7.73 (t, J = 7.1 Hz, 1H), 4.59 (t, J = 7.6 Hz, 2H),2.95 (s, 3H), 2.24 (t, J = 7.2 Hz, 2H), 1.91 (dt, 2H), 1.77 (s, 6H), 1.58(dt, J = 14.5, 7.2 Hz, 2H), 1.46 (dt, 2H).

[0108] (3) Synthesis of intermediate BYBC-5: The intermediate BY (1 mmol) prepared in step (1) and BC-5 (1 mmol) prepared in step (2) were placed in a reaction flask, 5.0 ml of acetonitrile was added as a solvent, and triethylamine (1 mmol) was added as a catalyst. The solid was dissolved by ultrasonic vibration, heated to 75°C, and the reaction was stirred at a constant temperature for about 8 h. After confirming the formation of obvious main product spots by thin layer chromatography, the reaction solution was filtered to obtain a filter cake, which was then washed with a small amount of acetonitrile and dried to obtain an orange product BYBC-5 with a yield of 58%. Fig. 9 For 1 H NMR spectrum (DMSO-d6).

[0109] δ 11.98 (s, 1H), 8.20 (d, J = 8.1 Hz, 2H), 8.09 (d, J= 5.8 Hz, 1H), 8.06(d, J = 5.0 Hz, 1H), 7.99 (d, J = 8.4 Hz, 1H), 7.76 (d, J = 8.9 Hz, 1H), 7.71 (t,1H), 7.67 (t, 1H), 7.56 (t, 1H), 7.51 (t, 1H), 6.16 (s, 1H), 4.32 (t, J = 7.1Hz, 2H), 4.07 (s, 3H), 2.18 (t, J = 7.2 Hz, 2H), 2.06 (s, 6H), 1.83 – 1.74 (m,3H), 1.57 – 1.48 (m, 2H), 1.42 – 1.33 (m, 2H).

[0110] (4) Synthesis of intermediate BYBC-5-NHS: The intermediate BYBC-5 (1 mmol) prepared in step (3) was dissolved in 5 ml DMF (N,N-dimethylformamide), and the BYBC-5 DMF solution was protected with nitrogen in a reaction flask. DIPEA (N,N-diisopropylethylamine, 1 mmol) was added to the reaction flask. DCC (dicyclohexylcarbodiimide, 1.3 mmol) was dissolved in 3 ml DMF, and the DCC DMF solution was added to the reaction flask. NHS (N-hydroxysuccinimide, 2 mmol) was dissolved in 2 ml DMF, and the NHS DMF solution was added to the reaction flask. The reaction was stirred at room temperature for about 24 h. After confirming the formation of obvious main product spots by thin layer chromatography, 200 ml petroleum ether was added to precipitate the product. After standing at 4°C for 1 h, the solution was gently discarded. The oily product at the bottom of the flask was dried in a vacuum oven at room temperature for 24 h. After drying, 3 The product was washed with 1 ml of dichloromethane, and the solid-liquid mixture was filtered to obtain a filter cake, which was dried to obtain an orange product BYBC-5-NHS with a yield of 40%. Fig.10 Its mass spectrum.

[0111] HRMS m / z: calcd for C 33 H 34 N3O4S + , [MI] + =568.23, found 568.21.

[0112] Example 6 Synthesis of rG4 imaging module targeting the 5'UTR region of human BCL2 gene mRNA

[0113] (1) Guangzhou Aiji Biotechnology was commissioned to synthesize the cleavage initiator chain 2 and covalently connect the DBCO group to the 5' end, and covalently connect the complementary chain of the rG4 flanking sequence of the BCL2 gene (CGGGGGCCAACGGCACCTCTC) to the 3' end, which was called the BCL2 gene sequence targeting module (Table 1);

[0114] (2) BYBC-5-NHS raw material was provided, and Guangzhou Aiji Bio was commissioned to synthesize RNA G4 structure targeting module (Table 1). Its sequence structure was split initiator chain 1, BYBX-5 was covalently linked to its 5' end, and N3 (azido) group was modified at its 3' end. Its mass spectrum was as follows: Fig.11 As shown;

[0115] (3) Entrust Qingke Biotechnology to introduce ROX groups and BHQ2 groups (Table 1) on the hairpin H1 to synthesize H1 (ROX). When H1 folds back to form a hairpin structure, the fluorescence is quenched; the hairpin H2 is the same as the previous embodiment;

[0116] The above-mentioned BCL2 gene sequence targeting module, RNA G4 structure targeting module, H1 (ROX) and H2 constitute a complete imaging solution.

[0117] Example 7 Fixed cell imaging of rG4 targeting the 5'UTR region of human BCL2 gene mRNA

[0118] (1) 293T cells (human embryonic kidney cells, SCSP-502 from Shanghai Cell Bank, Chinese Academy of Sciences) were inoculated in DMEM culture medium (Gibco, C11995500BT) containing 10% fetal bovine serum (FBS, FSP500 from Icosai) and 1% double antibody (white shark BL505A), and cultured and passaged in a cell culture incubator at 37°C and 5% CO2. After passage, 293T cells were cultured at 1×10 4 The cells were plated at a density of 10 cells / mL in a confocal dish (confocal, White Shark BS-20-GJM). After culturing for 12 hours, the cells were observed to have attached to the wall and washed once with 1 ml 1×PBS. The cells were fixed at room temperature for 15 min with 1 ml universal tissue fixative (neutral) (Sevier Bio G1101-500ML) and washed once with 1 ml 1×PBS. The cells were permeabilized with 1 ml 1×PBS containing 0.5% v / v Trion-X100 at room temperature for 5 min and washed twice with 1 ml 1×PBS.

[0119] (2) The cells were divided into two groups, a treatment group and a control group. The treatment group was added with 0.2 ml of 2×SSC buffer containing the RNA G4 structure targeting module and 0.2 ml of 2×SSC buffer containing the BCL2 gene sequence targeting module, respectively, so that their final concentrations in the incubation system were both 0.5 μM. The control group was added with 0.4 ml of 2×SSC buffer. The cells were incubated at 37°C for 1 h and washed three times with 1 ml of 2×SSC buffer to remove unreacted modules.

[0120] (3) Add 0.2 ml of 2×SSC buffer containing fluorescent hairpin H1 (ROX) and 0.2 ml of 2×SSC buffer containing H2 to the system after washing in step (2), so that the final concentration in the incubation system is 0.5 μM; incubate at 37°C for 2 h;

[0121] (4) Add 0.1 ml of 5×DAPI staining solution and stain for 15 min. Wash three times with 1 ml of 2×SSC buffer and finally photograph using a laser confocal microscope.

[0122] The results are as follows Fig.12 shown. Fig.12 A shows that the control group did not add the gene sequence targeting module and RNA G4 structure targeting module. When only H1 and H2 were present, the HCR reaction could not be triggered and there was no ROX fluorescence signal. Fig.12 In Figure B, obvious ROX fluorescence signals appeared in the cytoplasm of 293T cells, indicating that the gene sequence targeting module and the RNA G4 structure targeting module were successfully combined with BCL2 The 5'UTR region of the gene mRNA rG4 is then restored to the complete initiation chain; the restored initiation chain triggers the HCR reaction, causing H1 and H2 to open alternately, the fluorescence quenching to fail, and a long repetitive double-stranded DNA to be formed, and the fluorescence signal is turned on, thereby achieving BCL2 Signal amplification detection of gene rG4.

[0123] Example 8 Synthesis of rG4 imaging module targeting the 5'UTR region of human RANKL gene mRNA

[0124] (1) Guangzhou Aiji Biotechnology was commissioned to synthesize the cleavage initiation chain 2 and covalently connect the DBCO group at the 5' end, and covalently connect the complementary chain of the RANKL gene rG4 flanking sequence (CCCTCTCGCTTCGGAGCTCTCC) at the 3' end, which is called the RANKL gene sequence targeting module (Table 1);

[0125] (2) RNA G4 structure targeting module is the same as in Example 6;

[0126] (3) H1 (ROX) and H2 are the same as in Example 6;

[0127] The above-mentioned RANKL gene sequence targeting module, RNA G4 structure targeting module, H1 (ROX) and H2 constitute a complete imaging solution.

[0128] Example 9 Fixed cell imaging of human RANKL gene mRNA 5'UTR region rG4

[0129] (1) 293T cells (human embryonic kidney cells, SCSP-502 from Shanghai Cell Bank, Chinese Academy of Sciences) were inoculated in DMEM culture medium (Gibco, C11995500BT) containing 10% fetal bovine serum (FBS, FSP500 from Icosai) and 1% double antibody (white shark BL505A), and cultured and passaged in a cell culture incubator at 37°C and 5% CO2. After passage, 293T cells were cultured at 1×10 4 The cells were plated at a density of 10 cells / mL in a confocal dish (confocal, White Shark BS-20-GJM). After culturing for 12 hours, the cells were observed to have attached to the wall and washed once with 1 ml 1×PBS. The cells were fixed at room temperature for 15 min with 1 ml universal tissue fixative (neutral) (Sevier Bio G1101-500ML) and washed once with 1 ml 1×PBS. The cells were permeabilized with 1 ml 1×PBS containing 0.5% v / v Trion-X100 at room temperature for 5 min and washed twice with 1 ml 1×PBS.

[0130] (2) The cells were divided into two groups, a treatment group and a control group. The treatment group was added with 0.2 ml of 2×SSC buffer containing the RNA G4 structure targeting module and 0.2 ml of 2×SSC buffer containing the RANKL gene sequence targeting module, respectively, so that their final concentrations in the incubation system were both 0.5 μM. The control group was added with 0.4 ml of 2×SSC buffer. The cells were incubated at 37°C for 1 h and washed three times with 1 ml of 2×SSC buffer to remove unreacted modules.

[0131] (3) Add 0.2 ml of 2×SSC buffer containing fluorescent hairpin H1 (ROX) and 0.2 ml of 2×SSC buffer containing H2 to the system after washing in step (2), so that the final concentration in the incubation system is 0.5 μM; then incubate at 37°C for 2 h;

[0132] (4) Add 0.1 ml of 5×DAPI staining solution and stain for 15 min. Wash three times with 1 ml of 2×SSC buffer and finally photograph using a laser confocal microscope.

[0133] The results are as follows Fig.12The results showed that the control group did not have the gene sequence targeting module and RNA G4 structure targeting module, and only H1 and H2 were present, which could not trigger the HCR reaction and there was no ROX fluorescence signal ( Fig.12 The treatment group ( Fig.12 C) A more obvious signal appears in the cytoplasm of 293T cells, indicating RANKL The gene sequence targeting module and RNA G4 structure targeting module were successfully combined into RANKL The 5'UTR region of the gene mRNA rG4 is then restored to the complete initiation chain; the restored initiation chain triggers the HCR reaction, causing H1 and H2 to open alternately, the fluorescence quenching to fail, and a long repetitive double-stranded DNA to be formed, and the fluorescence signal is turned on, thereby achieving RANKL Signal amplification detection of gene rG4.

[0134] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A reagent for detecting single gene RNA G-quadruplexes by fluorescence imaging, characterized in that It includes RNA G-quadruplex structure targeting module, gene sequence targeting module and hairpins H1 and H2; The nucleic acid sequence of the RNA G-quadruplex structure targeting module includes a cleavage initiating strand 1; the 5' end of the cleavage initiating strand 1 is connected or modified with a group that recognizes or targets the G-quadruplex structure, and the 3' end is connected or modified with a click group; The nucleic acid sequence of the gene sequence targeting module at least includes a cleavage initiation strand 2 and a complementary sequence of a target gene RNA G-quadruplex flanking sequence; the 5' end of the nucleic acid sequence of the gene sequence targeting module is modified with a click group; wherein the click group of the RNA G-quadruplex structure targeting module and the click group of the gene sequence targeting module can undergo a click chemistry reaction, thereby forming a complete initiation strand I from the cleavage initiation strand 1 and the cleavage initiation strand 2; The nucleic acid sequence of the hairpin H1 is composed of the reverse complementary strand of the cleavage initiating strand 2, the reverse complementary strand of the cleavage initiating strand 1, the cleavage initiating strand 1 and a part of the cleavage initiating strand 2, wherein the reverse complementary strand of the cleavage initiating strand 1 and the cleavage initiating strand 1 contain a number of base sequences a, and then the hairpin H1 folds back and complements to form a hairpin structure; the sequence of the hairpin H1 is connected or modified with a fluorescent group-quenching group, and when the hairpin structure is formed, the fluorescence is quenched, and when the hairpin structure is opened, the fluorescence is excited; The nucleic acid sequence of the hairpin H2 is composed of cleavage initiating strand 1, cleavage initiating strand 2, the reverse complementary strand of the partial sequence of the cleavage initiating strand 2, the reverse complementary strand of the cleavage initiating strand 1 and the reverse complementary strand of the plurality of base sequences a. The lengths of the cleavage initiating chain 1 and the cleavage initiating chain 2 are 10-20 bp, and the partial sequence of the cleavage initiating chain 2 is a part of the 5' end of the cleavage initiating chain 2; The length of the complementary sequence of the target gene RNA G-quadruplex side sequence is 12 to 30 bp.

2. The reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to claim 1, characterized in that: The click groups are N3 groups and DBCO groups.

3. The reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to claim 1, characterized in that: The group that recognizes or targets the G-quadruplex structure is the G-quadruplex structure targeting ligand BYBX-5, and the covalent connection between the compound and the nucleic acid is as follows: BYBX-5 precursor compound BYBC-5-NHS is used as a raw material, and the connection is completed by reacting the activated ester with the modified amino group on the nucleic acid; The structural formula of BYBC-5-NHS is shown below: 。 4. The reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to claim 1, characterized in that: The fluorescent group-quenching group is ROX and BHQ2.

5. The reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to claim 1, characterized in that: The reagent also includes a buffer solution and a fluorescent staining solution.

6. A method for detecting single gene RNA G-quadruplexes by fluorescence imaging, characterized in that The following steps are included: (1) mixing the sample to be tested with the RNA G-quadruplex structure targeting module and the gene sequence targeting module in the reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to any one of claims 1 to 5, incubating, and then washing the cells; (2) Add hairpins H1 and H2 to the washed cells, incubate, and wash the cells; (3) Add DAPI staining solution, wash cells, and detect; The methods described do not include the purpose of disease treatment and diagnosis.

7. Use of the reagent for detecting single gene RNA G-quadruplex by fluorescence imaging according to any one of claims 1 to 5 or the method for detecting single gene RNA G-quadruplex by fluorescence imaging according to claim 6 in detecting RNA G-quadruplex, characterized in that: The applications described do not include the purpose of disease treatment and diagnosis.

Images